ID: 902839701

View in Genome Browser
Species Human (GRCh38)
Location 1:19067131-19067153
Sequence CAGCCATCACTTCTGAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902839694_902839701 14 Left 902839694 1:19067094-19067116 CCCCATTCACACTGTGCTGTGAA No data
Right 902839701 1:19067131-19067153 CAGCCATCACTTCTGAAACTGGG No data
902839696_902839701 12 Left 902839696 1:19067096-19067118 CCATTCACACTGTGCTGTGAAAA No data
Right 902839701 1:19067131-19067153 CAGCCATCACTTCTGAAACTGGG No data
902839695_902839701 13 Left 902839695 1:19067095-19067117 CCCATTCACACTGTGCTGTGAAA No data
Right 902839701 1:19067131-19067153 CAGCCATCACTTCTGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902839701 Original CRISPR CAGCCATCACTTCTGAAACT GGG Intergenic
No off target data available for this crispr