ID: 902838978

View in Genome Browser
Species Human (GRCh38)
Location 1:19063488-19063510
Sequence GCCTGGACGCTGTCTCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838968_902838978 21 Left 902838968 1:19063444-19063466 CCCTCCGGCGGTGACACCAATGT No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data
902838970_902838978 17 Left 902838970 1:19063448-19063470 CCGGCGGTGACACCAATGTCCTC No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data
902838965_902838978 26 Left 902838965 1:19063439-19063461 CCCCACCCTCCGGCGGTGACACC No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data
902838966_902838978 25 Left 902838966 1:19063440-19063462 CCCACCCTCCGGCGGTGACACCA No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data
902838967_902838978 24 Left 902838967 1:19063441-19063463 CCACCCTCCGGCGGTGACACCAA No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data
902838974_902838978 -2 Left 902838974 1:19063467-19063489 CCTCTTGTTCCCTGGGACAGAGC No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data
902838972_902838978 5 Left 902838972 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data
902838969_902838978 20 Left 902838969 1:19063445-19063467 CCTCCGGCGGTGACACCAATGTC No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838978 Original CRISPR GCCTGGACGCTGTCTCAGTG AGG Intergenic