ID: 902838968

View in Genome Browser
Species Human (GRCh38)
Location 1:19063444-19063466
Sequence ACATTGGTGTCACCGCCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838968_902838973 -7 Left 902838968 1:19063444-19063466 CCCTCCGGCGGTGACACCAATGT No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838968_902838978 21 Left 902838968 1:19063444-19063466 CCCTCCGGCGGTGACACCAATGT No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data
902838968_902838981 30 Left 902838968 1:19063444-19063466 CCCTCCGGCGGTGACACCAATGT No data
Right 902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG No data
902838968_902838980 22 Left 902838968 1:19063444-19063466 CCCTCCGGCGGTGACACCAATGT No data
Right 902838980 1:19063489-19063511 CCTGGACGCTGTCTCAGTGAGGG No data
902838968_902838975 4 Left 902838968 1:19063444-19063466 CCCTCCGGCGGTGACACCAATGT No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838968_902838971 -8 Left 902838968 1:19063444-19063466 CCCTCCGGCGGTGACACCAATGT No data
Right 902838971 1:19063459-19063481 ACCAATGTCCTCTTGTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838968 Original CRISPR ACATTGGTGTCACCGCCGGA GGG (reversed) Intergenic