ID: 902838972

View in Genome Browser
Species Human (GRCh38)
Location 1:19063460-19063482
Sequence CCCAGGGAACAAGAGGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838972_902838983 24 Left 902838972 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
Right 902838983 1:19063507-19063529 GAGGGTGCAGTGGGTAAGCTTGG No data
902838972_902838982 15 Left 902838972 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
Right 902838982 1:19063498-19063520 TGTCTCAGTGAGGGTGCAGTGGG No data
902838972_902838981 14 Left 902838972 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
Right 902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG No data
902838972_902838980 6 Left 902838972 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
Right 902838980 1:19063489-19063511 CCTGGACGCTGTCTCAGTGAGGG No data
902838972_902838978 5 Left 902838972 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838972 Original CRISPR CCCAGGGAACAAGAGGACAT TGG (reversed) Intergenic