ID: 902838969

View in Genome Browser
Species Human (GRCh38)
Location 1:19063445-19063467
Sequence GACATTGGTGTCACCGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838969_902838978 20 Left 902838969 1:19063445-19063467 CCTCCGGCGGTGACACCAATGTC No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data
902838969_902838971 -9 Left 902838969 1:19063445-19063467 CCTCCGGCGGTGACACCAATGTC No data
Right 902838971 1:19063459-19063481 ACCAATGTCCTCTTGTTCCCTGG No data
902838969_902838973 -8 Left 902838969 1:19063445-19063467 CCTCCGGCGGTGACACCAATGTC No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838969_902838975 3 Left 902838969 1:19063445-19063467 CCTCCGGCGGTGACACCAATGTC No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838969_902838981 29 Left 902838969 1:19063445-19063467 CCTCCGGCGGTGACACCAATGTC No data
Right 902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG No data
902838969_902838980 21 Left 902838969 1:19063445-19063467 CCTCCGGCGGTGACACCAATGTC No data
Right 902838980 1:19063489-19063511 CCTGGACGCTGTCTCAGTGAGGG No data
902838969_902838982 30 Left 902838969 1:19063445-19063467 CCTCCGGCGGTGACACCAATGTC No data
Right 902838982 1:19063498-19063520 TGTCTCAGTGAGGGTGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838969 Original CRISPR GACATTGGTGTCACCGCCGG AGG (reversed) Intergenic