ID: 902838981

View in Genome Browser
Species Human (GRCh38)
Location 1:19063497-19063519
Sequence CTGTCTCAGTGAGGGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838969_902838981 29 Left 902838969 1:19063445-19063467 CCTCCGGCGGTGACACCAATGTC No data
Right 902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG No data
902838976_902838981 -2 Left 902838976 1:19063476-19063498 CCCTGGGACAGAGCCTGGACGCT No data
Right 902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG No data
902838974_902838981 7 Left 902838974 1:19063467-19063489 CCTCTTGTTCCCTGGGACAGAGC No data
Right 902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG No data
902838968_902838981 30 Left 902838968 1:19063444-19063466 CCCTCCGGCGGTGACACCAATGT No data
Right 902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG No data
902838970_902838981 26 Left 902838970 1:19063448-19063470 CCGGCGGTGACACCAATGTCCTC No data
Right 902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG No data
902838972_902838981 14 Left 902838972 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
Right 902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG No data
902838977_902838981 -3 Left 902838977 1:19063477-19063499 CCTGGGACAGAGCCTGGACGCTG No data
Right 902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838981 Original CRISPR CTGTCTCAGTGAGGGTGCAG TGG Intergenic