ID: 902839844

View in Genome Browser
Species Human (GRCh38)
Location 1:19067830-19067852
Sequence GTCCAGCCAGGACTCCTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902839836_902839844 13 Left 902839836 1:19067794-19067816 CCCAGATCTCTGAAGCCGGGAAC No data
Right 902839844 1:19067830-19067852 GTCCAGCCAGGACTCCTTGTCGG No data
902839841_902839844 -2 Left 902839841 1:19067809-19067831 CCGGGAACAGCCTAACAAGGGGT No data
Right 902839844 1:19067830-19067852 GTCCAGCCAGGACTCCTTGTCGG No data
902839837_902839844 12 Left 902839837 1:19067795-19067817 CCAGATCTCTGAAGCCGGGAACA No data
Right 902839844 1:19067830-19067852 GTCCAGCCAGGACTCCTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902839844 Original CRISPR GTCCAGCCAGGACTCCTTGT CGG Intergenic
No off target data available for this crispr