ID: 902838975

View in Genome Browser
Species Human (GRCh38)
Location 1:19063471-19063493
Sequence TTGTTCCCTGGGACAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838965_902838975 9 Left 902838965 1:19063439-19063461 CCCCACCCTCCGGCGGTGACACC No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838966_902838975 8 Left 902838966 1:19063440-19063462 CCCACCCTCCGGCGGTGACACCA No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838967_902838975 7 Left 902838967 1:19063441-19063463 CCACCCTCCGGCGGTGACACCAA No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838968_902838975 4 Left 902838968 1:19063444-19063466 CCCTCCGGCGGTGACACCAATGT No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838969_902838975 3 Left 902838969 1:19063445-19063467 CCTCCGGCGGTGACACCAATGTC No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838961_902838975 26 Left 902838961 1:19063422-19063444 CCACACGCCTCTCAGCGCCCCAC No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838962_902838975 19 Left 902838962 1:19063429-19063451 CCTCTCAGCGCCCCACCCTCCGG No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838970_902838975 0 Left 902838970 1:19063448-19063470 CCGGCGGTGACACCAATGTCCTC No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838975 Original CRISPR TTGTTCCCTGGGACAGAGCC TGG Intergenic