ID: 902841162

View in Genome Browser
Species Human (GRCh38)
Location 1:19074767-19074789
Sequence GAGGGAGAACAGAGGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1480
Summary {0: 1, 1: 0, 2: 9, 3: 148, 4: 1322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902841154_902841162 3 Left 902841154 1:19074741-19074763 CCCGCGGAGGGAACTTAATGCAC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG 0: 1
1: 0
2: 9
3: 148
4: 1322
902841155_902841162 2 Left 902841155 1:19074742-19074764 CCGCGGAGGGAACTTAATGCACA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG 0: 1
1: 0
2: 9
3: 148
4: 1322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902841162 Original CRISPR GAGGGAGAACAGAGGGTGGA AGG Exonic
900078233 1:835127-835149 GTGGGTGAACAGGGGGTGGAGGG - Intergenic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900384020 1:2401228-2401250 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
900384024 1:2401239-2401261 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
900427747 1:2588165-2588187 GAGGGTCCACAGAGGGTGCAGGG - Intronic
900471953 1:2859453-2859475 GAGGAAGACAAGAGGGAGGAAGG + Intergenic
900503211 1:3016654-3016676 GAGGGAGAAAGGAGAGAGGAAGG + Intergenic
900628845 1:3623297-3623319 GAGGAAGAACAGAGGCCGGGAGG - Intergenic
900658277 1:3770834-3770856 GAGGGAAGACAGAGGATGGAGGG + Intronic
900863105 1:5246579-5246601 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
900932897 1:5747836-5747858 GAGGGAGGAGGGAGGGAGGAGGG + Intergenic
901532743 1:9863760-9863782 GTGAAAGAACAGAGGCTGGAAGG + Intronic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
901883055 1:12205162-12205184 GAGGGAGGCCAGGGGGTGGAGGG + Intronic
901945807 1:12702622-12702644 GAGGGAGGACAGAGGGACAAAGG - Intergenic
902410205 1:16207785-16207807 GGGCGAGAACTGAGGGTGGGGGG + Intronic
902542496 1:17164960-17164982 ATGGGAGAACAGAGGGTGTGTGG + Intergenic
902779191 1:18693578-18693600 GAGTGAGGACAGGGGGCGGAGGG - Intronic
902833108 1:19030192-19030214 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
903270862 1:22187444-22187466 GAGGAAGAACAGTGGCTAGAAGG - Intergenic
903407083 1:23106826-23106848 GTGGGAGAACAGACTGTGGAGGG - Intronic
903513834 1:23896623-23896645 GAGGGAGATGAGAGGCAGGAGGG + Intronic
903576532 1:24342821-24342843 GAAGGAGACCAGAGGTGGGAGGG + Intronic
903703253 1:25266765-25266787 GAAAGAACACAGAGGGTGGAGGG - Intronic
904304355 1:29577963-29577985 GAGGGAGTAAACTGGGTGGACGG + Intergenic
904849055 1:33443486-33443508 CAGGGAGAACAGCAGGTAGAGGG + Intergenic
904986817 1:34557582-34557604 GAGGCCTAATAGAGGGTGGAGGG + Intergenic
905037500 1:34927678-34927700 GGGGGAGAAGAGAGGAGGGAGGG - Intronic
905120215 1:35676062-35676084 GAGGAAGAAGAGAGGGAGGAAGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905481892 1:38267669-38267691 GAGGGAGGAAAGAGGGAGGGAGG - Intergenic
905543410 1:38778411-38778433 GTGGGAGAACAGAGGTAGGTAGG - Intergenic
905749687 1:40451175-40451197 TAGGGAGACGAGTGGGTGGAGGG + Intronic
905945469 1:41897991-41898013 GAAGGAGGACCCAGGGTGGAGGG + Intronic
905975479 1:42170991-42171013 GAGGGGGAGCAGATGGTGAACGG - Intergenic
906037988 1:42764883-42764905 GAGGGAGAACAGAGAAAGGCAGG - Intronic
906240570 1:44239796-44239818 GAGGGAGAGGAGGGAGTGGAGGG + Intronic
906290885 1:44618588-44618610 GATGGAGGACAGATTGTGGAGGG + Intronic
906348705 1:45038557-45038579 GAGGTAGAACAGAGTCTGGAAGG + Intronic
907092559 1:51741418-51741440 GAGGGAGAAGGAAGGATGGAAGG - Intronic
907099351 1:51814142-51814164 GAGGGAGAAGGGCGGGAGGAGGG + Intronic
907289049 1:53401156-53401178 GAGGGAGAGAAGAGGGAGCAGGG + Intergenic
907303660 1:53502579-53502601 GAGGGAGAGAAGAGAGGGGAGGG + Intergenic
907466910 1:54644294-54644316 GAGGGAGAGCAGGGGAGGGAGGG - Intronic
907567003 1:55444654-55444676 GCAGGAGATCAGAGGGAGGAGGG + Intergenic
907588815 1:55646226-55646248 GAGGGAGGAGAGAGGGAGAAGGG - Intergenic
908347442 1:63249768-63249790 AAAGGAGAAGAGAGAGTGGAAGG + Intergenic
908557813 1:65275008-65275030 GAGGGAGAAGATAGGGTAAATGG - Intronic
908640854 1:66221767-66221789 GAGTGATGACAGAGGGTGGGAGG - Intronic
908755549 1:67466019-67466041 GAGGGAGAAGAAAGGGTAGGAGG + Intergenic
908759390 1:67498070-67498092 GAGGGAGAGGTGAGGATGGAAGG + Intergenic
908776375 1:67644926-67644948 GAGGGATCACAGAGGGTTTATGG - Intergenic
909156402 1:72083301-72083323 AAGGGAGGAGAGAGGGAGGATGG - Intronic
909289516 1:73864610-73864632 GAGGGTGACAGGAGGGTGGAGGG + Intergenic
909313725 1:74188265-74188287 GAGGGAGGAGAGTGGGAGGAGGG + Intronic
909462003 1:75927511-75927533 AAGGGTGAACAGAGGTTGGGAGG + Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
909837872 1:80280205-80280227 CAGGGATAACAGAGTTTGGAAGG + Intergenic
910257675 1:85264575-85264597 GAGTGAGATGAGAGGGAGGAAGG + Intergenic
910393458 1:86768236-86768258 GAGGGATTAAAGAGTGTGGAAGG + Intergenic
910645226 1:89507210-89507232 GAGGGAGAGTGGAGAGTGGAGGG - Intergenic
910701941 1:90084960-90084982 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
910701947 1:90084987-90085009 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
910750805 1:90628025-90628047 GAGGGGGAACATAGGGGGCAAGG + Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
911803318 1:102173494-102173516 GAGAGAGAACAGAGGGAGAGAGG - Intergenic
911834574 1:102600256-102600278 GAAGGAGAACAGAGGGACAATGG + Intergenic
912374837 1:109201589-109201611 GAGGGCGGAAAGAGGGAGGAGGG + Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
915314998 1:155023499-155023521 CAGGAAGCACAGAGGGTGGGTGG - Intronic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915740719 1:158116477-158116499 GAAGGAGGACAGAGTGGGGAGGG + Intergenic
915932389 1:160068601-160068623 GAGGAAGAAACGAGGGAGGAGGG - Intronic
916052873 1:161048463-161048485 GAGGGAGACCAGAGGGCTGGAGG - Exonic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
917159301 1:172039774-172039796 GAGGAAGAACAGAGAAAGGAAGG - Intronic
917182298 1:172312652-172312674 AAGGGAGGAAAGAGGATGGAAGG - Intronic
917329601 1:173868225-173868247 GAGGAAGAGCAGAGAGGGGAGGG + Intronic
917428756 1:174943459-174943481 GAGGGAGAAGAAAATGTGGAGGG - Intronic
917723750 1:177811034-177811056 GGAGGGAAACAGAGGGTGGAGGG + Intergenic
918109664 1:181444385-181444407 GAGGTAAAAGAGAGGGTGTAAGG + Intronic
918410146 1:184249873-184249895 GAAGGAGATCAAAGGGTAGAAGG - Intergenic
918476835 1:184934318-184934340 GAGGGAGAAGGAAGGGAGGAGGG + Intronic
918586357 1:186193255-186193277 GAGGGAGAAGGGAAGGAGGAAGG + Intergenic
918597998 1:186315752-186315774 GAGTGAGAACAGAGAGTAGCAGG - Intronic
919091079 1:192979579-192979601 AAGGAGGAACGGAGGGTGGAAGG + Intergenic
919190575 1:194212170-194212192 GAGGCCTAACTGAGGGTGGAAGG + Intergenic
919236391 1:194849830-194849852 AAGGAAGAAAAGAGGGAGGAGGG - Intergenic
919245447 1:194977499-194977521 GAGGGAGAAGAGTGGGAGGAGGG - Intergenic
919864979 1:201774456-201774478 GTGGGAGAAAAAAGGCTGGATGG - Intronic
920256692 1:204660193-204660215 GAAGGAGAAACGAGGGTGGACGG - Intronic
920372298 1:205486792-205486814 AAGGGAGGACAGAGAGTTGAGGG - Intergenic
920811291 1:209288218-209288240 GGGTGAGGACAGAGGGTGGCAGG + Intergenic
920868762 1:209775574-209775596 GAGGGAGATCAGAGAGGAGAGGG - Intronic
921087582 1:211810333-211810355 GACGGAAGATAGAGGGTGGAAGG + Intronic
921961266 1:221036863-221036885 GAGGCCTACCAGAGGGTGGAGGG - Intergenic
922049684 1:221977552-221977574 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
922079702 1:222283842-222283864 GAGGGGGAACACAGGCAGGAAGG + Intergenic
922154218 1:223028853-223028875 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
922417570 1:225435649-225435671 TTGGTAGAACTGAGGGTGGAGGG - Intergenic
922588514 1:226754093-226754115 GGTGGAGAACAGAGGGTGGAGGG + Intergenic
922598824 1:226834497-226834519 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
922859568 1:228804643-228804665 GAGGAAGAAAAGAGGGAGGAAGG - Intergenic
922934678 1:229413659-229413681 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
923165840 1:231360805-231360827 AAGAGAGAACAGAGAATGGATGG + Intergenic
923300444 1:232635440-232635462 GAGGGAGGAAGGAGGGAGGAAGG + Intergenic
923452861 1:234136157-234136179 GAAGGAAGAAAGAGGGTGGAGGG - Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923482586 1:234397749-234397771 GAGGGGGAAGAGGGGGAGGAGGG + Intronic
923662734 1:235972465-235972487 GCGGGAGAGGAGAGGGTGAAGGG - Intergenic
924202618 1:241675225-241675247 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
924440625 1:244082540-244082562 GAGGGAGAAGAGAGGCAGGGAGG + Intergenic
924459639 1:244247620-244247642 GAGGGAGAGCAGAGACTGGGGGG + Intergenic
924737353 1:246770070-246770092 GAGGGTGGAGAGTGGGTGGAAGG - Intergenic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063525273 10:6778937-6778959 AAGGAAGAAGAGAGGGAGGAAGG + Intergenic
1063561813 10:7135202-7135224 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1063649252 10:7917229-7917251 GAGGGAAAAGAGAGCGAGGATGG + Intronic
1063657125 10:8002130-8002152 GAGAGAGAACAGAGGATGATAGG - Intronic
1063690211 10:8280079-8280101 AAGGAAGAAGAGAGGGTGGAAGG + Intergenic
1063711419 10:8482728-8482750 GAGAGAGAAGAGAGAGAGGAGGG - Intergenic
1063823259 10:9862327-9862349 GAGGCAGAAGAGAGAGTGAAGGG + Intergenic
1063983959 10:11481067-11481089 GAATGATAACAGAGGGTGAATGG - Intronic
1064114816 10:12568449-12568471 GAGAGAGAAAAGAGGAAGGAAGG - Intronic
1064346863 10:14540527-14540549 GGGGGAGGACAGAGGGAGGGTGG - Intronic
1064952856 10:20873469-20873491 GAGGAAGAACAGGAGGAGGAGGG + Intronic
1065122081 10:22540150-22540172 GAGGGAGAAGTGAGCCTGGAGGG + Intronic
1065181567 10:23131343-23131365 GTTGGAGGGCAGAGGGTGGAAGG + Intergenic
1065223770 10:23522401-23522423 AAGGGAGAACAGAGGAGCGAGGG - Intergenic
1065261369 10:23926792-23926814 GAGGAAGAAAAGAGGGAGGAAGG - Intronic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1065656594 10:27957587-27957609 GGGGGAGAAAAGAAGCTGGAAGG + Intronic
1065728772 10:28691716-28691738 GAGGGAGTGGAGAGGGGGGATGG - Intergenic
1065822228 10:29536253-29536275 GAGGGAGGAGAGAGGCAGGAGGG + Intronic
1065973589 10:30823889-30823911 GTGGGAGAACAGAGGAAAGATGG - Intronic
1065987102 10:30965756-30965778 GAGGAAGGAGAGAGGGAGGAGGG + Intronic
1066190010 10:33047486-33047508 AAGGGAGAGAAGAGGGTGGATGG + Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1067438128 10:46292990-46293012 GACGGAGAGGAGAGGGAGGAGGG + Intronic
1067528316 10:47051754-47051776 GAGGGAGATCAGAGAGTGTGTGG + Intergenic
1067574933 10:47403127-47403149 GAGGGAGAGGAGGGGGAGGAGGG + Intergenic
1068092917 10:52454996-52455018 GAGGGGGCACAGAGGGAGCAAGG - Intergenic
1068709771 10:60121332-60121354 GAGGGAGTGCAGGGGGTGGAGGG + Intronic
1068729713 10:60343321-60343343 GAGGGAGAAAAGGGGGAGTAGGG + Intronic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068858169 10:61818829-61818851 GAGGCCTAACAGAGGGTGAAGGG + Intergenic
1069265704 10:66454806-66454828 GAGGGAGAGGAGGGGGAGGAGGG + Intronic
1069705064 10:70453851-70453873 GAGGGATAACAAAGGGCAGAAGG + Intergenic
1069772011 10:70906097-70906119 GTGGGAGCACAGAGAGAGGAGGG + Intergenic
1069806888 10:71131868-71131890 GAGGGAGAGCAGAGGCTGCATGG - Intergenic
1070001639 10:72382536-72382558 GAGTTAGAACAGAAGGTGCAGGG + Intronic
1070549919 10:77482957-77482979 GAGAGAGAAGAGAGGAAGGATGG - Intronic
1070731125 10:78828975-78828997 GATGGAGACCACAGGGTGGGCGG + Intergenic
1071187087 10:83058393-83058415 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1071468409 10:85961493-85961515 GAGGGAGGACAGACGGTGGTTGG - Intronic
1072152763 10:92696445-92696467 GAGGGGGAACAGAGGAACGAGGG + Intergenic
1072314889 10:94192334-94192356 GAGGGGGAAGAGAGGGAGGTGGG - Intronic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1072917237 10:99545556-99545578 GAGGGGGAGCAGTGGGAGGAGGG + Intergenic
1073110394 10:101060174-101060196 GATGGAGAACAGTAGGTAGACGG - Intergenic
1073730465 10:106281482-106281504 GAGTGAGAAGAGAGGGTAGAAGG + Intergenic
1075108741 10:119560524-119560546 GAGGGAGAGGGGAGGGGGGAGGG + Intergenic
1075155256 10:119970978-119971000 GAGGGAGAACAGATAATGAAAGG - Intergenic
1075224936 10:120620517-120620539 GAAGGGGAGCAGAGGATGGAAGG - Intergenic
1075344213 10:121670414-121670436 GAGGGAGGACAGTGGGAGGATGG + Intergenic
1075685876 10:124364776-124364798 GAGGGAGAAGAGGGGAGGGAGGG + Intergenic
1076304864 10:129458837-129458859 GAGGGAGAGAGGAGGGAGGAGGG - Intergenic
1076338826 10:129728735-129728757 GACAGAGAACAGGGGGTGGTGGG - Intronic
1076406878 10:130218414-130218436 GAGGGAGGACCCAGGGTAGACGG + Intergenic
1076746266 10:132516238-132516260 GACAGAGGACAGAGGGTGGAAGG - Intergenic
1076751741 10:132546776-132546798 CAGGGAGAACAGTGGCTGGGCGG - Intronic
1076853203 10:133103082-133103104 GAGGGGGCCCTGAGGGTGGAGGG + Intronic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077020198 11:413900-413922 CAGGCAGAAGAGAGGGTGCAGGG - Intronic
1077024570 11:433523-433545 GAGGTGGAATAGAGGGGGGAGGG - Intronic
1077024579 11:433550-433572 GAGGCGGAATAGAGGGGGGAGGG - Intronic
1077280498 11:1742872-1742894 GAGGATGAACAGATGATGGATGG + Intronic
1077305253 11:1866026-1866048 GTGGGAGAGCAGAGTTTGGAGGG + Intronic
1077317817 11:1927145-1927167 GAGGTGGAAGGGAGGGTGGAGGG + Intronic
1077354475 11:2108850-2108872 GAGGCAGAACAGCTGGTGGAGGG + Intergenic
1077613970 11:3661902-3661924 GTGGGAGAGCAGATGGTTGAGGG + Intronic
1077869918 11:6253072-6253094 GAGGGGGAGCAGAGGATGGAGGG - Intergenic
1077893884 11:6439633-6439655 GAGAGAGAAAAGAGGCAGGAGGG + Intronic
1077915452 11:6608828-6608850 GAGGGAGAAGACAGGTGGGAAGG - Intronic
1078109302 11:8379767-8379789 GAGGGTGAAGGGTGGGTGGAGGG - Intergenic
1078158708 11:8821220-8821242 TAAGGAGAAAAGAGGGTGGGAGG + Intronic
1078195595 11:9134349-9134371 GGGAGAGGACAGAGGGAGGAAGG - Intronic
1078328348 11:10398417-10398439 CAGGGAGGCCAGAGGGTGCATGG + Intronic
1078860336 11:15240753-15240775 GTGGTAGAACAGAGGGAAGAGGG - Intronic
1079281739 11:19093496-19093518 CAAAGAGAACAGGGGGTGGAGGG - Intergenic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1079964382 11:26963149-26963171 GAGGGAGAAAAAAGAGAGGAAGG + Intergenic
1080394001 11:31873428-31873450 GAGGGAGAGAAGAGGGTGGTTGG + Intronic
1080485680 11:32704494-32704516 GAGGGAGGCCAGAGGGCTGAGGG + Intronic
1080557401 11:33430079-33430101 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
1080604678 11:33855164-33855186 GAGGAAGAACGGAAGGAGGAAGG + Intergenic
1081409130 11:42735022-42735044 GAGGGAGGAGAGAAGGAGGAGGG + Intergenic
1081620203 11:44614903-44614925 GAGGAAGAACAGAGGACAGAAGG + Intronic
1081695672 11:45107520-45107542 GAAGCAGAACAGAGGGTGGATGG + Intronic
1081805966 11:45890705-45890727 GTGGGAGACCAGAGGGCGGTGGG + Intronic
1081905498 11:46666979-46667001 GAGGGAGAAAAGGGAGAGGATGG - Intronic
1081909010 11:46688276-46688298 GATGGAGCACAGTGGGTTGAAGG + Intronic
1082116974 11:48338951-48338973 CAGAGAGAACAGAGGATCGAAGG - Intergenic
1082160943 11:48886831-48886853 GAGGGCGGAGAGAGGGTGGGGGG + Intergenic
1082161423 11:48893575-48893597 GAGGGCGGAGAGAGGGTGGGGGG - Intergenic
1082167016 11:48962028-48962050 GAGGGAGGAGAGACGGTGGGGGG - Intergenic
1082656634 11:55865951-55865973 GAGGGAGGAGAGAGGGTGGGGGG - Intergenic
1083213430 11:61203688-61203710 GAGGGAGAAAAAAGGGAAGAAGG - Intronic
1083270605 11:61570319-61570341 GAGGGTGGCCAGAGGCTGGAAGG + Intronic
1083426747 11:62591996-62592018 GCGGGAGGACAGGGGGCGGAGGG - Intronic
1083506908 11:63166459-63166481 GAGGGACAACAGATGTTGTATGG + Intronic
1083651593 11:64207697-64207719 GAGGGAGGGAAGAGGGTGGGAGG - Intronic
1083822688 11:65181879-65181901 GAGGGAGGGCGGAGGGCGGAGGG + Intronic
1083831874 11:65238628-65238650 GAGGGAGACCAGAGGGGGAGGGG - Intergenic
1084055078 11:66626700-66626722 GAGGGAGAAAAGAGGTGGGTAGG + Exonic
1084083154 11:66842512-66842534 GAGGGGGGACAGAGGCTGGCAGG + Intronic
1084092222 11:66886186-66886208 GAGGGAGAAGAGGGGAGGGAGGG + Intronic
1084184349 11:67463925-67463947 GAAGGAGGGCAGTGGGTGGAGGG + Exonic
1084658795 11:70535279-70535301 GATGGAGGATAGAGGATGGATGG - Intronic
1084794026 11:71492132-71492154 GAGGGAGAGCAGATGGCGGGCGG + Intronic
1085473178 11:76771220-76771242 GACAGAAAGCAGAGGGTGGAAGG - Intergenic
1085521173 11:77139681-77139703 GAGGGAGAAGGAAGGGAGGAAGG - Intronic
1085543046 11:77289848-77289870 GAGGGAGAAGGGAGGGAGGAGGG + Intronic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086068535 11:82772635-82772657 GAGGGTGAACGGTGGGAGGAGGG - Intergenic
1086955662 11:92932479-92932501 GAGGGAGAAAGAAGGGAGGAAGG - Intergenic
1086957263 11:92946225-92946247 GTGGGGCAACAGAGGGTAGAAGG + Intergenic
1087027590 11:93665381-93665403 GAGAGAGAACACAGTGTGAACGG + Intronic
1087093658 11:94300087-94300109 GAGGAAGAATAGAGGAGGGAAGG + Intergenic
1087732093 11:101790323-101790345 GAGGAAGAAGAGAGGAAGGAAGG + Intronic
1087786223 11:102357247-102357269 GAGGGAGTAAGGAGGGAGGAGGG - Intronic
1088051175 11:105517354-105517376 GAGGGAGAGGGGAGGGGGGAGGG + Intergenic
1088714266 11:112535048-112535070 GAGGGAGACATGGGGGTGGAGGG + Intergenic
1089077121 11:115747170-115747192 GATGGAGAACAGAGGAGGCAGGG + Intergenic
1089102510 11:115975491-115975513 GGGGGAGAACAAGGGGTGAAGGG - Intergenic
1089303299 11:117511652-117511674 CAGAGAGGAGAGAGGGTGGAGGG - Intronic
1089901004 11:121984633-121984655 GAGGGAGAGAAGAGGGTAGTGGG + Intergenic
1090020639 11:123125462-123125484 GAGGGAGGAGGGAGGGAGGAGGG - Intronic
1090082408 11:123622859-123622881 GGTGGGGAACAGAGGGTGGGAGG - Intronic
1090085035 11:123642976-123642998 GAGGGAGAACAAAGGCAGGCGGG + Intronic
1090107743 11:123870058-123870080 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1090182615 11:124714033-124714055 GGAGGAGATCAGAGGGTGGGAGG + Intergenic
1090244645 11:125207212-125207234 AAGGGAGGAGGGAGGGTGGAAGG - Intronic
1090259561 11:125308827-125308849 GAACTAGGACAGAGGGTGGAAGG - Intronic
1090657220 11:128855355-128855377 GATGGAGAAAAGAGGATAGAAGG + Intronic
1090718813 11:129454122-129454144 GAGGGAGGACGGTGGGAGGAGGG - Intergenic
1090771345 11:129922058-129922080 GATGGAGAAGTGAGGGTTGAAGG - Intronic
1091180864 11:133603350-133603372 GAGGAGGAGCAGGGGGTGGAGGG + Intergenic
1091206984 11:133828504-133828526 GAGGGAGGAGAGGAGGTGGAAGG + Intergenic
1091284595 11:134401579-134401601 GAGGAAGAAGGGAGGGGGGAAGG + Intronic
1091399249 12:172543-172565 GTGGGAGAGCAGAGGCTGGCAGG - Intronic
1091645602 12:2270098-2270120 GTCAGGGAACAGAGGGTGGAAGG + Intronic
1091700186 12:2653978-2654000 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1091760865 12:3086387-3086409 GAGAGAAAACAGAGGGCGGAAGG - Intronic
1091823592 12:3493314-3493336 GTGGGCGATCAGAGGGCGGAGGG - Intronic
1092071668 12:5636554-5636576 GAGAGAAAACAGCAGGTGGAAGG + Intronic
1092091713 12:5809129-5809151 GAGGGAGTGCAGATGGGGGAAGG + Intronic
1092097220 12:5852910-5852932 GAGAGAGAAGAGGGGGTGGAGGG + Intronic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092203756 12:6603354-6603376 GAGGGAGAGAGGAGGGAGGAGGG - Intronic
1092229665 12:6769524-6769546 GAGGGAGAACTGGGGCTGCAGGG + Intronic
1092239484 12:6828371-6828393 GAGGGAGAGGAAAGGGGGGAAGG - Intronic
1092505093 12:9090516-9090538 GAAGGAGAACAGAGGGAGAATGG + Intronic
1093052806 12:14522148-14522170 GAGGGAGAAGAGATGGAGAAGGG + Intronic
1093315055 12:17639052-17639074 GAGGGAGAAGAGTGGGAGGAAGG - Intergenic
1093322131 12:17724737-17724759 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1093569065 12:20644853-20644875 GAGGGGGAAGAGGGGGAGGAGGG - Intronic
1094075273 12:26465561-26465583 GAGGGAGAACAGAGGGAAAGTGG + Intronic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1094831913 12:34304203-34304225 GAGGTAGAAACGAAGGTGGAAGG + Intergenic
1095323899 12:40863943-40863965 GAAGGAGAAGAGAGGGAGGGAGG - Intronic
1095557001 12:43519366-43519388 GAGGGAGGAAAGAGGGTTGTAGG - Intronic
1095621967 12:44267657-44267679 GAGGGAGAAAGGAGGGTCAAAGG - Intronic
1095700758 12:45188648-45188670 CAGAGAGAACAGAGGGTCAAGGG + Intergenic
1096252557 12:50042317-50042339 GATGGAGAGGAGACGGTGGAGGG + Intergenic
1096254676 12:50055886-50055908 GAGGGAGCAGCGGGGGTGGAGGG - Intergenic
1096267726 12:50137328-50137350 AAGGGAGAACAGAGAGAGCAAGG + Intronic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1097223991 12:57466152-57466174 GAAGAGGAACAGGGGGTGGAGGG + Intronic
1097248873 12:57621494-57621516 GAGGAAGGACGGAGGGTGGAGGG + Intronic
1097262663 12:57728201-57728223 TAGGGAAAGCAGAGGGTGGGGGG + Intronic
1097542345 12:60956446-60956468 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1097694038 12:62759995-62760017 AAGGAAGAATGGAGGGTGGAAGG - Intronic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1099292238 12:80787528-80787550 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
1099868405 12:88314955-88314977 GAGGGAGAAGAGTGGGAGGAGGG - Intergenic
1099971561 12:89505564-89505586 GAGGGAGTATAGTGGCTGGAAGG + Intronic
1100192715 12:92209803-92209825 GATAGTGAAGAGAGGGTGGAAGG - Intergenic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1100370792 12:93967011-93967033 GAGGGAGTATAGAGGGAGGGAGG - Intergenic
1100393388 12:94163608-94163630 GAGGGAGGGGAGAGGGTAGAAGG + Intronic
1100569886 12:95837519-95837541 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
1101259573 12:103014419-103014441 GAGGGAGAAGGGAGGGAGGAAGG - Intergenic
1101348217 12:103905426-103905448 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348265 12:103905556-103905578 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348278 12:103905606-103905628 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348304 12:103905673-103905695 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101396818 12:104355963-104355985 GAGGGTGAGGAAAGGGTGGAAGG + Intergenic
1101830851 12:108255311-108255333 GTGGGAGACAAGAGGGAGGAAGG + Intergenic
1102395585 12:112583071-112583093 GAGGGAGGACAGTGGCTGGGAGG + Intronic
1102446281 12:113005253-113005275 GATGGTGGACAGAAGGTGGAGGG + Intronic
1102604274 12:114056719-114056741 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1102764761 12:115423062-115423084 GAGGGAGGAAAGAGGGAGAAAGG + Intergenic
1102813531 12:115844095-115844117 GGTGGAGAATAGATGGTGGAGGG - Intergenic
1102901641 12:116643095-116643117 GTGGGAGAAGAGTGGGTGGGAGG - Intergenic
1103025204 12:117568175-117568197 GAGGGAGAGGAGAGGAGGGAGGG - Intronic
1103184531 12:118945088-118945110 GAGGGAGAGCTGAGGGTTGGGGG - Intergenic
1103397466 12:120619125-120619147 GAGGGGGAAGAGAGGGCTGAAGG - Intergenic
1103729545 12:123018043-123018065 GAGAGAGAAAAGAGGGAGGGAGG - Intronic
1103917815 12:124385025-124385047 GAGGGAGAAAGGAGGGAGGAAGG + Intronic
1104081555 12:125434502-125434524 GTGGGAGATTAGAGGGTGGGAGG + Intronic
1104125168 12:125839280-125839302 AAGGGAGAAGACTGGGTGGATGG + Intergenic
1104134378 12:125923445-125923467 GAGGGAGAAGAGATGATGGATGG + Intergenic
1104188037 12:126451167-126451189 GAGGCAGCAGAGGGGGTGGAGGG - Intergenic
1104191073 12:126482430-126482452 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
1104463371 12:128971852-128971874 GAGGGAGGAGGGAGGGGGGAAGG - Intronic
1104571440 12:129929615-129929637 GAGGCAGAGCAGAGCATGGAGGG - Intergenic
1104684421 12:130775572-130775594 GCGGAAGAACCGAGGGTGAAAGG - Intergenic
1105614335 13:21998712-21998734 CAGGGAGCTCAGAGGGTGGAGGG + Intergenic
1106148295 13:27072284-27072306 GTTGCAGAACACAGGGTGGAAGG + Intronic
1106586135 13:31057908-31057930 GAGGGAGAAGAGGGCGGGGAGGG - Intergenic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107014903 13:35700486-35700508 GAGAGAGAACAGAGGAAGGCAGG + Intergenic
1107389721 13:39951461-39951483 GAGGGAGGGCAGGGGGTGGATGG + Intergenic
1107983130 13:45752404-45752426 GAGGAAGAAGAGAGGGTTGCTGG - Intergenic
1108433225 13:50375670-50375692 GAGGGAGAAAAGAGGGATGGAGG - Intronic
1108813046 13:54253578-54253600 GAGGCCCATCAGAGGGTGGAAGG + Intergenic
1109640986 13:65191434-65191456 GAGGGAGAACATGGGGTGTTTGG + Intergenic
1109688306 13:65849718-65849740 GAGGGAAAACACAGGGTGTGAGG - Intergenic
1109750189 13:66681788-66681810 AATAGAGAACAGAAGGTGGATGG - Intronic
1109958134 13:69595354-69595376 GAGGGAGAGCAGGGTGAGGAGGG + Intergenic
1110523329 13:76506251-76506273 GAGGGAGGAGGGAGGGAGGAGGG + Intergenic
1110788963 13:79566486-79566508 GTGGCCGAAGAGAGGGTGGAGGG + Intergenic
1111629579 13:90832783-90832805 GGGGGTGATCACAGGGTGGAAGG + Intergenic
1111630307 13:90840721-90840743 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1111747601 13:92290567-92290589 GAGGGAGAACATAGGATGTTTGG + Intronic
1112927671 13:104696208-104696230 GAGGAAGAGCAAAGAGTGGAAGG + Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113333031 13:109349834-109349856 GATGGAGCACAGAGTCTGGAAGG + Intergenic
1113353050 13:109548481-109548503 GGAGGAGGACAGAGGGTGGTTGG - Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113791565 13:113031575-113031597 GAGGGAGAATGCGGGGTGGAGGG + Intronic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114207017 14:20581596-20581618 GAGGATGGACAGAGGATGGAAGG - Intergenic
1115343287 14:32315433-32315455 GAAGGATAACAGGGGGTTGAGGG - Intergenic
1115643049 14:35347568-35347590 GTGGGAGATCAAAGGGAGGAGGG + Intergenic
1115718171 14:36128835-36128857 GCAGGAGATCAGAGGGTGGAAGG + Intergenic
1115971423 14:38948946-38948968 GAGGGAGGAGAGAGGGTGTGGGG + Intergenic
1116085294 14:40229594-40229616 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1117165646 14:53029937-53029959 GAGGCCTAGCAGAGGGTGGAGGG - Intergenic
1117457938 14:55916477-55916499 GAGGGAGAAGGGTGGGAGGAGGG - Intergenic
1118050749 14:62024539-62024561 AATGGAGAACACAGGGTGTATGG - Intronic
1118114400 14:62758837-62758859 GGAGGATAACAGAGGGTGTAGGG + Intronic
1118422974 14:65627983-65628005 GAGGGAAAACCAAGGGTTGAGGG + Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119022277 14:71125555-71125577 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1119726031 14:76922324-76922346 GATGGAGGATGGAGGGTGGAAGG + Intergenic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1119931721 14:78553989-78554011 GAGAGAGAAGAGTGTGTGGAGGG + Intronic
1119935150 14:78585506-78585528 TAGGGACAAGGGAGGGTGGAGGG + Intronic
1120251541 14:82065542-82065564 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1120674784 14:87408352-87408374 GAGGGAGAGAAGAGGTGGGAGGG + Intergenic
1120903166 14:89593226-89593248 GAGGGAGAAAGGAGGGAGGGAGG + Intronic
1121024977 14:90608924-90608946 GAGGGAGAAAAGTGGGGAGACGG + Intronic
1121335618 14:93076077-93076099 GAGGGAGAAGGAAGGATGGATGG - Intronic
1121335622 14:93076095-93076117 GAGGGAGAAGGAAGGATGGAGGG - Intronic
1121725058 14:96141272-96141294 GAGACAGACAAGAGGGTGGAGGG + Intergenic
1121800197 14:96768652-96768674 GAGGAAGAAGGGAGGGAGGAAGG - Intergenic
1121882073 14:97509702-97509724 GAGAAAGAACAGAGGCTGGAAGG - Intergenic
1121888061 14:97562642-97562664 GAAGGAGGAAAGAGGGAGGAAGG + Intergenic
1122198768 14:100109209-100109231 GAAGGACAAGAGAAGGTGGATGG - Intronic
1122244599 14:100393576-100393598 GAAGTAGGACAGATGGTGGAAGG + Intronic
1122322229 14:100862004-100862026 GAGGAAGAAGAGAAGGTGGGAGG - Intergenic
1122507479 14:102240870-102240892 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1122650051 14:103221177-103221199 GATGGAGCACACAGGGTGGAGGG + Intergenic
1122685406 14:103502479-103502501 GAGGGACAGCCCAGGGTGGATGG + Intronic
1123009150 14:105338849-105338871 GAGGGAGAAGAGCGGGGAGATGG - Intronic
1123068157 14:105628414-105628436 GAGGGAGGACAGAGTGAGCAGGG - Intergenic
1123181891 14:106479231-106479253 GTGAGAGAAAAGAGGGAGGAAGG - Intergenic
1202945014 14_KI270726v1_random:17498-17520 GTGAGAGAAAAGAGGGAGGAAGG + Intergenic
1123678649 15:22739497-22739519 GGGGGAGAAGAGAGGAAGGAAGG - Intergenic
1123996061 15:25718750-25718772 GAGGCAGGACAGAGGGTGGCAGG + Intronic
1124012793 15:25852206-25852228 GAGGGAGGATAGAGGGAGGATGG - Intronic
1124211996 15:27771075-27771097 GAGGGAGAAAAGAGGGAGGGAGG - Intronic
1124395255 15:29295041-29295063 GAGGGAGAAAACAGGGTGACAGG + Intronic
1124591461 15:31057385-31057407 GAGGGAGGAGAGTGGGAGGAGGG + Intronic
1124641719 15:31400140-31400162 GAGGGAGAGCAGAGTGGGGGTGG - Intronic
1125131658 15:36290092-36290114 AAGGAAGAATGGAGGGTGGAAGG + Intergenic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125501959 15:40245491-40245513 AAGAAAGCACAGAGGGTGGAGGG + Intronic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125530070 15:40407272-40407294 GCTGGAGCACAGAGGGTGGGAGG + Intronic
1125701484 15:41689326-41689348 GAGGGAGAAGAGAGGGAGAGAGG - Intronic
1125779582 15:42252560-42252582 GAGGGAGAAGAGAGGGAGAAAGG - Intronic
1125841834 15:42809137-42809159 GAGTGAGAACAGAGGGCAGGTGG - Intronic
1126781214 15:52140362-52140384 GAGGGAGCACAGTGGGAGGCAGG - Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127125567 15:55808535-55808557 GAGTGAGAACATAGGGTGTTTGG - Intergenic
1127157409 15:56142526-56142548 GAGGGAGGTCAGAGAGTGCAAGG - Intronic
1127167166 15:56256933-56256955 ATGGGAGAGCAGAGGGTGGGAGG - Intronic
1127507390 15:59610396-59610418 GAGGGAGGAGGGAGGGAGGAGGG - Intronic
1127507395 15:59610407-59610429 GAGGGAGGAGGGAGGGAGGAGGG - Intronic
1127758268 15:62113670-62113692 GAGAGAGAACAGTGGGTGTCAGG - Intergenic
1127872349 15:63083831-63083853 GAGGGAGAGAGGAGGGAGGAAGG + Intergenic
1128301234 15:66567569-66567591 GAGGGAGGCCAGGGGGTGGGTGG + Intergenic
1128520337 15:68370706-68370728 GATGGAGAACAGATGATGGTGGG + Intronic
1128798739 15:70483375-70483397 GAAGGAAAACAGAGCCTGGAGGG - Intergenic
1128826126 15:70719063-70719085 GAGGAAGGAAAGAGGGAGGAAGG + Intronic
1129351566 15:74958560-74958582 GGGCGAGAACAGCGGGAGGAGGG - Intronic
1129892457 15:79080350-79080372 GAGGGAGGAAAGGGGGTGGGAGG + Intronic
1129933049 15:79428256-79428278 GAGGGAGAAGAAAGGAAGGAGGG - Intergenic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130125169 15:81087812-81087834 GAGGGAGATCAGAAAGTGCAGGG - Intronic
1130164182 15:81436201-81436223 GAGGGAGAATATAGGGAGGTTGG - Intergenic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1130845211 15:87737536-87737558 GAGTGAGAACATAGGGTGTTTGG + Intergenic
1131447586 15:92512766-92512788 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1131568345 15:93506567-93506589 GAGGGAGACCAGGGGGCTGAGGG - Intergenic
1131849182 15:96519767-96519789 GAGGGAGAAGAGATGGAGAATGG + Intergenic
1132020413 15:98356541-98356563 GAGCGGGAAGAGAGGGAGGAAGG + Intergenic
1132047305 15:98575194-98575216 GATGAAGAAGAGAGGGAGGAGGG - Intergenic
1132169176 15:99629998-99630020 GAGGGAGAAGAGAGGGACGGGGG - Intronic
1132208049 15:99999856-99999878 GAGGGACAACCTGGGGTGGAGGG - Intronic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132262864 15:100441534-100441556 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1132491547 16:234606-234628 GAGCGAGGACGGAGGGGGGACGG + Exonic
1132568063 16:632174-632196 CAGGGAGGACAGTGGATGGAAGG - Intronic
1132647264 16:1004862-1004884 GAGGGAGAAGAGACGGGGGAGGG + Intergenic
1132647281 16:1004907-1004929 GAGGGAGCAGAGATGGGGGAGGG + Intergenic
1132647310 16:1004997-1005019 GAGGGAGAAGAGAAGGGGGAGGG + Intergenic
1132647343 16:1005086-1005108 GAGGGAGCAGAGATGGGGGAGGG + Intergenic
1132647371 16:1005158-1005180 GAGGGAGAAGAGACGGGGGAGGG + Intergenic
1133339900 16:5029335-5029357 GAGGGGGATGAGAGGGTGGCCGG + Intronic
1133363800 16:5195081-5195103 GAAGGAGAACAGGGGGGCGAGGG - Intergenic
1133392053 16:5418663-5418685 GAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1133415845 16:5606437-5606459 GAGGGAGGAATGAGGGTGGAGGG - Intergenic
1133417023 16:5614890-5614912 GAGGAAGAACACAGGGAGGGTGG + Intergenic
1133534454 16:6687714-6687736 CGGGGAGGACAGAGGATGGAAGG + Intronic
1134013069 16:10869478-10869500 GAGGGGGCTCAGAGTGTGGAGGG - Intergenic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1134640312 16:15824744-15824766 GAAAGAGATCAGAGGGTGGTGGG - Intronic
1134806527 16:17130639-17130661 TAAGGAGAATAGAGGATGGAAGG - Intronic
1134815716 16:17204068-17204090 GAGTGAGGACAGAGGTGGGAGGG + Intronic
1134832640 16:17336115-17336137 GATGGAGGGCAGAGCGTGGAAGG + Intronic
1135376233 16:21949710-21949732 GAGGGAGGAGGGAGGGAGGAAGG + Intergenic
1135547812 16:23377575-23377597 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1136622878 16:31442103-31442125 GCAGGAGAATGGAGGGTGGACGG + Intronic
1137610214 16:49812902-49812924 CAGGGAGGACAGTGGGTGGCTGG + Intronic
1137620998 16:49876616-49876638 GAGTGAGATCAGAGGGTCGAGGG + Intergenic
1137662334 16:50219674-50219696 GAGGGAGAAGAAAAGGGGGAGGG - Intronic
1137775470 16:51050670-51050692 GACCGAGATCAGAGGCTGGAAGG + Intergenic
1138235645 16:55380179-55380201 CAGGGAGAGCAGAGGGGGAAGGG - Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138537055 16:57665956-57665978 GAGGGAGTGGAGGGGGTGGAGGG - Intergenic
1138544029 16:57705734-57705756 AGGAGAGATCAGAGGGTGGATGG - Intronic
1138567875 16:57846597-57846619 GGGGGAGAAAGGAGGGAGGATGG - Intronic
1139253531 16:65519566-65519588 GAGGTAGAAAGGAGGGAGGAAGG - Intergenic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1139855499 16:69976534-69976556 GTGGAAGAGGAGAGGGTGGAAGG + Intergenic
1139885217 16:70203652-70203674 GTGGAAGAGGAGAGGGTGGAAGG + Intergenic
1140134187 16:72190647-72190669 GCGGGAGAACAGAGAGTTGCAGG + Intergenic
1140200009 16:72887498-72887520 GAGGAAGGACTGAGTGTGGAGGG + Intronic
1140208069 16:72949593-72949615 GGGGGAAAGCGGAGGGTGGAGGG + Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140584874 16:76277480-76277502 GAGAGAGAAGAGAGGGAGGAGGG + Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1140897588 16:79338675-79338697 GAGGGAGAAAAGAGGGAGAGAGG + Intergenic
1140943610 16:79747108-79747130 GAGGGAGAAGAGAGAGAAGAGGG + Intergenic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141007187 16:80363349-80363371 GAAGGAGAAAAGAGGAGGGAAGG + Intergenic
1141323773 16:83036704-83036726 GAAGCAGAACACAGGGTGCAAGG - Intronic
1141359510 16:83382508-83382530 GATGGAGCACTGAGGGTTGAAGG - Intronic
1141431128 16:83970595-83970617 AGGCGAGGACAGAGGGTGGAAGG + Intronic
1141746482 16:85929791-85929813 GCGGGAGACCAGAGGGAGGGAGG + Intergenic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1142008214 16:87700486-87700508 GGAGGAGGGCAGAGGGTGGAGGG + Intronic
1142008223 16:87700511-87700533 GAGGGAGGAAAGAGGGTGGAGGG + Intronic
1142008249 16:87700604-87700626 GAGGGAGGAAACAGGGTGGAGGG + Intronic
1142236393 16:88924502-88924524 GGGGGAGAAGAGCGGGCGGAGGG + Intronic
1142251454 16:88993793-88993815 GAGGGAGAGAAGAAGGGGGAGGG - Intergenic
1142355509 16:89599757-89599779 GCAGGAGAAGAGAGGGTGGGAGG - Intergenic
1142498273 17:317936-317958 AAGAAACAACAGAGGGTGGAGGG - Intronic
1142804278 17:2363317-2363339 GCTGGAGAGCAGAGGGTGGCTGG + Intronic
1142836881 17:2593914-2593936 GAGGGAGAGGGGAGGGAGGAAGG - Exonic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143021336 17:3918356-3918378 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
1143483423 17:7239532-7239554 GAGGGAGAGAAGAGGAGGGAGGG - Intronic
1143524372 17:7463562-7463584 AAGTGATGACAGAGGGTGGAGGG + Exonic
1143585216 17:7847455-7847477 GAGTGACAACTGAGGGTGGAGGG + Intronic
1143610204 17:8013712-8013734 GAGGGAGAGTATAGTGTGGAAGG - Intronic
1144156724 17:12511342-12511364 GACAGAGGACAGAGCGTGGAGGG + Intergenic
1144405032 17:14943930-14943952 GAAGGAGAAAATAGCGTGGAGGG + Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144886586 17:18467210-18467232 GAAGGAGGACAGAGTCTGGAAGG + Intergenic
1144942985 17:18954199-18954221 GGGGCAGAACAGACAGTGGAGGG + Intronic
1144995415 17:19264886-19264908 GAGGAAGGAAGGAGGGTGGAGGG + Intronic
1145126972 17:20309541-20309563 GAGGGAGAAAGGAGGGAGGGAGG - Intronic
1145145624 17:20477098-20477120 GAAGGAGGACAGAGTCTGGAAGG - Intergenic
1145193717 17:20868916-20868938 GAGGGGGAAAAGAGGGTGGCAGG + Intronic
1145351943 17:22091140-22091162 GAGGGGGAAAAGAGGGTGGCAGG + Intergenic
1145763730 17:27443645-27443667 GGGGGAGGACAGAGTCTGGAAGG + Intergenic
1146455421 17:33005638-33005660 GAGGCAGAAGAGAAGCTGGAGGG - Intergenic
1146459788 17:33036952-33036974 GAGGGAGAAGGGTGGGAGGAGGG + Intronic
1146654829 17:34628971-34628993 GAAGGAGAGCAGAGGATGAAGGG - Intronic
1146688315 17:34856580-34856602 GGGGGAGGACGGAGGGTGGGAGG + Intergenic
1146953146 17:36920517-36920539 GAGAGAGGGCAGAGGCTGGAAGG - Intergenic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147142573 17:38467616-38467638 AAGGAAGAACAGATGATGGATGG - Intronic
1147161303 17:38570967-38570989 GAGGGAGGACAGAGGATGGAGGG - Intronic
1147187243 17:38719623-38719645 GAGGGACACCCGAGGGAGGAGGG + Intronic
1147445726 17:40474286-40474308 GTGGGAGAAGAGAGGGAGGGAGG + Intergenic
1147492127 17:40879388-40879410 GGGGCCTAACAGAGGGTGGAGGG + Intronic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147575128 17:41594593-41594615 GAAGGAGGACAGAGGGAGGGAGG + Intergenic
1147817600 17:43221323-43221345 GAGGGTGGAAAGAGAGTGGAAGG - Intergenic
1148255202 17:46125041-46125063 GAGGGAGGAGGGAGGGAGGAGGG + Intronic
1148255207 17:46125052-46125074 GAGGGAGGAGGGAGGGAGGAGGG + Intronic
1148579640 17:48734680-48734702 GAGGGAGGAGAAAGGGAGGAAGG + Intergenic
1148716607 17:49720285-49720307 GGAGGAGAACAGAGGGGAGAGGG + Intronic
1148731612 17:49840129-49840151 AAGGGAGAGCAGAGGGAGAATGG - Intronic
1148851369 17:50557049-50557071 GAGGTGGAAGAGAGGGAGGATGG + Intergenic
1148892667 17:50819412-50819434 GAGGGGGAATACGGGGTGGAAGG + Intergenic
1149256629 17:54834969-54834991 TTGGGAGCACAGTGGGTGGATGG - Intergenic
1149339286 17:55669397-55669419 GAGGGAGAAAAGTGTGTGGGAGG - Intergenic
1149914066 17:60592271-60592293 AAGGGGGAAGAGGGGGTGGAGGG + Intergenic
1150090936 17:62324171-62324193 GAGGGAGAACATGGGGTGTTTGG - Intergenic
1150428931 17:65100603-65100625 GAGGGAGAGGAGGAGGTGGAGGG - Intergenic
1150506246 17:65701834-65701856 GAGGGAGAACAGAGAGAGTAGGG - Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151276536 17:73038744-73038766 GAGGGAGGAGGGAGGGAGGAGGG + Intronic
1151345799 17:73500499-73500521 GAAGGAGAACAGAAGGAAGATGG - Intronic
1151345804 17:73500531-73500553 GAAGGAGAACTGAGGGGGGATGG - Intronic
1151345812 17:73500562-73500584 GGAGGAGAACAGAGGGAGGATGG - Intronic
1151345862 17:73500780-73500802 GGAGGAGAACGGAGGGAGGATGG - Intronic
1151345870 17:73500812-73500834 GATGGAGAACTGAGGGAGGATGG - Intronic
1151345893 17:73500904-73500926 GGAGGAGGACAGAGGGAGGATGG - Intronic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151671029 17:75571796-75571818 CAGGGAGAGCAGAGGGTGCTCGG + Intronic
1151796772 17:76351859-76351881 GAGGGAGAGCAGAGGGGAGCAGG - Intronic
1152055943 17:78026871-78026893 GAGGGATATTTGAGGGTGGAGGG + Intronic
1152095485 17:78269482-78269504 GCTGGAGAGGAGAGGGTGGACGG + Intergenic
1152492875 17:80649530-80649552 AAGGCAGAACTGTGGGTGGATGG + Intronic
1152623967 17:81379974-81379996 GGGGGGGAGCAGGGGGTGGAGGG - Intergenic
1152808530 17:82370581-82370603 GCGGGAGGAAAGGGGGTGGAAGG - Intergenic
1152859088 17:82685226-82685248 GAGGGAGGACGGAGGAGGGAGGG + Intronic
1152861737 17:82700436-82700458 GAGGAAGAAAAGAGGATGGAAGG + Intergenic
1152913103 17:83016686-83016708 GAGAGAGAATAGAGGAGGGAGGG + Intronic
1153098533 18:1437392-1437414 GAGGGAAATCTGAGGGTGGTTGG - Intergenic
1153268338 18:3294477-3294499 GAGAGAGAATAAAAGGTGGAGGG + Intergenic
1153478071 18:5518332-5518354 GAGGGAGTACACGGGGTGGGAGG - Intronic
1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG + Intronic
1153574124 18:6503985-6504007 GAGGGAGGAGGGAGGGAGGAAGG + Intergenic
1153836750 18:8970484-8970506 GAGGGGGAAGGGAGGGAGGAAGG + Intergenic
1153845185 18:9043114-9043136 AAGGAAGAAGAGAGGGTGGGAGG - Intergenic
1153924595 18:9824963-9824985 GAGGGAGAAGAGCGGCAGGAAGG - Intronic
1153987790 18:10368591-10368613 GAGGGAGAGCAGAGAGAGGGAGG + Intergenic
1154056373 18:11016373-11016395 GAGGCAGAAAGGAGGCTGGAGGG + Intronic
1155157746 18:23171677-23171699 GAGGGTTATCAGAGGGTGGCAGG - Intronic
1155823839 18:30413495-30413517 GAGGGAGGAGAAAGGGAGGATGG + Intergenic
1155925252 18:31649086-31649108 GAGGCAGCACAGAGTGTGGGAGG - Intronic
1156252079 18:35360774-35360796 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1156703673 18:39854622-39854644 GAGAGAGAAGAGAGGAGGGACGG + Intergenic
1156717096 18:40024335-40024357 GAGAGAGAAGAGAGAGTGAAAGG + Intergenic
1156837625 18:41574412-41574434 GATGGAAAAAAGAGGGTGGAGGG + Intergenic
1157085207 18:44573436-44573458 AAGGGAGAATGGAGGGTAGAAGG + Intergenic
1157221586 18:45832071-45832093 GAGTGTGAACAGAGGGTGGTGGG - Intronic
1157268303 18:46248367-46248389 GAGGGTGAGCAGTGGGTGGCTGG + Intronic
1157488680 18:48107420-48107442 GAGGAAGAGGAGAGGGAGGAGGG + Intronic
1157690076 18:49674425-49674447 GAGGGAGAACAAGGGAGGGAGGG + Intergenic
1158027315 18:52915733-52915755 GAGGCAGAAAAGAGGAAGGAAGG + Intronic
1158078433 18:53560061-53560083 GAGGGGGAAAAGAGGGCGGGAGG + Intergenic
1158103786 18:53861387-53861409 GAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1158103791 18:53861398-53861420 GAGGGAGGAAGGAGGGAGGAGGG + Intergenic
1158103817 18:53861462-53861484 GAGGGAGGAAGGAGGGAGGAGGG + Intergenic
1158187226 18:54784443-54784465 AATGGGGAACAGAGGGTGGAGGG - Intronic
1158425771 18:57338578-57338600 GAGAGAGAAGGGAAGGTGGAGGG - Intergenic
1158435494 18:57432981-57433003 GAGGGAGGAGGGAGGGAGGAAGG + Intergenic
1158576848 18:58645435-58645457 AAGGGAGAATGGAGGGTGGAAGG + Intergenic
1158729361 18:60005090-60005112 GAGTGAGAACATAGGATGTATGG + Intergenic
1158760638 18:60381643-60381665 GAGAGGGAAGAAAGGGTGGAGGG + Intergenic
1158863926 18:61619353-61619375 GAGAGACAACACAGGGTGGGTGG - Intergenic
1159214456 18:65372357-65372379 GAGGGAGAGGAGAGGGTGCCAGG + Intergenic
1159776437 18:72608337-72608359 AAGGAAGAACAGAGCGGGGAGGG - Intronic
1159804820 18:72943528-72943550 GAAGTAGAAAATAGGGTGGAAGG - Intergenic
1160429590 18:78802242-78802264 GAGGGGAAACGGAGGCTGGAGGG + Intergenic
1160629856 18:80239210-80239232 CAGGGAGAAGAGGGGGTCGAAGG + Intronic
1160751815 19:737951-737973 CAGGGAGAACAGACCGTGGACGG + Intronic
1160916966 19:1501393-1501415 GAGGGAGGAGAGAGGGTGCCAGG + Intergenic
1160974033 19:1783726-1783748 CAGGGAGAACAGAGGTGGCAGGG + Intronic
1161007071 19:1942044-1942066 GGGGGAGAGCAGGGGGTGGTGGG + Intronic
1161198879 19:3003222-3003244 GAGGGAGAGAGGAGGGAGGAGGG + Intronic
1161453298 19:4358345-4358367 GAGGGAGGGCAGAAGTTGGAGGG - Intronic
1161530538 19:4786505-4786527 GAGGGAGAGAGGAGGTTGGAGGG + Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161776134 19:6263260-6263282 GAGGCAGAACAGAGGAAGGGTGG + Intronic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1161851455 19:6739908-6739930 GAGAGAGAGCGGAGGGTGGAGGG - Intronic
1161922839 19:7279447-7279469 GAGGGAGAAGAGAGTGAGGAGGG + Intronic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162320153 19:9966765-9966787 GACGGAGAAGAGAGGGGAGATGG + Intronic
1162362158 19:10226947-10226969 GAGGGATGGAAGAGGGTGGAGGG - Intronic
1162515016 19:11142615-11142637 GAGGGAGAACAAACGGGGGCGGG + Intronic
1162515567 19:11145374-11145396 GAGGGAGGAGAGAGGGAGGTTGG - Intronic
1162569266 19:11461523-11461545 GAGGGAGGAAAGAGGGAGGGAGG - Intronic
1162875648 19:13619010-13619032 GAAGGAGAAGGGAGGGAGGAAGG + Intronic
1162971237 19:14182650-14182672 GAGGGAGGGCCGGGGGTGGAAGG + Intronic
1163720506 19:18896176-18896198 GCGGGAGAGCGGAGGGCGGAGGG + Intronic
1164202644 19:23031268-23031290 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1164258613 19:23550495-23550517 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164739828 19:30567621-30567643 GAGGGAGCATAGAGAGTGGGTGG + Intronic
1164744176 19:30599198-30599220 GAGGAAGAAGGGAGGGAGGAAGG - Intronic
1165369948 19:35398786-35398808 TTGGGAGAACAGAGGAAGGAAGG - Intergenic
1165374336 19:35431249-35431271 GAGGGAAAACACATGGTGCAGGG - Intergenic
1165604948 19:37093817-37093839 GAGGTAGAACAGATGGAGAATGG + Intronic
1165832690 19:38737106-38737128 GAGGGAACCCGGAGGGTGGAGGG - Intronic
1166193894 19:41193874-41193896 GAGGCAGAGAAGAGGCTGGAGGG + Intronic
1166211076 19:41306811-41306833 TAGGAAGAACAGGAGGTGGAAGG - Exonic
1166251790 19:41576372-41576394 GAGGGAGCACAGAGACTGGCTGG + Intronic
1166255271 19:41599831-41599853 GAGGGAGCACAGAGACTGGCTGG + Intronic
1166335555 19:42104606-42104628 GAGGCAGAACAGAGGGTATGAGG + Intronic
1166455552 19:42937249-42937271 GAGGCAGAACTGAGAGAGGAGGG - Intronic
1166485091 19:43205709-43205731 GAGGCAGAACTGAGAGAGGAGGG - Exonic
1166885739 19:45960047-45960069 GAGGGAATAGAGAGAGTGGAGGG + Intronic
1166885992 19:45961156-45961178 GCGGGGGCACACAGGGTGGAGGG + Intronic
1167295572 19:48646926-48646948 GAGGGAGAGGAGGGGGAGGAGGG + Intergenic
1167324091 19:48813350-48813372 TGGGGAGAAAAGAGGGGGGAAGG + Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167595130 19:50423503-50423525 GAGGGAGACCAGAGCCAGGAGGG + Intronic
1167627631 19:50603203-50603225 GAGGGAGAGGAGAGGGAGAAGGG - Intergenic
1167649109 19:50719846-50719868 GAGGGAGGGGAGAGGGCGGAGGG - Intergenic
1167651776 19:50734890-50734912 GAGGGAGAGAAGAGGGCAGAGGG - Intergenic
1168228127 19:55011211-55011233 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1168433798 19:56302294-56302316 GAGGGAGAAAAGAGGGAAGAAGG - Intronic
1168521730 19:57056511-57056533 GGGGCAGACCTGAGGGTGGAGGG + Intergenic
925032198 2:659626-659648 GAGGGAGAAAAGAAGGAAGAAGG + Intergenic
925339726 2:3127777-3127799 GGTGGAGGACGGAGGGTGGAGGG + Intergenic
925926847 2:8677002-8677024 GAGGGTGCACAGCGGATGGAGGG + Intergenic
926135038 2:10330571-10330593 GTGTGAGAACAGAGGGAGAAAGG - Intronic
926412532 2:12619617-12619639 GAGGAAGAAGAGAGGGAGGAGGG - Intergenic
926419932 2:12686195-12686217 GAGGCAGCACAGAGCATGGAGGG - Intergenic
926433872 2:12818373-12818395 GAGGGAGGACGGAGGGAGAAGGG - Intergenic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
926557465 2:14376167-14376189 GGGTGAGAACAAAGGGTAGATGG - Intergenic
927469856 2:23365178-23365200 GAGAGAGAAGAGAGGGAGGGAGG + Intergenic
927558522 2:24052372-24052394 GAGGGAGGAGAGAGGTGGGAAGG - Intronic
927865194 2:26583545-26583567 GAGGAAGGACAGAAAGTGGAGGG + Intronic
927965176 2:27263645-27263667 CAGGGATAACAGTGGGTTGAAGG - Intronic
927972170 2:27312653-27312675 GCAGGAGAACAGAGTGGGGAGGG - Intronic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
928286006 2:29990532-29990554 GAGGGAGATGAGAGGGAGGAAGG + Intergenic
928347335 2:30512482-30512504 GAAGGAGATAAAAGGGTGGATGG + Intronic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929171159 2:38934553-38934575 GAGGGAGAGAAGCGGGAGGAAGG - Intronic
929279856 2:40066041-40066063 GAGGGAGAAGGGAGGGAGGGGGG - Intergenic
929279863 2:40066052-40066074 GAGGGAGAAGTGAGGGAGAAGGG - Intergenic
929279869 2:40066074-40066096 GAGGGAGAAGAGAGGGAGAAGGG - Intergenic
929444503 2:41991951-41991973 GAGGGAGAAGAGGAGGGGGAGGG + Intergenic
929547977 2:42868395-42868417 GAGGGAGAAGAGTGGCTGGCTGG + Intergenic
930238086 2:48906857-48906879 AAGGGAGGAATGAGGGTGGAGGG + Intergenic
930343859 2:50152913-50152935 GAGGGAGAAGAGAAGGAGAAAGG - Intronic
930581143 2:53213739-53213761 GAGTGAGAACACATGGTGTATGG + Intergenic
931390104 2:61834351-61834373 GAGGGAGAGTGGAGGGAGGAGGG + Intronic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931933381 2:67166885-67166907 GAGGCTTATCAGAGGGTGGAGGG + Intergenic
931948116 2:67332856-67332878 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
932141183 2:69279789-69279811 GAAGGAGAACATGGGGTGGTTGG + Intergenic
932239011 2:70142607-70142629 GAAGGAGAACAGAGAGGGGGAGG - Intergenic
932323536 2:70839072-70839094 GAAGGAGAAGAGAGGGAGGAGGG + Intergenic
932424482 2:71620436-71620458 GAGGAAGAGCAGAGGGTGCCTGG + Intronic
932491756 2:72127232-72127254 GAGGGAGAAGAGAGGGGGAAAGG - Intergenic
933080320 2:77977222-77977244 GACGAAGAACAGGGGTTGGAGGG - Intergenic
933270351 2:80226637-80226659 GAGGGAAAAAGTAGGGTGGAGGG - Intronic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
933866581 2:86523675-86523697 GAGGCAGAGGAGAGAGTGGAAGG - Intronic
934047330 2:88183576-88183598 GAGGGAGGAAAGAGAGAGGAAGG - Intronic
934060505 2:88288198-88288220 GAGAGAGAAGAAAGGATGGAAGG - Intergenic
934559977 2:95308188-95308210 GGGGGAGAGCTGGGGGTGGACGG - Intronic
935063234 2:99626375-99626397 GAGGAAGAAGGGAGGGAGGAAGG - Intronic
935063286 2:99626527-99626549 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
935206566 2:100901588-100901610 GCAGGAGATCAGAGGGTGGGTGG + Intronic
935234463 2:101126924-101126946 GAAGGAGATGAGAAGGTGGAAGG - Intronic
935304118 2:101720028-101720050 AGGGGAGAACAGTGGATGGAAGG + Intronic
935358456 2:102226694-102226716 GAGGGAAAACGGAGGGAAGAAGG + Intronic
935433666 2:103004762-103004784 GACAGAGAGCAGGGGGTGGATGG + Intergenic
935501533 2:103846776-103846798 GAGGGAGAAGAAAGGGAGAATGG + Intergenic
935891173 2:107680206-107680228 GAGAGAGCACAAAGGATGGAGGG + Intergenic
936014848 2:108950224-108950246 GAGGGAGGAGGGAGGGAGGAAGG - Intronic
936060577 2:109293234-109293256 GAGGGAGGACAGAGGGATGGTGG + Intronic
936061168 2:109296638-109296660 GAGCAAGAACAGATGGTGCAGGG - Intronic
936233567 2:110724931-110724953 AAGGAAGAACGGAGGGAGGAAGG + Intergenic
936286096 2:111182514-111182536 GAGGGAGAGAGCAGGGTGGAAGG - Intergenic
936462263 2:112722336-112722358 GGGGGAGGACAGAGGGAGGGAGG + Intronic
936644597 2:114354559-114354581 GAAGGAGTAAAGAGGTTGGAGGG + Intergenic
936669512 2:114640604-114640626 GAGGGAGGACAGAGACAGGAGGG - Intronic
936855123 2:116948367-116948389 GAGGGAGAGGAGGGGATGGAGGG + Intergenic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937439410 2:121903719-121903741 GAGGGAGGAGACAGGGTGAAAGG - Intergenic
937784648 2:125881918-125881940 GAGGTAGACCACAGAGTGGAGGG - Intergenic
937911760 2:127079005-127079027 GAGGGAGGGCAGGGCGTGGAAGG - Intronic
937930879 2:127204338-127204360 GAGGGAGGAGGGAGGGGGGAGGG + Intronic
937989974 2:127656915-127656937 GTGGGAGAACATGGGGTGTATGG - Intronic
938082816 2:128379299-128379321 GAGGGAGGCGAGAGGGGGGAAGG - Intergenic
938555674 2:132421827-132421849 GAGAGAGAAGAGAGGGTAGAGGG + Intronic
939019060 2:136937330-136937352 TAGGTAGAACAGCGGGTGGCGGG - Intronic
939307262 2:140427394-140427416 AAGGACGAACGGAGGGTGGAAGG - Intronic
939523321 2:143260845-143260867 AATGGAGAACAGAGGAAGGATGG - Intronic
939966008 2:148610889-148610911 GGTGGAGAACAGATGGAGGAAGG + Intergenic
940366500 2:152853863-152853885 GAGGGAGAAGGGTGGGAGGACGG - Intergenic
940615497 2:156044115-156044137 GAGTGAGAACACATGGTGTATGG + Intergenic
940714079 2:157198564-157198586 AAGGAAGAACAGAGGAAGGAAGG + Intergenic
941451600 2:165666649-165666671 GAGGAAGAAAAGAGAGAGGAAGG + Intronic
941540267 2:166773478-166773500 GAGGGAGAGCAGAGGCGGGCTGG - Intergenic
941809240 2:169739003-169739025 GAGGGAGAGGAGATGGGGGAGGG - Intronic
942052775 2:172156182-172156204 AAGGGAGAACAGAGAGGGGCGGG - Intergenic
942450750 2:176106881-176106903 GAGGGGGAAGAGGGGGAGGAAGG - Intronic
942503178 2:176613844-176613866 GAGGGAGGAGGGAGGGAGGAAGG - Intergenic
942669398 2:178357992-178358014 GAGTGAGAACAGGTGGTGTATGG - Intronic
942809686 2:179983257-179983279 GAGGGTGAAGGGAGAGTGGAGGG - Intronic
943089708 2:183359306-183359328 GAGGGAGTTCAGAGTGTGCAGGG - Intergenic
943111819 2:183616242-183616264 GAGTGAGAACAGATGGTGTTTGG + Intergenic
944121070 2:196241461-196241483 GAGAGAGGACAGAGGAGGGACGG - Intronic
944155671 2:196604843-196604865 AAGGGAGAACCCTGGGTGGATGG - Intergenic
944334079 2:198508718-198508740 GAGTGAGAACATAGGGTGTTTGG + Intronic
944374373 2:199024511-199024533 GAGGGAGAAAAGAGGAAGAAAGG - Intergenic
944523820 2:200598127-200598149 GAGGGAGAGAGGAGGGAGGAAGG + Intronic
945110175 2:206355487-206355509 TAGGAAGAAGAGAGGGAGGAAGG - Intergenic
945624689 2:212188255-212188277 GAGGGAGAGAAGAGGGAGGGAGG - Intronic
945923227 2:215777722-215777744 CAGGGAGAACACAGTGTGAAGGG - Intergenic
946119083 2:217493411-217493433 GAGGGTGAATGGAGGGTGGGAGG - Intronic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946303883 2:218844695-218844717 GAGGGAGGAGAGTGGGAGGAGGG + Intergenic
946305289 2:218853461-218853483 GAGTGTGAACAGGGCGTGGAGGG + Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946456638 2:219832005-219832027 GAGAGAGGACAGAGTGTGAAGGG + Intergenic
946716142 2:222556697-222556719 GGGGGAGGAGTGAGGGTGGATGG - Intronic
946716224 2:222556942-222556964 CAGGGAGAAGTCAGGGTGGATGG - Intronic
946785137 2:223235438-223235460 GAGGGGGAACAGAGAATGAAAGG - Intergenic
946898736 2:224352357-224352379 GAGGAAGAAGAGAGGAAGGAGGG + Intergenic
947030052 2:225783019-225783041 GAGGGAGGAAGGAGGGAGGAAGG - Intergenic
947064397 2:226205543-226205565 GAGGGAGAAAGGATGATGGAGGG + Intergenic
947190898 2:227503553-227503575 GAGGGAGAAATGAGGAAGGAAGG - Intronic
947262736 2:228242253-228242275 GAGGGAGTGCACAGGCTGGAGGG - Intergenic
948035599 2:234855924-234855946 GAGGGAGAATGGAGGCTGGGAGG - Intergenic
948099503 2:235362335-235362357 GAGGAAGACAAGAGTGTGGAAGG - Intergenic
948108818 2:235437742-235437764 GATAGAGAGCAGATGGTGGAAGG - Intergenic
948351901 2:237347681-237347703 CAGGGATAGCACAGGGTGGAAGG - Intronic
948371773 2:237494201-237494223 GACAGAGGGCAGAGGGTGGAGGG + Intronic
948380144 2:237545039-237545061 GAGTGGGGACAGTGGGTGGAGGG + Intronic
948398966 2:237668613-237668635 GAGGGGGAACTGAGGCTGGAAGG - Intronic
948666140 2:239535915-239535937 GAGAGAGTACAGAGCGTGGAAGG - Intergenic
948751826 2:240137506-240137528 GAGGAAGAACAGGGGAGGGAAGG + Intergenic
948873193 2:240813786-240813808 GCGTGAGAACAGAGTGTGAAAGG + Intronic
949051324 2:241899027-241899049 GGGGAAGAACACAGGGTGGCAGG + Intronic
949072292 2:242033029-242033051 GAGAGAGGGCAGAGGGTAGACGG + Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169267254 20:4174275-4174297 GAGGGAGAGCAGAGGGTCCAGGG + Intronic
1169293925 20:4376355-4376377 GACTGAGAACAGAGAGTGCAGGG - Intergenic
1169981038 20:11384147-11384169 GAGGTAGAAGATAGGGTGCATGG - Intergenic
1170003383 20:11639705-11639727 GATGGATACCAGAGGCTGGAAGG + Intergenic
1170624619 20:18021773-18021795 GAAGGAGAGAAGAAGGTGGAAGG + Intronic
1170868343 20:20180994-20181016 GGGGCAAATCAGAGGGTGGAGGG + Intronic
1171198104 20:23217280-23217302 GAGTGAGAACAGAGGATGTTTGG + Intergenic
1171249620 20:23638051-23638073 GAGGGAGAAGGGAGGTGGGAGGG - Intronic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1171370924 20:24661493-24661515 GAGGGAGGGAAGAGGGAGGAAGG + Intronic
1171401311 20:24874474-24874496 AAGGAAGAACAGGGGGTGCAGGG - Intergenic
1171545589 20:25998108-25998130 GTGGGAGAGGAGTGGGTGGAGGG + Intergenic
1172061592 20:32190347-32190369 GCGGGAGGACAGTGGGAGGAAGG + Intergenic
1172099431 20:32476317-32476339 GAGGGGGAAGAGAGGCTGGCAGG + Intronic
1172171741 20:32939626-32939648 GAGAGAGAAAGGAGGGAGGAAGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172285088 20:33734559-33734581 GAGGGGGAGCAGTGGGTTGAGGG + Intronic
1172966542 20:38839484-38839506 GAGGAAGGAGAGAGGGAGGAAGG - Intronic
1173165941 20:40687611-40687633 GAGAGAGACGAGAGGGTGGGAGG - Exonic
1173307014 20:41860419-41860441 GAAGGAGAAAAGAGCATGGAAGG + Intergenic
1173438992 20:43058426-43058448 GAGAGAGAAAAGAGGATGGAAGG + Intronic
1174172865 20:48627975-48627997 GAGGGAGGACAGCGGGTTGGCGG + Intronic
1174280726 20:49437294-49437316 GAGGGAGAACTGATGGGGGCTGG + Intronic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1174612204 20:51807153-51807175 GAGGGAGAGTGGGGGGTGGAGGG + Intergenic
1174627610 20:51928231-51928253 GAGGGAGAAAGGAGGGAAGAAGG + Intergenic
1175025247 20:55894855-55894877 GAGGAAGAATAGAGGAAGGATGG + Intergenic
1175392497 20:58636073-58636095 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175392534 20:58636193-58636215 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175792832 20:61752896-61752918 GGGGGACACCAGAGGGTGGGAGG + Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1176138918 20:63536762-63536784 CAGGGAGGACAGAGGGTCCAGGG - Intronic
1176266453 20:64212023-64212045 GTAAGAGAACAGGGGGTGGAGGG - Intronic
1176383999 21:6127932-6127954 GAGGGAGGAGAGAGGAGGGAGGG + Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177565645 21:22817993-22818015 GAGGGGGAACAGGGTGAGGAAGG + Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1178777553 21:35566551-35566573 GAGGAAGAATAGAGGGAGGAAGG - Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1178837591 21:36111773-36111795 GAGGGAGGAGGGAGGGAGGATGG + Intergenic
1178893100 21:36536310-36536332 GAGGGAGAACTGAGGATGGGTGG - Intronic
1179130943 21:38636668-38636690 GTGGGAGAGGAGAGGTTGGATGG - Intronic
1179615391 21:42580109-42580131 GAGGGAGGACCAAGGGGGGAGGG - Intronic
1179650519 21:42805501-42805523 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1179716874 21:43292996-43293018 GAGGGAGAACAGGGAGGGAATGG - Intergenic
1179739475 21:43410306-43410328 GAGGGAGGAGAGAGGAGGGAGGG - Intergenic
1180787525 22:18555123-18555145 GAGGGCGAACAGAGCGGGGGTGG - Intergenic
1181119673 22:20657578-20657600 GAGGGAGAAAAGAGAGTGGCAGG + Intergenic
1181174331 22:21027318-21027340 GAGAGAGAGCAGAGGGCGGCAGG + Exonic
1181234214 22:21440182-21440204 GAGGGCGAACAGAGCGGGGGTGG + Intronic
1181244433 22:21494649-21494671 GAGGGCGAACAGAGCGGGGGTGG - Intergenic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181534389 22:23534125-23534147 GAGGAAGAAGGGAGGGAGGAAGG + Intergenic
1181537193 22:23552592-23552614 GAGGTAGAAGAGAGGATGGATGG - Intergenic
1181711873 22:24696215-24696237 GAGGGGGAAGAGGGGGAGGAGGG - Intergenic
1181754388 22:25013006-25013028 GAAGGGGAACTGAGAGTGGAGGG + Intronic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181868211 22:25876159-25876181 GAAGGAGAACACAGACTGGAGGG - Intronic
1181883376 22:25999528-25999550 GAGGGGGAAGAGGGGGAGGAGGG - Intronic
1181884649 22:26010659-26010681 GATGAAGGACAGAGGATGGAAGG - Intronic
1181901519 22:26160134-26160156 GAGAGAGGAAAGAGGGAGGAAGG + Intergenic
1181902391 22:26167618-26167640 GAGGCCTACCAGAGGGTGGAAGG + Intergenic
1181977579 22:26741900-26741922 GAAGGAGAAGAGAGGAAGGAAGG - Intergenic
1181999763 22:26910904-26910926 GAGAGAGAGGAGAGGGTGGGAGG - Intergenic
1182103265 22:27671990-27672012 GAGGGAGCAGGGAGGGAGGAAGG + Intergenic
1182163112 22:28143609-28143631 GAGGGAGAACAGAGAGCGTGAGG + Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1182836499 22:33346243-33346265 GAGAGAGAAGAGAGGAAGGAAGG - Intronic
1182875982 22:33691262-33691284 GAGGGAGGAGAGAGGGAGGGAGG + Intronic
1182890955 22:33818446-33818468 GAGGGAGAAAAGAGGAGGGGAGG + Intronic
1182960595 22:34470902-34470924 GAGGGAGAAAATAGAATGGAAGG - Intergenic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183210065 22:36445632-36445654 GAGGGAGGAAAGAGGAAGGAAGG + Intergenic
1183295264 22:37025442-37025464 CTTGGAGAACTGAGGGTGGAAGG + Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183730913 22:39617866-39617888 GAGGGAGGAAAGAGGGAGGGGGG - Intronic
1183863365 22:40685020-40685042 TAGGGAGAACAGGTGGTCGAGGG + Intergenic
1184002029 22:41682135-41682157 GAGGCTGGACATAGGGTGGACGG + Intronic
1184044921 22:41967091-41967113 AAGGAAGAACAGAGGGTGCTGGG - Intergenic
1184064126 22:42106354-42106376 GAAGGAGAAGAGAGGGAAGAGGG + Intergenic
1184293029 22:43508441-43508463 GATGGATGACAGAGGGGGGATGG - Intergenic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1184380816 22:44143878-44143900 GAGGGGGAAGAGAGTGAGGAAGG - Intronic
1184508600 22:44918787-44918809 GAGGAAGAAGAGAGGGTGCTGGG + Intronic
1184639689 22:45863819-45863841 GAGGGGGCACAGAGTGGGGAAGG - Intergenic
1184691320 22:46118612-46118634 GCGGGAGGAAGGAGGGTGGATGG - Intergenic
1184692327 22:46122958-46122980 AAGCGAGAACAGAGGGAGGTGGG - Intergenic
1184835722 22:47019880-47019902 AAGGGAGAGGAGAGGATGGAGGG - Intronic
1185015300 22:48339323-48339345 GAGGGAGAAGAGAGGGAGAGAGG + Intergenic
1185100218 22:48836352-48836374 GTGGGAGAGCAGAGGCTGCAGGG + Intronic
1185108943 22:48890106-48890128 GAGGCAGCACAAAGGCTGGAAGG + Intergenic
949195591 3:1302490-1302512 GAGAGAGAGAAGAGGGAGGAAGG + Intronic
949379988 3:3433641-3433663 GAGGGAGAAGAAAGGAGGGATGG + Intergenic
949768213 3:7550334-7550356 GAGGGAGAAGGGAGGAGGGAAGG - Intronic
949943774 3:9174449-9174471 GAGGGAGAAAGCAAGGTGGAGGG + Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950483647 3:13260171-13260193 GAGGAAGGGAAGAGGGTGGAGGG + Intergenic
950677521 3:14563623-14563645 GAGGGAGAAGGCAGGGAGGAGGG + Intergenic
950768835 3:15294427-15294449 GAGGAAGAAAGGAGGATGGAAGG - Intronic
950903848 3:16520069-16520091 GAGGGAGAAAGGAGCGTGAAGGG + Intergenic
951109592 3:18786198-18786220 AAGGGAGTGCAGGGGGTGGAGGG - Intergenic
951396702 3:22177816-22177838 GAGTGAGAACATACGGTGGTTGG + Intronic
951894720 3:27599972-27599994 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
952342517 3:32457917-32457939 GAGGCAGAGCAGAGGGTGTGGGG + Intronic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
952785147 3:37146455-37146477 GAGGGAGCACAGTGGGGTGAGGG - Intronic
952879324 3:37973522-37973544 CAGCGAGGAAAGAGGGTGGAAGG - Intronic
953086336 3:39671676-39671698 GAGGGAGAACAGATAAGGGAGGG - Intergenic
954092142 3:48293634-48293656 GTGGGAGAACAGAGGAAAGAAGG - Exonic
954148785 3:48647302-48647324 GAGGGAGGGTGGAGGGTGGAGGG + Intronic
954367410 3:50154056-50154078 GAGGGAGAAGAGAGGGGAGAAGG + Intergenic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954579797 3:51697056-51697078 CAGGGAGAACAGAGGATCAAGGG - Intronic
954796040 3:53161748-53161770 GGGGGAGAACACAGAGTGGGTGG - Intronic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955034132 3:55249842-55249864 GTTGGAGAGCAGAGGGTGGGAGG - Intergenic
955200416 3:56847093-56847115 GAGTCAGAATAGGGGGTGGAGGG + Intronic
955421017 3:58737763-58737785 GAGGGAAAAAAGAGTGTGCATGG + Intronic
955552041 3:60095611-60095633 GAGGGAAAGCTGAGGGTGAAGGG + Intronic
955636533 3:61036197-61036219 GGGGCAGAACAGAGTGTGGTAGG + Intronic
955719796 3:61868543-61868565 GAGGAAGAAAAGAGATTGGAAGG - Intronic
955804931 3:62723938-62723960 GAGGAAGAGCACTGGGTGGAGGG + Intronic
955843370 3:63135739-63135761 CAGGGACAAAAGAGGGTAGAGGG + Intergenic
956262682 3:67362257-67362279 GAGGGAGAACAGCATGTGCAAGG - Intronic
956849706 3:73217730-73217752 GAGGGAGAAAAGGGAGGGGAGGG - Intergenic
957040076 3:75329721-75329743 GAGGGAGAGCAGGGGAAGGAGGG - Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957486923 3:80873382-80873404 TAGGCAGACTAGAGGGTGGAGGG + Intergenic
957954168 3:87162095-87162117 GAGGGAGGATAAAGGGAGGAGGG - Intergenic
958421809 3:93939013-93939035 AAGGGGGAATAGAGGGTGGAAGG - Intronic
958687161 3:97413398-97413420 GAGGGAGAAAAGGGGAAGGAGGG + Intronic
959080079 3:101791086-101791108 GAGCGAGGACAGTGGGAGGAGGG - Intronic
959543854 3:107571123-107571145 AAGGGGGAATGGAGGGTGGAAGG + Intronic
959574158 3:107916537-107916559 GAGGGAGGAGGGTGGGTGGAAGG - Intergenic
959760954 3:109964286-109964308 GAGGGAGGGCAGAGGGCGGGGGG + Intergenic
960310259 3:116109751-116109773 GAGGAGGAATGGAGGGTGGAAGG + Intronic
960674417 3:120180822-120180844 GCAGCAGACCAGAGGGTGGATGG + Intronic
960714215 3:120559765-120559787 GAGGGAGAAGAGAGGGAGAAAGG - Intergenic
960719246 3:120609579-120609601 GAGGGAGGGAGGAGGGTGGAGGG - Intergenic
960891456 3:122452628-122452650 GAGGGAGGAGAGAGGGAGGGAGG + Intronic
961004635 3:123396712-123396734 GAGAGAGAAGGGAGGGAGGAAGG + Intronic
961044862 3:123701263-123701285 GAGGGAGAGCAGGGGAAGGAGGG - Intronic
961168400 3:124779323-124779345 GAGGGAGCAAAGGGGATGGAAGG + Intronic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
961730434 3:128960991-128961013 GAGGAGGAATGGAGGGTGGAAGG - Intronic
962275712 3:134011871-134011893 GTGTGAGAACAGAGGGAGGCGGG + Intronic
962854163 3:139329280-139329302 CAGGAAGGAGAGAGGGTGGAGGG + Intronic
962857637 3:139363276-139363298 GAGGGTGAGCAGTGGGTGGGTGG + Intronic
963192321 3:142486616-142486638 GAGAGAGAAGAGAGGGAGGAAGG - Intronic
963238770 3:142982272-142982294 GAGGGAGAGGAGAGGAGGGAGGG + Intronic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963494715 3:146044793-146044815 GAGAGAGAACAAAGGGGGAAAGG + Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
963952130 3:151214488-151214510 AAGGAAGAACAGAGGGAGGGAGG - Intronic
964287450 3:155134292-155134314 GAGGATTAATAGAGGGTGGAGGG - Intronic
964484813 3:157176287-157176309 GAGGGAGCACAGCGTGTGTAAGG + Intergenic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
965173081 3:165293879-165293901 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
965211630 3:165797277-165797299 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
965286876 3:166828539-166828561 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
965868631 3:173238261-173238283 CAGGGAGATTAGAGAGTGGAGGG - Intergenic
966066695 3:175828985-175829007 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
966398596 3:179525390-179525412 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
966602715 3:181791041-181791063 GTGGGAGAAGAGAGAGAGGAAGG + Intergenic
966696708 3:182797014-182797036 GAGGAAGAACAGAAAGTTGAGGG - Intronic
966833200 3:184028863-184028885 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
966863275 3:184242243-184242265 CAGGGAGCTCAGAGGATGGAGGG - Exonic
966876282 3:184323704-184323726 GAGGGACAGGAGAGGGTGGTGGG - Intronic
967156065 3:186693457-186693479 GAAGAAGAACAGTGGGTTGAGGG - Intergenic
967277367 3:187789886-187789908 GAGGAAGAAGAGAGGAAGGAAGG + Intergenic
967613933 3:191542242-191542264 AAGGCAGAAAAGAGAGTGGAAGG - Intergenic
967963885 3:194945560-194945582 CAAGGAGAAGAGAGGGGGGAAGG + Intergenic
968583493 4:1405585-1405607 GAGGGAGAAAGGAGGGAGGGAGG + Intronic
968663700 4:1809655-1809677 GGAGGAGAGCAGAGGGAGGACGG - Intergenic
968726583 4:2250703-2250725 TAGGGAGAATAGAGTGGGGATGG + Intronic
968835226 4:2958879-2958901 GAGGAGGAAAAGAGAGTGGAAGG + Intronic
968889324 4:3359256-3359278 GAGGGAGAGGAGGAGGTGGAGGG - Intronic
968889332 4:3359280-3359302 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
968957440 4:3726456-3726478 GAGGGAGAGGAGAGAGAGGAAGG + Intergenic
969143551 4:5100745-5100767 GAGGGAGGAGGGAGGGAGGAGGG - Intronic
969152887 4:5185548-5185570 GGGGGAGGACAGAGACTGGAAGG + Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969581109 4:8065996-8066018 GAGGGAGAAAGGAGGGAGGGAGG + Intronic
970047031 4:11866071-11866093 GAGGGCGAAGGGAGGGAGGAGGG + Intergenic
970262275 4:14239649-14239671 GAGGGAGAAAGCAGAGTGGAAGG + Intergenic
970328041 4:14948827-14948849 GAGAGAGAAGGGAGGGGGGAGGG - Intergenic
970522352 4:16898676-16898698 GAGGGAGAGGAGAGGAGGGAGGG + Exonic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
970607313 4:17692716-17692738 GAGGGAGGACAGGGGAAGGAAGG + Intronic
970781576 4:19744164-19744186 GAGGGAGAAGAAGGGATGGAAGG - Intergenic
970850359 4:20595400-20595422 GAGGGAGGAGAGTGGGTGGGAGG + Intronic
971380978 4:26097385-26097407 TGGGGAGAACAGAAGATGGAAGG + Intergenic
971394347 4:26214675-26214697 GAGGGAGGAGAGAGGGAGGAAGG + Intronic
971570938 4:28209992-28210014 GAGGGGGAAGAGGGGGAGGAAGG - Intergenic
971769845 4:30882158-30882180 GAAGGGGAAGAGAGGGAGGAAGG - Intronic
971823897 4:31596318-31596340 GAGGGAGTAGAGAGGAGGGATGG - Intergenic
972374655 4:38459200-38459222 GAGGGAGGAGAGAGGGAGAAAGG + Intergenic
972529808 4:39951183-39951205 GAGGCAGAACAGAGGCCAGATGG - Intronic
972601984 4:40581042-40581064 GTGGGAGCACAGAGGTTGGGAGG + Intronic
972694667 4:41433901-41433923 GAGGGAGGACTGAGGGCAGAGGG + Intronic
972700954 4:41492421-41492443 GAGGGAGCCCAGAGGGAGAAGGG + Intronic
972772784 4:42213730-42213752 GAGGGAGAAGAGAGGGAGGGGGG - Intergenic
973246483 4:48016200-48016222 GAGACAGAACGGAGAGTGGATGG + Intronic
973608204 4:52608648-52608670 GAGGGAGAGTGGGGGGTGGAGGG - Intronic
973697723 4:53507216-53507238 GAGGGGTCACAGAAGGTGGAAGG + Intronic
973750975 4:54021058-54021080 AAGGGGGAATGGAGGGTGGAAGG - Intronic
973765472 4:54157614-54157636 GAGGGAGGAGGGAGGGAGGAAGG + Intronic
974247611 4:59340740-59340762 AAGGGAGAAGGGAGGGAGGAAGG + Intergenic
974508573 4:62807849-62807871 GTGGGAGAGCAGAGGGGGTAGGG + Intergenic
974749723 4:66121729-66121751 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
974919051 4:68214400-68214422 GAGTGAGAAGAGATAGTGGAGGG - Intergenic
974994780 4:69141373-69141395 GAGGGAGAAAAGAAGAGGGAAGG - Intronic
975446038 4:74466695-74466717 CAGGAAGAACCGAGAGTGGAAGG - Intergenic
975692701 4:76981634-76981656 GAAGGAGAACAGAGTAAGGAAGG + Intronic
975934038 4:79558429-79558451 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976665221 4:87583469-87583491 GAGAGAGAAAAGAGGGGGGAAGG - Intergenic
977202811 4:94136763-94136785 GAGGGAGGAGGGAGGGAGGAAGG + Intergenic
977290554 4:95160579-95160601 GAGGGAGGAAGGAGGGAGGAAGG - Intergenic
977431145 4:96931367-96931389 GAATGAGAACAGAGGATTGAAGG + Intergenic
977630842 4:99240963-99240985 AAGGGAGTACAGAGGTGGGAGGG - Intergenic
977870187 4:102081707-102081729 GAGGGAGGAGGGAGGGAGGAAGG + Intergenic
977917972 4:102614560-102614582 GAGGCCAAGCAGAGGGTGGAAGG - Intronic
978234569 4:106443250-106443272 GAGGGAGGAGGGAGGGAGGAAGG - Intergenic
978400905 4:108329656-108329678 GAGGGAGGAGGGAGGGAGGAGGG + Intergenic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
978826088 4:113025732-113025754 TAAGGAGATCTGAGGGTGGAGGG + Intronic
978921871 4:114193431-114193453 GACAGAGAGCAGAGGTTGGATGG + Intergenic
979506383 4:121502571-121502593 GAGGGAGAAAAGGGGGGGAAGGG - Intergenic
979627603 4:122863335-122863357 AAGGGAGAAAAAAGGATGGAAGG - Intronic
980190677 4:129520487-129520509 GAGGAAGAAGAGAAGGAGGAGGG + Intergenic
980788989 4:137594494-137594516 GAGGGAGAACAGGCGGTGTTTGG + Intergenic
980875640 4:138659410-138659432 GAGGGAGAAGAGAAGCAGGAGGG + Intergenic
981091556 4:140737422-140737444 GAGAGAGAAGGGAGGGTGCAGGG - Intronic
981269543 4:142829015-142829037 TAGGTAGATCAGAGGGAGGAGGG + Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981316377 4:143343665-143343687 GAGTGAGAACAGGGGATGCAGGG + Intronic
981482867 4:145256000-145256022 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
982066649 4:151660240-151660262 GAGGGAGACCAGGGGCTGGCTGG - Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982335924 4:154238143-154238165 GAGAGAGAAAAGACGGTGGGGGG + Intronic
982549755 4:156783199-156783221 GGGGGAGAGTAGATGGTGGAAGG + Intronic
982718759 4:158837853-158837875 AAGGGAGCACAGATGGTGGAGGG + Intronic
983387414 4:167082798-167082820 GAGAGAGGACAGAGGGAGGGAGG + Intronic
983500940 4:168499241-168499263 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
984070329 4:175103370-175103392 GAGGGAGAAGGGAGAGGGGAGGG + Intergenic
984070340 4:175103398-175103420 GAGGGAGAAGGGAGAGGGGAGGG + Intergenic
984070350 4:175103423-175103445 GAGGGAGAAGGGAGAGGGGAGGG + Intergenic
984070361 4:175103451-175103473 GAGGGAGAAGGGAGAGGGGAGGG + Intergenic
984070371 4:175103476-175103498 GAGGGAGAAGGGAGAGGGGAGGG + Intergenic
984864787 4:184272195-184272217 GAGGGAAGCCAGAGGGTTGAGGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985235993 4:187875141-187875163 GAGGGCGGACAGTGGGAGGAGGG - Intergenic
985293721 4:188412356-188412378 GAGGAAGCACAGGGAGTGGAAGG + Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985937195 5:3106425-3106447 GAGGGAGAGCAGAGGGAGAGGGG - Intergenic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
986015200 5:3751542-3751564 GGGTGAGAAGGGAGGGTGGAGGG + Intergenic
986054323 5:4120881-4120903 GAGGTCTACCAGAGGGTGGATGG + Intergenic
986272117 5:6242467-6242489 GAGGCATATCAGAGGGTGGAGGG + Intergenic
986299324 5:6466010-6466032 AAGGGAGGATAGAGGGTGCAAGG - Intronic
986369856 5:7069083-7069105 GCAGGAGAACAGTGGCTGGAGGG - Intergenic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986796521 5:11218022-11218044 GAGGAAGAAGGGAGGGAGGAAGG - Intronic
986919733 5:12666990-12667012 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
987092252 5:14518634-14518656 GAGGGAGAAGGGTGGGAGGAGGG - Intronic
987222339 5:15803533-15803555 GAGGGAGATGAGAGGAAGGATGG - Intronic
987224957 5:15830788-15830810 AAGGGAGAGAAGATGGTGGAGGG + Intronic
987330669 5:16854534-16854556 GGGGGAGGAGTGAGGGTGGAGGG + Intronic
987410240 5:17607586-17607608 GAGTGAGAACATAGGGTGTTTGG + Intergenic
987859370 5:23464727-23464749 GAGGGAGAGGGGAGGGGGGAGGG + Intergenic
987996225 5:25283857-25283879 GAGGGAGAAGAGAGAGAGAAAGG + Intergenic
988372893 5:30395184-30395206 GAAGGAGAAGAGAGTGAGGATGG - Intergenic
988817523 5:34849376-34849398 AAGGCAGAACAGAGAATGGAGGG + Intronic
988906378 5:35794903-35794925 GAGGGGGACCTGAGGGCGGAAGG - Intronic
989069643 5:37497222-37497244 GAGGGAGGAGGGAGGGAGGACGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989297238 5:39843792-39843814 CAGGGAGAACAGATGTTTGAAGG + Intergenic
989304450 5:39936531-39936553 GAGAAAGAACAGAGGATGGCTGG + Intergenic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
990154374 5:52858044-52858066 CAGGAAGTACAGAGGATGGAAGG - Intronic
990303451 5:54472334-54472356 GCAAGAGAGCAGAGGGTGGAAGG + Intergenic
990398833 5:55415186-55415208 GAGGGAGGAGAGTGGGAGGAAGG + Intronic
990625751 5:57608654-57608676 GAAGGAGAACAGAGAGAGAAAGG + Intergenic
990702949 5:58495288-58495310 GAGGGAGGACAGTGGAAGGAGGG + Exonic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991050211 5:62264826-62264848 GGGAGAGAACAGATGGAGGATGG + Intergenic
991113537 5:62928206-62928228 GTGGGGGAACAAACGGTGGAGGG + Intergenic
991214322 5:64144759-64144781 GCTGGTGATCAGAGGGTGGAAGG - Intergenic
991252915 5:64583493-64583515 GAGGGAGAAGAAAGAGAGGAGGG + Intronic
992226714 5:74625852-74625874 AAGGGAGAGCAGACGTTGGAGGG - Intergenic
992856204 5:80863965-80863987 GAAGGAAAACAAAGGGTGAAGGG + Intronic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
993109026 5:83632453-83632475 GAGTGAGAACATAGGGTGTTTGG + Intergenic
993262045 5:85669933-85669955 GAGAGAGATTAGAGAGTGGAAGG + Intergenic
993301969 5:86222997-86223019 GATAGAAAACAGAGGCTGGAAGG + Intergenic
993503265 5:88684875-88684897 GAGGGAGAAAGGAGGCGGGAGGG + Intergenic
993589205 5:89773305-89773327 GAGGGAGAACACAGGAGGAAAGG + Intergenic
993775722 5:91993274-91993296 AAGGGAGAAAAGAGAGAGGAAGG + Intergenic
994435186 5:99720594-99720616 GAGGCAGAAGAGTGGGAGGAAGG + Intergenic
994775541 5:104032885-104032907 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
994791840 5:104237153-104237175 GAGTGAGAACAGAAGGAGGTGGG + Intergenic
994823683 5:104684954-104684976 GAGTGAGAACATAGGGTGTTTGG - Intergenic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
994869691 5:105331647-105331669 GAGGGAGGAAAGAGGAGGGAGGG + Intergenic
995271237 5:110221615-110221637 GAGGGAGAAGAGATGGGGAAAGG - Intergenic
996163285 5:120194177-120194199 GAGGGAGAAGAGAGGAAGGGTGG + Intergenic
996376959 5:122821328-122821350 GAGGGAGAGAAGGGGATGGAAGG - Intronic
996403944 5:123089063-123089085 GAGAGAGAACGGAGGGGGGAGGG - Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996784351 5:127222562-127222584 GAGGGAGAAGGGTGGGAGGAAGG + Intergenic
996818733 5:127602138-127602160 GAGGAAGAACAGCGCTTGGAGGG - Intergenic
997101516 5:130974414-130974436 TAGAGAGAAGAGAGAGTGGAAGG - Intergenic
998447566 5:142210646-142210668 GAGGGAGGGGAGAGGGAGGAAGG - Intergenic
998506617 5:142677633-142677655 AAGGGACAACAGAGGGTAGAAGG + Intronic
998680104 5:144457547-144457569 GAAGTAAAACAGGGGGTGGAGGG + Intronic
998912016 5:146970071-146970093 GAGGATGTAAAGAGGGTGGATGG - Intronic
999194064 5:149770087-149770109 GAGGGAGGACAGAGGCTGACTGG - Intronic
999261552 5:150241741-150241763 GAGGAAGAAAAGAGAGGGGAGGG - Intronic
999287170 5:150401001-150401023 GAGAGAGGCCAGATGGTGGAGGG - Intergenic
999323793 5:150630699-150630721 GAGGGAGAGGAGAGGGTGGATGG - Intronic
999712353 5:154329759-154329781 GATGAAGCACAGAGGGTGGGAGG - Intronic
999728005 5:154452972-154452994 GAGCTATCACAGAGGGTGGAGGG - Intronic
999739495 5:154539305-154539327 GAGGGAGGAGAGAGGAAGGAAGG - Intergenic
999872334 5:155765427-155765449 GAGGGAGGAGGGAGGGTGGGAGG + Intergenic
1000772029 5:165366295-165366317 GAGGGAGGGCGGAGGGAGGAAGG + Intergenic
1001331603 5:170766464-170766486 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1001547973 5:172582313-172582335 GAAGGAGACCTGAGGGTGCAAGG + Intergenic
1001972443 5:175967658-175967680 GAAGGTGAGGAGAGGGTGGATGG - Intronic
1001977911 5:176015464-176015486 GAAGGAGAAAAGAGGGAGGAAGG - Intronic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002239509 5:177828298-177828320 GAAGGAGAAAAGAGGGAGGAAGG + Intergenic
1002244996 5:177876122-177876144 GAAGGTGAGGAGAGGGTGGATGG + Intergenic
1002368973 5:178734705-178734727 GAGGGAGAAGGGTGGGAGGAGGG - Intergenic
1002539838 5:179899156-179899178 GGGTGAGAACAGAGAGTGGCGGG + Intronic
1002687566 5:181025843-181025865 GAGGAAGAAGAGATGGTGAAAGG + Intergenic
1003153191 6:3570090-3570112 GAGGGAGAGGAGAGGGAGGGAGG - Intergenic
1003479184 6:6515750-6515772 GAGGTAGATAACAGGGTGGACGG - Intergenic
1003670877 6:8157925-8157947 GAGGGAGAAAAGAGGACGAAAGG + Intergenic
1003712155 6:8603917-8603939 GAGGGAGGAAAGAGGAAGGAAGG - Intergenic
1004111127 6:12720152-12720174 GAGGTAGAATGGAGGTTGGAAGG + Intronic
1004649325 6:17593489-17593511 GAGGGAGAAGGGAGGGAGGGAGG - Intergenic
1004657628 6:17679656-17679678 GAGAGAGAACAGGAGGTGGGAGG + Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1004975508 6:20961439-20961461 GAGGGAGATCAGGGGGAGGTGGG + Intronic
1005004914 6:21278320-21278342 GAGGCAGGAGAGAGGGTGGGAGG + Intergenic
1005014806 6:21365943-21365965 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1005277642 6:24237208-24237230 AATTGAGAGCAGAGGGTGGAAGG + Intronic
1005693988 6:28334780-28334802 GTGGGACAACAGGGGGTGGAAGG + Intronic
1005964891 6:30720332-30720354 GAGGGAGAAAGGAGAGGGGAGGG - Exonic
1006303921 6:33207969-33207991 GAGCCAAAGCAGAGGGTGGAGGG + Intergenic
1006341282 6:33448546-33448568 GAGGGAGGCCAGAGGGAGGCTGG - Intronic
1006410349 6:33870109-33870131 GAGAGAGAACAGAGGGCAGGTGG + Intergenic
1006431623 6:34000687-34000709 GAGGGAGCACAGGGGGCTGAGGG + Intergenic
1006432740 6:34007812-34007834 GAGGAGGAAAAGGGGGTGGAGGG + Intergenic
1006437813 6:34035317-34035339 GAAGGAGAACAGGGGGAGGATGG + Intronic
1006615115 6:35321014-35321036 GAGGGAGAAAGGAGGGAGAAAGG + Intronic
1006729401 6:36225130-36225152 GAGGGAAAAGGAAGGGTGGAGGG + Intronic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007407547 6:41643663-41643685 GAGAGAGAAAGGAGGGAGGAAGG + Intronic
1007756111 6:44100881-44100903 GAGGGAGGAGAGAAGGTGGCTGG - Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1008419711 6:51284017-51284039 GAGGGAGAAGGGAGGGATGAAGG + Intergenic
1008544415 6:52573243-52573265 GAAGGAGAAGGGAAGGTGGAGGG + Intronic
1008614646 6:53214721-53214743 AGGGGAGAACAGTGGGAGGAGGG - Intergenic
1008920934 6:56843696-56843718 GAGGGAGGGAGGAGGGTGGAGGG + Intronic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1009730955 6:67605842-67605864 GGGGCATATCAGAGGGTGGAGGG + Intergenic
1010273738 6:73945179-73945201 CATGGAGGACAGAGGGTGGGAGG - Intergenic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1010524218 6:76880568-76880590 AAAGGAGAATAGAAGGTGGAGGG + Intergenic
1010896925 6:81376408-81376430 GAGTGAGAACATAGGGTGTTTGG - Intergenic
1010985092 6:82414499-82414521 GACAGATAACAGAGGATGGATGG + Intergenic
1010995861 6:82531677-82531699 GTGGGAGAAAAGAAGGAGGATGG + Intergenic
1011151201 6:84275332-84275354 TAGGGAGAACTGAGAGTGGAGGG + Intergenic
1011218648 6:85031850-85031872 GAGGGAGAAGAGAGAGAAGAGGG + Intergenic
1011255557 6:85417267-85417289 GAGAAAGAACAGAGGGAGAAGGG + Intergenic
1011656297 6:89555085-89555107 GAGGGGGGAGAGAGGGGGGAGGG - Intronic
1011771090 6:90674660-90674682 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1012231185 6:96762636-96762658 GAGGGAGGACTGAGGGTAGCTGG - Intergenic
1012315675 6:97780855-97780877 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1012516101 6:100061423-100061445 GATGGTGAACAGACGCTGGAAGG - Intergenic
1012592470 6:100999194-100999216 GTGTGAGCACAGAGAGTGGAAGG + Intergenic
1012953877 6:105547884-105547906 GAGGTAGAAAAAAGGGAGGAAGG + Intergenic
1013195299 6:107839409-107839431 GAGGAAGAAGAGAGGGAGGGAGG + Intergenic
1013701134 6:112770781-112770803 GAGGGACAATGGAGGGTGAAGGG - Intergenic
1014715285 6:124857351-124857373 GGAGGAGAACAGGGGGTGCAAGG + Intergenic
1014754172 6:125285072-125285094 GAGTGAGAACATATGGTGGTTGG - Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015292488 6:131553326-131553348 GAGTGAGAACAGGGGGTGTTTGG + Intergenic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1015544562 6:134348140-134348162 GAGGGAGAGCAGAGGCGGGCTGG + Intergenic
1015562596 6:134532809-134532831 GTGGGAGAAAGGAGGGTGGAAGG + Intergenic
1015583508 6:134751891-134751913 GATGGAGAACAGCAGATGGAAGG - Intergenic
1015619696 6:135118302-135118324 TGGTGAGAGCAGAGGGTGGAGGG - Intergenic
1015837277 6:137433991-137434013 AAGGGAGAAGGGAGGGTGGGAGG - Intergenic
1016547199 6:145237816-145237838 GAAGGAGAACAAAGGGGGAAGGG - Intergenic
1016562636 6:145414142-145414164 AAGGCAGAACTGAGTGTGGAAGG - Intergenic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016970286 6:149755838-149755860 GAGGGAGGACAGAGTGTGTGGGG + Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017387741 6:153905794-153905816 GAGGGAGGAGAGTGGGAGGAGGG + Intergenic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1018066630 6:160129111-160129133 TGGGGAGAACAGAGGGTGTTGGG - Intronic
1018132134 6:160741803-160741825 GAGGGAGAAGAGTGGGAGGAGGG - Intronic
1018287796 6:162259252-162259274 GTGGGAGAACAGAGGCAGGTCGG - Intronic
1018368322 6:163144948-163144970 GATGGGGAAAAGAGGGTGGGAGG - Intronic
1018604238 6:165579979-165580001 GATGTAGAACAGAGTGAGGAGGG - Intronic
1018940956 6:168308626-168308648 GCTGGAGTACAGACGGTGGAGGG - Exonic
1019040036 6:169096146-169096168 GAGGGAGGAGGGATGGTGGAGGG - Intergenic
1019064672 6:169287216-169287238 GAGGGACAGCAGAGGGGAGAGGG + Intergenic
1019166335 6:170100083-170100105 GAGGGAGAAAAGAGGTTTGCAGG + Intergenic
1019327603 7:445993-446015 GATGGAGAAAAGAAGGAGGAGGG + Intergenic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019428724 7:988875-988897 GTGGGAGGAGAGAGGGTGGGAGG - Exonic
1019483577 7:1277285-1277307 GAGGGAGAAGAGAGGGAAGGAGG - Intergenic
1019499057 7:1355381-1355403 GAGGGAGAAGAGGGTTTGGAGGG - Intergenic
1019551817 7:1606884-1606906 GGGGAAGAACAGGGGGAGGAGGG - Intergenic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019795112 7:3043408-3043430 GAGGGAGAAAAAGGGTTGGAAGG + Intronic
1019805079 7:3117685-3117707 GGGGGAGAAGAGAGGGAAGAAGG + Intergenic
1020011490 7:4808002-4808024 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
1020029133 7:4920674-4920696 GAGGGAGGAGAGAGGGAGGAGGG - Intronic
1020119025 7:5492407-5492429 GAGGGAGCAGAGAGGCTGGAGGG + Intronic
1021352976 7:19617752-19617774 GAGAGAGGAGAGAGGGAGGAAGG - Intergenic
1021417382 7:20403790-20403812 GAGGGAGAAAAGAGGAAGGTTGG + Intronic
1021433929 7:20592891-20592913 ATGGGAGGATAGAGGGTGGAAGG + Intergenic
1021585284 7:22201261-22201283 GCAAGAGATCAGAGGGTGGAAGG - Intronic
1021853342 7:24830081-24830103 GAGGTAGAACTGAGGTAGGACGG + Intronic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1021920337 7:25478719-25478741 GAGGGAGGACAGATGTAGGAAGG + Intergenic
1021930504 7:25576819-25576841 GAGGAAGAAGAGAGGCAGGAAGG + Intergenic
1022035659 7:26531709-26531731 GAGGGAGAATGGAGGGTGGTGGG + Intergenic
1022038013 7:26552253-26552275 GAGGGAGTGCAGAGGAGGGATGG + Intergenic
1022042137 7:26591252-26591274 GAGACAGAATAAAGGGTGGATGG - Intergenic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022447258 7:30480499-30480521 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1022506626 7:30911787-30911809 GGGGGAGCACAAAGGGAGGAAGG - Intergenic
1022530625 7:31064806-31064828 GTAGGAGAACACAGGATGGATGG - Intronic
1022729673 7:33010536-33010558 GAGAGGGAACAGGGTGTGGAAGG - Intergenic
1023149058 7:37182583-37182605 GAGAGAGAAGAGAGAGAGGAGGG - Intronic
1023370375 7:39507042-39507064 GAGAGAGAAGAGAGGAAGGAAGG + Intergenic
1023568631 7:41549814-41549836 GAGTGAGAACAGATGGTGTTTGG + Intergenic
1023944156 7:44790244-44790266 GAGAAAGAACAGTGAGTGGAAGG - Intergenic
1024164957 7:46721697-46721719 GAGAGAGAGGTGAGGGTGGAAGG - Intronic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024270151 7:47635805-47635827 GGGGGAGAAGAGAGGGGAGAAGG + Intergenic
1024295641 7:47839752-47839774 GATGGCCCACAGAGGGTGGATGG + Intronic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1024878531 7:54056430-54056452 GAAAGAGAACATAGGGTGGTTGG + Intergenic
1024959715 7:54961187-54961209 GAGAGAGGACAGAGGGAGGGAGG + Intergenic
1025789867 7:64679615-64679637 GAGGAGGAATGGAGGGTGGAAGG - Intronic
1026261438 7:68758987-68759009 GAGGGAGAAAAGAGTGAGGGAGG + Intergenic
1026364331 7:69632542-69632564 GAGGGAGAGGAGAGGCAGGATGG - Intronic
1026405172 7:70057687-70057709 GAGGGACAACAGAGGGTCTAGGG - Intronic
1026874771 7:73872894-73872916 GAGAGAGAAAGGAGGGAGGAAGG - Intergenic
1027354263 7:77340924-77340946 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1027481651 7:78705279-78705301 GAGAGAGAAGAGAGAGTGAAGGG - Intronic
1027698599 7:81440730-81440752 GAGGGAGATTTAAGGGTGGAGGG + Intergenic
1028133996 7:87207664-87207686 GAGGGAGAAGGCAGGGTAGAGGG + Intronic
1028382809 7:90217423-90217445 GAGAGATATCAGAGGCTGGAAGG - Intronic
1029309641 7:99650730-99650752 GAGGCAGAGGAGAAGGTGGACGG - Intronic
1029348624 7:99997206-99997228 GAGGAAGGACAGAGGGAGGGAGG - Intergenic
1029412782 7:100426667-100426689 GAGGGAGGGAAGAGGGAGGAAGG - Intronic
1029412897 7:100426976-100426998 GAAGGAGAAGAGAGGGAGGGAGG - Intronic
1029480387 7:100808915-100808937 GAGGGAGAAAAGGGGGTCAAAGG - Intronic
1029557552 7:101280809-101280831 CAGGGAGGAAAGGGGGTGGAAGG + Intergenic
1029873451 7:103721195-103721217 GAGGAAGGAAAGAGGGAGGAAGG - Intronic
1029955650 7:104636522-104636544 GAGGGAGAAGGGTGGGAGGAAGG - Intronic
1030162015 7:106518614-106518636 GAAGGAGAGGAGAGGGAGGAAGG - Intergenic
1030306705 7:108026351-108026373 GAGTGAGAAGAGAGGATGAAAGG - Intronic
1030593447 7:111508544-111508566 GAGAGGGCACAGAGGGTGGGAGG + Intronic
1030611889 7:111698688-111698710 GAGAGAGAAAAGAGGGTTTAGGG + Intergenic
1031081785 7:117265135-117265157 GAGGCAGGAGAGAGGGAGGAGGG - Intergenic
1031296462 7:120010130-120010152 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1031422611 7:121568466-121568488 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031751878 7:125585272-125585294 GAGTGAGAACAGGCGGTGTATGG - Intergenic
1031990259 7:128192815-128192837 GAGGGACCACCAAGGGTGGAGGG - Intergenic
1032339115 7:131054527-131054549 GAGGGAGGAGGGAGGGAGGAGGG + Intergenic
1032799851 7:135309226-135309248 GAAGGAGAAGAAAGGATGGAAGG + Intergenic
1032906989 7:136379814-136379836 GAGGGAGGAGGGAGGCTGGAAGG - Intergenic
1033033730 7:137850966-137850988 GAGGCAGAGCAGAGAGTGAAGGG + Intergenic
1033083473 7:138320620-138320642 GAGTGAGAACAGGTGGTGGTTGG - Intergenic
1033150854 7:138913926-138913948 GAGGGAGACAGGAGGGAGGAGGG + Intronic
1033534307 7:142298189-142298211 GAGGGAGAAGAGAGGCAGGAGGG + Intergenic
1033569131 7:142609928-142609950 GAGGGAGATCAGAGGGATTAAGG + Intergenic
1033656969 7:143381266-143381288 GAGGGAGAAGAGAGGGGGCGGGG - Exonic
1033786478 7:144737270-144737292 GGGGGAGAAGGGAGGGAGGAAGG + Intronic
1033943257 7:146681541-146681563 GAGGGAGATGGGAGGGTGGGGGG + Intronic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034004368 7:147452938-147452960 GAGGGAGAAGAAAGGGAGGGAGG + Intronic
1034391068 7:150788112-150788134 GAGGGAGAGGAGAGGCTGGTGGG + Intergenic
1035100222 7:156389977-156389999 GAGGGAGAGAAGGGGGAGGAAGG - Intergenic
1035527405 8:324616-324638 GTGGGTGAACAGGGGGTGGAGGG + Intergenic
1036208644 8:6824311-6824333 GAGGGAGAGAAGGGGGTGAAGGG + Intronic
1036472491 8:9063909-9063931 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1036546085 8:9771289-9771311 GAGGGAGGAGAGAGGAAGGAAGG + Intronic
1036649487 8:10633274-10633296 GTGGGAGATCAGAGAGTAGAGGG - Intronic
1036718066 8:11144993-11145015 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
1036926978 8:12916400-12916422 GAGGGAGGACAGAGAGAGGATGG - Intergenic
1036978777 8:13445131-13445153 AAGAGAGCACAGAGGGAGGAAGG + Intronic
1037476938 8:19267195-19267217 AAGGGAGAAGAGTGGGAGGAGGG + Intergenic
1037742731 8:21620421-21620443 AATGGAGATCAGAGGGTGGGAGG - Intergenic
1037819650 8:22129513-22129535 GAGGGAGGACAGAAAGTGGAAGG + Intronic
1037864485 8:22432427-22432449 GAGGGAGAAGAGAGAGAGAAGGG - Intronic
1038370208 8:26981583-26981605 GAGTGAGAACAGACGGTGTTTGG - Intergenic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038570546 8:28658345-28658367 GAGGGTGAAAACAGGGTGGATGG - Intronic
1038920342 8:32076568-32076590 GAGGGTGGAAAGTGGGTGGAGGG + Intronic
1039233867 8:35479786-35479808 GGGAGAGAACATAGGTTGGAAGG + Intronic
1039278992 8:35961814-35961836 GAGAGAGAAGAGAGGGAGCAGGG - Intergenic
1040537585 8:48323336-48323358 GAGACAGGGCAGAGGGTGGAGGG + Intergenic
1040743540 8:50611366-50611388 GACAGAGAACAGAGGGTAGGAGG + Intronic
1041095252 8:54343164-54343186 GAAGGAGAAGAGAGGGAAGAAGG - Intergenic
1041387273 8:57318001-57318023 AAGGGAGAAGAGAGGCAGGAAGG - Intergenic
1041576177 8:59398218-59398240 GTGGAATACCAGAGGGTGGAAGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1043147126 8:76673106-76673128 GAAAGAGAAGAAAGGGTGGACGG + Intergenic
1043152687 8:76738674-76738696 GAGGGAGGAGGGAGGGAGGAAGG - Intronic
1043372888 8:79613161-79613183 CATAGAGAACAGAGGGTGGGCGG - Intronic
1043889363 8:85639577-85639599 GAGGGAGAACATGGGGTGTTTGG - Intergenic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044314836 8:90738014-90738036 TAGGGCTGACAGAGGGTGGAAGG + Intronic
1044381951 8:91544635-91544657 GAGAGAGAACAGAGAAAGGAAGG - Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044539378 8:93392511-93392533 GAGGGAGAAAACAGGGGTGATGG - Intergenic
1044653253 8:94521197-94521219 GAAGGAGAACAGAGGGTTGGGGG - Intronic
1044711517 8:95063043-95063065 GAGGAAGAAGTGAGGCTGGAAGG + Intronic
1044785265 8:95786787-95786809 GAGGGAGCAAAGAGGAAGGAAGG + Intergenic
1044900298 8:96936973-96936995 GAGGGAGGAGAGAGGGAGGAAGG - Intronic
1045330922 8:101155081-101155103 GGGGGAGAAGGGAGGGAGGATGG - Intergenic
1045357930 8:101405766-101405788 GAGGGAGATGAGAGGGAAGAGGG - Intergenic
1045429293 8:102098262-102098284 GAAGGACTGCAGAGGGTGGAGGG + Intronic
1045474635 8:102542557-102542579 GAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045755281 8:105534227-105534249 GAGGGAGGAGGGAGGGAGGAAGG - Intronic
1045811042 8:106220416-106220438 GGGGCATATCAGAGGGTGGAGGG + Intergenic
1045942768 8:107757436-107757458 GAGGGAGAAGAGAAAGTGAAGGG - Intergenic
1046483232 8:114851085-114851107 GATGGAGAAAAGAGGAGGGAGGG + Intergenic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1046917130 8:119689655-119689677 GAGGAAGAAAGGAGAGTGGAAGG + Intergenic
1047051568 8:121118531-121118553 GGGGCACATCAGAGGGTGGAGGG + Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047538636 8:125743006-125743028 GAGGGAGACAGGAGAGTGGAGGG - Intergenic
1047734010 8:127750155-127750177 GAGGGAGAAGGGAGGGAGGAAGG - Intergenic
1047852317 8:128870403-128870425 TGGGAAGAACAGAGGGTGGGAGG - Intergenic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048135331 8:131741972-131741994 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1048321385 8:133403291-133403313 AAGGCAGAACAGAGGGTGAGAGG + Intergenic
1048346036 8:133575215-133575237 GAGAGAGAACAGAGCGGAGAGGG - Intergenic
1048360175 8:133690815-133690837 GATGGAGAATAGTGGGTGGATGG + Intergenic
1048690294 8:136955669-136955691 GAGGAAGAAGGGAGGGTGGGAGG - Intergenic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049231761 8:141488388-141488410 GAGGGAGAAGAGAGGGTAGTGGG - Intergenic
1049240792 8:141536511-141536533 GAGGCAGAACGGGGGGTGGAGGG - Intergenic
1049341384 8:142114425-142114447 GAATGAGAAGAGAGGGAGGAAGG + Intergenic
1049350661 8:142162820-142162842 GATGGAGGATAGAGGATGGATGG + Intergenic
1049370248 8:142260978-142261000 GAGGGAGGAGAGAGGGAGGGGGG + Intronic
1049370345 8:142261317-142261339 GATGGAGGAGAGAGGGAGGAGGG + Intronic
1049370366 8:142261372-142261394 GATGGAGGAGAGAGGGGGGAGGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1049961054 9:738518-738540 GTTAGAGAAGAGAGGGTGGAAGG - Intronic
1050013157 9:1205955-1205977 GAGGCAGTAGAGAGGGAGGAGGG + Intergenic
1050038982 9:1467902-1467924 GAGAGAGAAGAGAGGGTGACAGG + Intergenic
1050155607 9:2663694-2663716 GAGGGAGAAGAGAGGGAGAATGG - Intergenic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050292009 9:4165094-4165116 GCAGGAGAACAGAGGCTGGAGGG + Intronic
1050753684 9:8973207-8973229 GAGGGAGGAGAGAAGGAGGAGGG - Intronic
1050895925 9:10885991-10886013 AAGGAGGAATAGAGGGTGGAAGG - Intergenic
1051196596 9:14568401-14568423 GAGGGCGGAAAGAGGGAGGAAGG + Intergenic
1051853425 9:21535605-21535627 GAGGGAGAAAGGAGGGTGGAGGG + Intergenic
1051919444 9:22247688-22247710 GAGGGGGAACAGAGGGAGAGGGG - Intergenic
1052180753 9:25524511-25524533 GGGGCATATCAGAGGGTGGAGGG - Intergenic
1052191681 9:25670174-25670196 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1052639270 9:31143802-31143824 GAGTGAGAACAGGGGGTGTTTGG - Intergenic
1053057872 9:35004719-35004741 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1053288976 9:36867695-36867717 GAGAGATAAAAGAGGGAGGAAGG - Intronic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053549926 9:39066947-39066969 AAAGGAGAAAAGAGAGTGGATGG - Intergenic
1053814040 9:41887040-41887062 AAAGGAGAAAAGAGAGTGGATGG - Intergenic
1054616556 9:67300400-67300422 AAAGGAGAAAAGAGAGTGGATGG + Intergenic
1054753231 9:68930076-68930098 GGAGGAGAAGAGAGGCTGGAAGG - Intronic
1055304807 9:74918405-74918427 GAGGGTGAAGAGAGGCTGGTTGG + Intergenic
1055364505 9:75528150-75528172 GAAGGAGCAGAGAGGGTGGTAGG + Intergenic
1055416516 9:76090214-76090236 CAGGGAGAAGGGAGGGTGCATGG - Intronic
1055569840 9:77605446-77605468 GGGGGAGAAAAGTGGGAGGAAGG - Intronic
1056391725 9:86147034-86147056 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1056406007 9:86275788-86275810 GAAGTAGCACACAGGGTGGAAGG + Intronic
1056680178 9:88710574-88710596 AAGGGAGTACAGGGTGTGGAGGG + Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057388410 9:94623945-94623967 GAGGGAGATGAGAGGCTAGATGG + Intronic
1057704982 9:97389729-97389751 GAGGGAACTGAGAGGGTGGAAGG - Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058052217 9:100418405-100418427 GAGAGAGAAAAGAGGGAGGGAGG - Intergenic
1058095087 9:100850949-100850971 GCAGAAGAAGAGAGGGTGGATGG + Intergenic
1058157376 9:101530596-101530618 GATGGTGAACAGAAGGTGGCTGG + Intronic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058354752 9:104071156-104071178 GAGGGAGAGAGGAGGATGGAAGG + Intergenic
1058705747 9:107636948-107636970 GAGGAAGAAGAGAGGGTAGGGGG + Intergenic
1058815863 9:108682201-108682223 GAGGGAGACCAGAGAATGTAAGG + Intergenic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059345492 9:113625335-113625357 GAGGGAGAAGAGACTTTGGAGGG - Intergenic
1059630475 9:116116481-116116503 GAGGGAGAACAATGGTTGGGTGG + Intergenic
1059933258 9:119282496-119282518 GAAGAAGGACAGAGGGAGGAGGG + Intronic
1060016181 9:120088318-120088340 GCAGGAGATCAAAGGGTGGAGGG - Intergenic
1060135971 9:121153991-121154013 GAGGGAGATGATAGGGTGGTAGG + Intronic
1060777196 9:126383682-126383704 AAGAGAGAACAGATGGGGGAGGG + Intronic
1060899913 9:127248210-127248232 CATGGAGAAGAGAGGTTGGAAGG + Intronic
1060920128 9:127414553-127414575 AAGGGGGAATAGAGGGTGGAAGG - Intergenic
1060994359 9:127867737-127867759 GAGGAGGAACGGAGGGTTGAGGG + Exonic
1061153949 9:128845912-128845934 GGTGGAAAACAGAGGCTGGAGGG + Intronic
1061256519 9:129456734-129456756 GTGGGTGAATGGAGGGTGGATGG + Intergenic
1061281982 9:129602751-129602773 GAGAGAGAAGGGAGGGAGGAAGG + Intergenic
1061390605 9:130315315-130315337 GGGGGAGGGCAGAGGGAGGAGGG - Intronic
1061490555 9:130941665-130941687 AAGGGAAATCCGAGGGTGGAGGG - Intergenic
1061582907 9:131548311-131548333 AAGGAGGAATAGAGGGTGGAAGG - Intergenic
1061619892 9:131805043-131805065 GGGGGAGCTCAGAGGGTGCAAGG + Intergenic
1061738872 9:132684572-132684594 GCGGGAGGACAAAGGGAGGAAGG - Intronic
1061755481 9:132809380-132809402 GAGGGAGGCCACAGGGTGAAGGG - Intronic
1061820742 9:133226040-133226062 GAGGGAGGAGGGAGGGTGGGTGG + Intergenic
1061995395 9:134180497-134180519 GACGGAGAAGGGATGGTGGAGGG - Intergenic
1062049123 9:134438129-134438151 GTGCCTGAACAGAGGGTGGATGG + Intronic
1062074299 9:134576032-134576054 GAGGGATAAGAGGGGGTGCAGGG + Intergenic
1062088218 9:134659627-134659649 CAGGGAGGACAGAGGGTTGTTGG - Intronic
1062143988 9:134978884-134978906 GAGGGAGGATAGAGGGAGGGAGG + Intergenic
1062144026 9:134978993-134979015 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
1062174294 9:135152482-135152504 GAGGGAGCACAGAGGGATGTAGG - Intergenic
1062271889 9:135713651-135713673 GCAGGAGAGCAGAGGGGGGATGG - Intronic
1062369760 9:136231887-136231909 GAGGGGGTGGAGAGGGTGGAGGG - Intronic
1062391657 9:136336317-136336339 GCGGCAGAACTGAGGGTGGAAGG - Intronic
1062671004 9:137709363-137709385 GTGGGAGATCAGGGGGTGGGAGG + Intronic
1203489268 Un_GL000224v1:87808-87830 GAGAGAGAACTGAGTGTGGCTGG - Intergenic
1203501889 Un_KI270741v1:29703-29725 GAGAGAGAACTGAGTGTGGCTGG - Intergenic
1185525049 X:771868-771890 GAGAGAGAGCAGTGGCTGGATGG - Intergenic
1185581511 X:1213610-1213632 GAGGGAGAGGGGAGGGAGGAGGG - Intergenic
1185688341 X:1948485-1948507 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185688619 X:2134007-2134029 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185692355 X:2166239-2166261 GAGGGAGAACATAGGATGATAGG - Intergenic
1185692380 X:2166853-2166875 GAGGGAGAACAAAGGATGTTTGG - Intergenic
1185937732 X:4277812-4277834 GAAGGAGAAGGGAGGGAGGAAGG - Intergenic
1186060887 X:5705714-5705736 GAGGAAGAAGAGAGAGAGGAAGG - Intergenic
1186078774 X:5908060-5908082 GAGGGAGGAGAGACAGTGGAAGG + Intronic
1186111945 X:6266901-6266923 AAGGGAGGAAAGAGGGAGGAGGG + Intergenic
1186113024 X:6276639-6276661 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186239979 X:7555369-7555391 AAGGGAGAAGAGAGGAGGGAAGG + Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1187478480 X:19633159-19633181 GACAGAGAAGAGAGGGAGGAAGG + Intronic
1187652593 X:21425593-21425615 GAGGGAGACCAGAGGCTATAAGG - Intronic
1187668397 X:21641902-21641924 GTGGGAGAACAGAAGGGGAAAGG + Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1187825542 X:23331945-23331967 GAGGGCGAACCGAGGTTGGAAGG + Intergenic
1188115107 X:26232897-26232919 GAAGGAGAAGAGAGCGTGCAGGG + Intergenic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188430873 X:30104600-30104622 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1189157533 X:38773844-38773866 GAGGGGGAAAGCAGGGTGGAGGG + Intergenic
1189161114 X:38809900-38809922 AATGCAGAACAGAGGGAGGAAGG - Intergenic
1189426862 X:40909677-40909699 GAGGCAGAAGAGAGGGAGGAGGG + Intergenic
1190259023 X:48786513-48786535 GAGGGAGAAGGGAGGGAGGGAGG + Intergenic
1190384420 X:49871137-49871159 GAAGGAGGAAATAGGGTGGAGGG - Intergenic
1190732299 X:53234140-53234162 GAGGAAGCAAAGAGGGTGCAAGG + Exonic
1191074981 X:56443360-56443382 GAGTGAGAACATAGGGTGTTTGG - Intergenic
1191196166 X:57725709-57725731 GAGTGAGAACATAGGGTGTTTGG + Intergenic
1191601122 X:63008981-63009003 GAGGAACAACAGAGGGGGCAAGG - Intergenic
1191777525 X:64832414-64832436 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1191805962 X:65134117-65134139 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1191956073 X:66643638-66643660 GAGGGACAATGGAGGGTGGGAGG - Intergenic
1192054523 X:67759576-67759598 GAGGGAGAAAAGAGAGGGAAAGG - Intergenic
1192545100 X:72006548-72006570 GAGGGTGCACAGAGGTGGGAAGG - Intergenic
1192577140 X:72252094-72252116 GAGGGAGAACAGAGAGAAAAAGG + Intronic
1192583188 X:72301497-72301519 GAAGGAGAAGGGAGGGTGAAGGG - Intronic
1193159287 X:78209847-78209869 AAGTGAGAACACAGGGTGTATGG - Intergenic
1193552760 X:82918633-82918655 GATGGTGAACAGTGGGAGGAGGG - Intergenic
1193786079 X:85760899-85760921 GAGGGAGACCAGAGGTGTGAGGG - Intergenic
1193859872 X:86652089-86652111 GAGGGAGAAGGGTGGGAGGAGGG - Intronic
1194135364 X:90134124-90134146 GAGGGAGGAGAGAGTGTGGGGGG - Intergenic
1194681010 X:96852626-96852648 GAGGGAGGAGATTGGGTGGAAGG + Intronic
1194721554 X:97346391-97346413 GAGGGAGAAGAGAGGATGAAGGG - Intronic
1194738031 X:97537637-97537659 GAGTGAGCACAGAAGATGGAAGG - Intronic
1195280897 X:103331228-103331250 GGGGGAGATGAGAGGGTGGAGGG + Intronic
1195299118 X:103509579-103509601 GAAGGAGAAAAGAGAGAGGAAGG - Intronic
1195416713 X:104628320-104628342 GAGGGGGAACAGAGAGAGGTTGG - Intronic
1195479288 X:105324230-105324252 AATGGAGTACAGAGGGAGGAAGG + Intronic
1195783544 X:108490796-108490818 ACTTGAGAACAGAGGGTGGAAGG - Intronic
1195986283 X:110634154-110634176 AAGGGAAATCAGGGGGTGGAGGG + Intergenic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196331387 X:114473367-114473389 GGGAGAGAAAGGAGGGTGGAGGG + Intergenic
1196974487 X:121143138-121143160 GAAAGAGAAGAGAAGGTGGAGGG - Intergenic
1196992850 X:121347466-121347488 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1197470811 X:126864352-126864374 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1198200295 X:134409800-134409822 GAGGGAGGAGAGAGGGAGAAGGG - Intronic
1198253589 X:134905465-134905487 GAGAGAGAAATGGGGGTGGAAGG + Intronic
1198268104 X:135029836-135029858 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1198296424 X:135292140-135292162 GTGGGAGTACAGTGGGTTGATGG - Intronic
1198316434 X:135471406-135471428 GAGGGAGAACAAGTGGTGTAAGG - Intergenic
1198501187 X:137248815-137248837 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
1198598309 X:138260045-138260067 AAGGAAGAATGGAGGGTGGAAGG - Intergenic
1198787683 X:140307692-140307714 GAGGGAGAAGAGAGAGAGTAAGG + Intergenic
1199264743 X:145817706-145817728 GAGGGAGGAGGGAGGGAGGAGGG - Intergenic
1199264757 X:145817742-145817764 GAGGGAGGAGGGAGGGAGGAGGG - Intergenic
1199264780 X:145817805-145817827 GAGGGAGGCGAGAGGGAGGAGGG - Intergenic
1199659514 X:150034699-150034721 GAGGGAGAAGAGTATGTGGAGGG + Intergenic
1200481144 Y:3704221-3704243 GAGGGAGAAGAGAGTGTGGGGGG - Intergenic
1201506959 Y:14712485-14712507 GAGGGAAAGCATAGGTTGGAAGG - Intronic
1201517641 Y:14835327-14835349 GAGGGAGGAAGGAGGGAGGAGGG + Intronic