ID: 902838983

View in Genome Browser
Species Human (GRCh38)
Location 1:19063507-19063529
Sequence GAGGGTGCAGTGGGTAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838976_902838983 8 Left 902838976 1:19063476-19063498 CCCTGGGACAGAGCCTGGACGCT No data
Right 902838983 1:19063507-19063529 GAGGGTGCAGTGGGTAAGCTTGG No data
902838979_902838983 -5 Left 902838979 1:19063489-19063511 CCTGGACGCTGTCTCAGTGAGGG No data
Right 902838983 1:19063507-19063529 GAGGGTGCAGTGGGTAAGCTTGG No data
902838974_902838983 17 Left 902838974 1:19063467-19063489 CCTCTTGTTCCCTGGGACAGAGC No data
Right 902838983 1:19063507-19063529 GAGGGTGCAGTGGGTAAGCTTGG No data
902838977_902838983 7 Left 902838977 1:19063477-19063499 CCTGGGACAGAGCCTGGACGCTG No data
Right 902838983 1:19063507-19063529 GAGGGTGCAGTGGGTAAGCTTGG No data
902838972_902838983 24 Left 902838972 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
Right 902838983 1:19063507-19063529 GAGGGTGCAGTGGGTAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838983 Original CRISPR GAGGGTGCAGTGGGTAAGCT TGG Intergenic