ID: 902839120

View in Genome Browser
Species Human (GRCh38)
Location 1:19064333-19064355
Sequence TTTCCTAGAAAGGGCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902839112_902839120 15 Left 902839112 1:19064295-19064317 CCTGGGCCAGCCTTTTTCTCAGC No data
Right 902839120 1:19064333-19064355 TTTCCTAGAAAGGGCCAAGCAGG No data
902839117_902839120 -7 Left 902839117 1:19064317-19064339 CCAGGGCTTAGCAACTTTTCCTA No data
Right 902839120 1:19064333-19064355 TTTCCTAGAAAGGGCCAAGCAGG No data
902839116_902839120 5 Left 902839116 1:19064305-19064327 CCTTTTTCTCAGCCAGGGCTTAG No data
Right 902839120 1:19064333-19064355 TTTCCTAGAAAGGGCCAAGCAGG No data
902839115_902839120 9 Left 902839115 1:19064301-19064323 CCAGCCTTTTTCTCAGCCAGGGC No data
Right 902839120 1:19064333-19064355 TTTCCTAGAAAGGGCCAAGCAGG No data
902839109_902839120 27 Left 902839109 1:19064283-19064305 CCTCCAGAGATCCCTGGGCCAGC No data
Right 902839120 1:19064333-19064355 TTTCCTAGAAAGGGCCAAGCAGG No data
902839111_902839120 16 Left 902839111 1:19064294-19064316 CCCTGGGCCAGCCTTTTTCTCAG No data
Right 902839120 1:19064333-19064355 TTTCCTAGAAAGGGCCAAGCAGG No data
902839110_902839120 24 Left 902839110 1:19064286-19064308 CCAGAGATCCCTGGGCCAGCCTT No data
Right 902839120 1:19064333-19064355 TTTCCTAGAAAGGGCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902839120 Original CRISPR TTTCCTAGAAAGGGCCAAGC AGG Intergenic
No off target data available for this crispr