ID: 902839340

View in Genome Browser
Species Human (GRCh38)
Location 1:19065346-19065368
Sequence CAGGGTAACCGGGAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902839331_902839340 -3 Left 902839331 1:19065326-19065348 CCTGCGGCTGGGGTGCCAGCCAG No data
Right 902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG No data
902839329_902839340 2 Left 902839329 1:19065321-19065343 CCAACCCTGCGGCTGGGGTGCCA No data
Right 902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG No data
902839330_902839340 -2 Left 902839330 1:19065325-19065347 CCCTGCGGCTGGGGTGCCAGCCA No data
Right 902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG No data
902839323_902839340 18 Left 902839323 1:19065305-19065327 CCATTCTTACCGCAGTCCAACCC No data
Right 902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG No data
902839322_902839340 26 Left 902839322 1:19065297-19065319 CCTGTCTGCCATTCTTACCGCAG No data
Right 902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG No data
902839325_902839340 9 Left 902839325 1:19065314-19065336 CCGCAGTCCAACCCTGCGGCTGG No data
Right 902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902839340 Original CRISPR CAGGGTAACCGGGAGGAGGA CGG Intergenic
No off target data available for this crispr