ID: 902838967

View in Genome Browser
Species Human (GRCh38)
Location 1:19063441-19063463
Sequence TTGGTGTCACCGCCGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838967_902838975 7 Left 902838967 1:19063441-19063463 CCACCCTCCGGCGGTGACACCAA No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838967_902838973 -4 Left 902838967 1:19063441-19063463 CCACCCTCCGGCGGTGACACCAA No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838967_902838980 25 Left 902838967 1:19063441-19063463 CCACCCTCCGGCGGTGACACCAA No data
Right 902838980 1:19063489-19063511 CCTGGACGCTGTCTCAGTGAGGG No data
902838967_902838971 -5 Left 902838967 1:19063441-19063463 CCACCCTCCGGCGGTGACACCAA No data
Right 902838971 1:19063459-19063481 ACCAATGTCCTCTTGTTCCCTGG No data
902838967_902838978 24 Left 902838967 1:19063441-19063463 CCACCCTCCGGCGGTGACACCAA No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838967 Original CRISPR TTGGTGTCACCGCCGGAGGG TGG (reversed) Intergenic