ID: 902838973

View in Genome Browser
Species Human (GRCh38)
Location 1:19063460-19063482
Sequence CCAATGTCCTCTTGTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838967_902838973 -4 Left 902838967 1:19063441-19063463 CCACCCTCCGGCGGTGACACCAA No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838966_902838973 -3 Left 902838966 1:19063440-19063462 CCCACCCTCCGGCGGTGACACCA No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838968_902838973 -7 Left 902838968 1:19063444-19063466 CCCTCCGGCGGTGACACCAATGT No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838965_902838973 -2 Left 902838965 1:19063439-19063461 CCCCACCCTCCGGCGGTGACACC No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838969_902838973 -8 Left 902838969 1:19063445-19063467 CCTCCGGCGGTGACACCAATGTC No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838961_902838973 15 Left 902838961 1:19063422-19063444 CCACACGCCTCTCAGCGCCCCAC No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838960_902838973 25 Left 902838960 1:19063412-19063434 CCACTTGCTACCACACGCCTCTC No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838962_902838973 8 Left 902838962 1:19063429-19063451 CCTCTCAGCGCCCCACCCTCCGG No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838973 Original CRISPR CCAATGTCCTCTTGTTCCCT GGG Intergenic