ID: 902838977

View in Genome Browser
Species Human (GRCh38)
Location 1:19063477-19063499
Sequence CAGCGTCCAGGCTCTGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838977_902838983 7 Left 902838977 1:19063477-19063499 CCTGGGACAGAGCCTGGACGCTG No data
Right 902838983 1:19063507-19063529 GAGGGTGCAGTGGGTAAGCTTGG No data
902838977_902838981 -3 Left 902838977 1:19063477-19063499 CCTGGGACAGAGCCTGGACGCTG No data
Right 902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG No data
902838977_902838982 -2 Left 902838977 1:19063477-19063499 CCTGGGACAGAGCCTGGACGCTG No data
Right 902838982 1:19063498-19063520 TGTCTCAGTGAGGGTGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838977 Original CRISPR CAGCGTCCAGGCTCTGTCCC AGG (reversed) Intergenic