ID: 902847038

View in Genome Browser
Species Human (GRCh38)
Location 1:19119563-19119585
Sequence CTCTGTTTGTGGAGTTTTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1644
Summary {0: 1, 1: 1, 2: 5, 3: 779, 4: 858}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902847034_902847038 1 Left 902847034 1:19119539-19119561 CCATAAAGCAACTGTTACCTTCT 0: 1
1: 0
2: 0
3: 13
4: 189
Right 902847038 1:19119563-19119585 CTCTGTTTGTGGAGTTTTCAGGG 0: 1
1: 1
2: 5
3: 779
4: 858
902847031_902847038 10 Left 902847031 1:19119530-19119552 CCCCTCTGACCATAAAGCAACTG 0: 1
1: 0
2: 0
3: 17
4: 149
Right 902847038 1:19119563-19119585 CTCTGTTTGTGGAGTTTTCAGGG 0: 1
1: 1
2: 5
3: 779
4: 858
902847033_902847038 8 Left 902847033 1:19119532-19119554 CCTCTGACCATAAAGCAACTGTT 0: 1
1: 0
2: 0
3: 7
4: 157
Right 902847038 1:19119563-19119585 CTCTGTTTGTGGAGTTTTCAGGG 0: 1
1: 1
2: 5
3: 779
4: 858
902847032_902847038 9 Left 902847032 1:19119531-19119553 CCCTCTGACCATAAAGCAACTGT 0: 1
1: 0
2: 0
3: 8
4: 139
Right 902847038 1:19119563-19119585 CTCTGTTTGTGGAGTTTTCAGGG 0: 1
1: 1
2: 5
3: 779
4: 858

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902847038 Original CRISPR CTCTGTTTGTGGAGTTTTCA GGG Exonic
900772351 1:4555335-4555357 CTCTATTTGTGGCGTATTCCAGG - Intergenic
901625864 1:10624702-10624724 CTCTGCCTGTGGAGATCTCATGG + Intronic
902676178 1:18009901-18009923 CCCGGTTTGTGGTGATTTCAGGG - Intergenic
902776817 1:18680162-18680184 CTCTGTCTGTGTATTTCTCAAGG + Intronic
902847038 1:19119563-19119585 CTCTGTTTGTGGAGTTTTCAGGG + Exonic
906023015 1:42647772-42647794 ATGTGTTTGTGTAGTTTCCAAGG - Intronic
907048847 1:51316293-51316315 CTCTGCTTCTGGAGTCTTAAAGG + Intronic
909038852 1:70626641-70626663 GTCTTTTTGTGGAGTCTTTAGGG - Intergenic
909823841 1:80100116-80100138 TTCTGTCTGTGGAGTATGCAAGG + Intergenic
910697944 1:90041583-90041605 CTGTTTGTGTGGAGTTTGCATGG + Intergenic
911412837 1:97532013-97532035 GTGTGTGTGTGCAGTTTTCAGGG + Intronic
911772354 1:101762218-101762240 CTTTGTTTTGGGAGTTTTAAAGG + Intergenic
911937285 1:103993751-103993773 CTCAGTTTGGGGAGGTTTCTTGG + Intergenic
912842939 1:113054769-113054791 CTTTGAGTGTGAAGTTTTCAGGG - Intergenic
913734307 1:121758594-121758616 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913734326 1:121758934-121758956 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913734420 1:121760632-121760654 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913734513 1:121762327-121762349 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913734575 1:121763347-121763369 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913734630 1:121764366-121764388 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913734649 1:121764706-121764728 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913734757 1:121766741-121766763 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913734852 1:121768450-121768472 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913734889 1:121769130-121769152 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913734999 1:121771169-121771191 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913735091 1:121772867-121772889 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913735149 1:121773887-121773909 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913751066 1:121967041-121967063 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913751159 1:121968735-121968757 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913791071 1:122527648-122527670 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913791299 1:122531728-122531750 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913791666 1:122538358-122538380 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913793843 1:122577632-122577654 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913794599 1:122591232-122591254 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913794742 1:122593783-122593805 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913798733 1:122664664-122664686 TTCTTTTTGTGGAATTTGCAAGG + Intergenic
913799145 1:122672318-122672340 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913801033 1:122706484-122706506 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913804816 1:122775153-122775175 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913805652 1:122790117-122790139 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913806317 1:122802018-122802040 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913807158 1:122816973-122816995 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913810644 1:122879872-122879894 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913810665 1:122880212-122880234 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913811899 1:122902141-122902163 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913819048 1:123029432-123029454 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913819646 1:123040305-123040327 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913819816 1:123043364-123043386 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913820114 1:123048811-123048833 CTCTTGTTGTGGAATTTGCAAGG + Intergenic
913821393 1:123071754-123071776 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913821571 1:123074981-123075003 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913821978 1:123082289-123082311 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913825544 1:123146189-123146211 CACTTTTTGTGGAATTTGCAAGG + Intergenic
913825879 1:123152307-123152329 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913826342 1:123160469-123160491 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913829836 1:123223501-123223523 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913831975 1:123262239-123262261 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913833273 1:123285181-123285203 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913836199 1:123336854-123336876 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913839674 1:123399034-123399056 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913840293 1:123410251-123410273 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913841469 1:123430817-123430839 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913841554 1:123432345-123432367 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913842677 1:123452735-123452757 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913847705 1:123543657-123543679 CTCTTTTTGTGGAATTGGCAAGG + Intergenic
913850750 1:123598371-123598393 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913852301 1:123626243-123626265 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913856081 1:123694570-123694592 CTCTTTTTGTGGAATATGCAAGG + Intergenic
913856388 1:123700010-123700032 CTCTTTTTGTGGAATTTGCAGGG + Intergenic
913856891 1:123709019-123709041 CTCTGTTTGTAAAGTCTGCACGG + Intergenic
913861021 1:123782435-123782457 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913861805 1:123796374-123796396 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913867002 1:123889840-123889862 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913869309 1:123931459-123931481 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913870474 1:123952533-123952555 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913870707 1:123956609-123956631 CTGTTTTTGTGGAATTTGCAAGG + Intergenic
913874116 1:124018125-124018147 CTCATTTTGTGGAATTTGCAAGG + Intergenic
913880382 1:124129562-124129584 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913886813 1:124245080-124245102 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913890265 1:124306423-124306445 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913891027 1:124320363-124320385 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913891796 1:124334307-124334329 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913892593 1:124348587-124348609 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913898184 1:124448531-124448553 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913898291 1:124450399-124450421 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913900084 1:124482348-124482370 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913900464 1:124489142-124489164 CTCTTTTTGTGGAATTGGCAAGG + Intergenic
913905377 1:124577840-124577862 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913905414 1:124578520-124578542 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913907252 1:124611149-124611171 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913908445 1:124632734-124632756 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913910607 1:124671320-124671342 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913912919 1:124712791-124712813 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913913656 1:124726045-124726067 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913914754 1:124745756-124745778 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
913915370 1:124756627-124756649 CTCTTTTTGTGGAATTGGCAGGG + Intergenic
913916963 1:124785346-124785368 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
913932925 1:125001364-125001386 ATCTGCTTGTGGATTTTTGAAGG + Intergenic
914864568 1:151415808-151415830 CTGTGTGTGTGCATTTTTCAAGG - Intronic
917645771 1:177027215-177027237 ATCTGTTCTTGGAGGTTTCAGGG - Intronic
917772247 1:178292384-178292406 GTCTGTTTGAGGAGTATACATGG + Intronic
919095962 1:193036852-193036874 ATGTGTTTGTGTAGTTTCCAAGG - Intronic
919422302 1:197385013-197385035 TTCTGTCTGAGGAGTTTCCAGGG + Intronic
919466147 1:197922981-197923003 CTCTGAGTTTAGAGTTTTCAGGG + Intronic
920289736 1:204911900-204911922 TTATGTGTGTAGAGTTTTCATGG + Intronic
923853904 1:237825551-237825573 GTTTTTTTCTGGAGTTTTCATGG - Intronic
924628896 1:245718566-245718588 GTCTGTGTGTTGAGTCTTCAGGG - Intergenic
924658683 1:245996478-245996500 GTCTATTTGTTCAGTTTTCAAGG - Intronic
1063133550 10:3197791-3197813 GTCTGTTTGTGGATTTCTTAGGG + Intergenic
1065858823 10:29853251-29853273 CTCTGTTTGTAGAGTATGCCTGG + Intergenic
1065985228 10:30944437-30944459 CCCTGTTGGTGGAGTTTGAAGGG - Intronic
1066660536 10:37735140-37735162 TTCTGTTTGTGGATTTCTTAGGG + Intergenic
1066821655 10:39500225-39500247 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1066826008 10:39578051-39578073 CTCTGTTTTTGGAATTTGCAAGG + Intergenic
1066845197 10:39998045-39998067 CTCTGTTTTTGGAATTTGCAAGG + Intergenic
1066852227 10:40137227-40137249 CTCTGTTTTTGGAATTTGCAAGG + Intergenic
1066860501 10:40301250-40301272 CTCTGTTTTTGGAATTTGCAAGG + Intergenic
1066871474 10:40519324-40519346 CTCTGTTTTTGGAATTTGCAAGG + Intergenic
1066874934 10:40587881-40587903 CTGTGTTTTTGGAATTTGCAAGG + Intergenic
1066881314 10:40715194-40715216 CTCTGTTTTTGGAATTTGCAAGG + Intergenic
1066886814 10:40822526-40822548 CTCTGTTTTTGGAATTTGCAAGG + Intergenic
1066896533 10:41014850-41014872 CTCTTTCTGTGGAATTTGCAAGG + Intergenic
1066896624 10:41016550-41016572 CTCTGTTTTTGGAATTTGCAAGG + Intergenic
1066904333 10:41168355-41168377 CTCTGTTTTTGGAATTTGCAAGG + Intergenic
1066916623 10:41409188-41409210 CTCTGTTTTTGGAATTTGCAAGG + Intergenic
1066918169 10:41439764-41439786 CTCTGTTTTTGGAATTTGCAAGG + Intergenic
1066921342 10:41502372-41502394 CTCTTTTTTTGGAATTTGCAAGG + Intergenic
1066921946 10:41514248-41514270 CTCTTTCTGTGGAATTTGCAAGG + Intergenic
1066923940 10:41552861-41552883 CTCTTTTTTTGGAATTTGCAAGG + Intergenic
1066924473 10:41562706-41562728 CTCTTTTTTTGGAATTTGCAAGG + Intergenic
1066925168 10:41575610-41575632 CTCTTTTTTTGGAATTTGCAAGG + Intergenic
1066925861 10:41588512-41588534 CTCTTTTTTTGGAATTTGCAAGG + Intergenic
1066935942 10:41835782-41835804 CTCTTTTTGTAGAATTTGCAAGG - Intergenic
1068422805 10:56818968-56818990 CTCTTTTAGTGAAGTTTTCATGG - Intergenic
1070278156 10:75028022-75028044 CTCTGTTTGTGGACATTTATAGG - Intronic
1070374911 10:75820353-75820375 ATATGTTTGTAGAGTTTTGAGGG - Intronic
1072664565 10:97384280-97384302 CTGAGGTTGTGGAGTTCTCAGGG - Intronic
1073471505 10:103725375-103725397 CACGGCTTGTGGAGTTTGCAGGG + Intronic
1073801186 10:107043429-107043451 CTCTTTTTGTGGAGATATAAGGG + Intronic
1074102461 10:110364522-110364544 CCCTATTAGTGGAGTTTTCTAGG + Intergenic
1074644771 10:115435316-115435338 CTATGAGGGTGGAGTTTTCATGG - Intronic
1075483744 10:122802982-122803004 CTCTGTCTCTGCAGTCTTCAAGG + Intergenic
1075561964 10:123474505-123474527 CTCTGTTTCTGGAGCCTGCATGG + Intergenic
1076354742 10:129843380-129843402 CACTGTTTGTGGCCTTTACAAGG + Intronic
1076823735 10:132956822-132956844 CTCTGGTCCTCGAGTTTTCAGGG + Intergenic
1078950280 11:16124090-16124112 TTATGTTTGGGGAATTTTCATGG - Intronic
1079295244 11:19227299-19227321 CTCTCTTCCTGCAGTTTTCAAGG - Intronic
1080985788 11:37463165-37463187 GTATGTGTGTGGAGTCTTCAGGG + Intergenic
1082152236 11:48754896-48754918 TTCTTTTTGTGGAATTTGCATGG - Intergenic
1084377234 11:68785880-68785902 CTCTGTTTTAGTAGTTTTTACGG - Intronic
1089513689 11:119018126-119018148 CTCTGGTGGTGGAGTTTGCGGGG - Intronic
1090154778 11:124425690-124425712 TTCTGTTTGTGGATTTTCCCAGG + Intergenic
1091836914 12:3592529-3592551 CTCTATTTGCGGAGTTTTGAGGG - Intronic
1092602895 12:10086034-10086056 ATGTATTTGTGTAGTTTTCAGGG - Intronic
1093176214 12:15916195-15916217 CGATGTTAGTGAAGTTTTCAAGG + Intronic
1093210676 12:16304569-16304591 CTCTGCTTTTGGAGGTCTCAGGG - Intergenic
1093468758 12:19478759-19478781 ATGTGTTTGTGTAGTTTTGAGGG + Intronic
1094034417 12:26052140-26052162 CACTATTTGTGGTGCTTTCAGGG - Intronic
1094879875 12:34709927-34709949 CTCTGTTTGTAAAGTCTGCAAGG - Intergenic
1094880078 12:34713323-34713345 CTCTGTTTGTAAAGTCTGCAAGG - Intergenic
1094883998 12:34840981-34841003 CTCTTTTTGTGGAGTTTCCATGG + Intergenic
1094884223 12:34844718-34844740 CTCTTTTTGTGGAGTTTCCATGG + Intergenic
1094911422 12:35284958-35284980 TTCTTTTTGTGGAGTTTCCATGG + Intergenic
1094939117 12:35733784-35733806 CTCTTTTTGTGGAGTTTCCATGG + Intergenic
1094966948 12:36184233-36184255 CTCTTTTTGTGGAGTTTCCATGG + Intergenic
1095001304 12:36739493-36739515 CTCTTTTTGTCGAGTTTCCATGG + Intergenic
1095022697 12:37085978-37086000 CTCTGTTTGTGGAGTTTCCATGG + Intergenic
1095030650 12:37271949-37271971 CTCTGTTTGTAAAGTCTGCATGG + Intergenic
1096572532 12:52531939-52531961 CTATGTTTGTGGACATTTCTTGG + Intergenic
1096791619 12:54048415-54048437 CCCTTTTTCTGGAGTTTTTAAGG - Intronic
1098600179 12:72322108-72322130 CAATGTTTGTGGTGCTTTCATGG + Intronic
1100924017 12:99523502-99523524 CTCTGTCCCTGGAGTCTTCAAGG + Intronic
1101347982 12:103904063-103904085 CTTTCTTTGTGGAGATCTCATGG - Intergenic
1101800861 12:108020964-108020986 CTCTGTATGTGTACTTTTCTGGG - Intergenic
1101852951 12:108418900-108418922 CCATGTTAGTGAAGTTTTCAAGG - Intergenic
1103882187 12:124174753-124174775 CTCTGTTGGAGGATTTTCCACGG - Intronic
1104073318 12:125367033-125367055 ATTTGTTTGCTGAGTTTTCATGG + Intronic
1105189444 13:17877619-17877641 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1105450150 13:20492469-20492491 CACTCTTTCTGGAGGTTTCAGGG + Intronic
1105544377 13:21340909-21340931 CTCTAGTTCTGGAGTTTCCAAGG + Intergenic
1105953009 13:25249837-25249859 GTTTGTTTGTTGTGTTTTCAGGG - Intronic
1106130424 13:26934895-26934917 CTCTGTTTGTGTTGTTATAAAGG - Intergenic
1107056752 13:36113560-36113582 CAGTGTTTTGGGAGTTTTCATGG + Intronic
1107295934 13:38907545-38907567 CTGTGTGTATGGAGTTTACATGG + Intergenic
1108150380 13:47527682-47527704 CTCTGTTTGTGATCTATTCAGGG - Intergenic
1108769194 13:53677528-53677550 ATGTGTTTGTGTAGTTTCCAAGG + Intergenic
1109589681 13:64462292-64462314 CCCTCTTTGAGGTGTTTTCAAGG + Intergenic
1111198603 13:84905376-84905398 CACTGGTTGTAGAGTTTGCATGG + Intergenic
1111224358 13:85250102-85250124 TTCTGTTTTTAGACTTTTCACGG - Intergenic
1111551106 13:89814032-89814054 CTCTGTTTGTAGAGTTTTATGGG - Intergenic
1112727397 13:102320251-102320273 TTTTTTTTTTGGAGTTTTCAAGG - Intronic
1113946298 13:114045742-114045764 CTGTTTTTGTGTAATTTTCATGG - Intronic
1114000533 14:18237415-18237437 CTCTTTTTGTAGAATTTGCAAGG - Intergenic
1115681443 14:35743128-35743150 CTGTCTGTGTGGAGTTTGCATGG - Intronic
1115841823 14:37480797-37480819 GTTTTTTTGTGGAGTCTTCAGGG - Intronic
1116557360 14:46328287-46328309 TAGTGTTTGTGCAGTTTTCAAGG + Intergenic
1117285204 14:54280148-54280170 GCCTGTTAGTGCAGTTTTCAGGG - Intergenic
1121435905 14:93919209-93919231 ATGTGTTTGTTGAGTTTTCATGG + Intronic
1122255736 14:100474356-100474378 CTGTGTTTGTGGAGATGTGAAGG - Intronic
1123357501 15:19279314-19279336 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1123846878 15:24312120-24312142 CTTGCTGTGTGGAGTTTTCAGGG + Intergenic
1123865882 15:24519181-24519203 CTTGCTGTGTGGAGTTTTCAGGG + Intergenic
1124455899 15:29842585-29842607 CTGTCTGTGTGGAGTTTGCATGG - Intronic
1126261552 15:46698909-46698931 ATTTGATTGTGGTGTTTTCATGG - Intergenic
1126832764 15:52625269-52625291 CTCTGCTTGAAGACTTTTCATGG - Intronic
1127727504 15:61764440-61764462 CTCTGTATCTGTAGTTTTCTAGG - Intergenic
1130174571 15:81554870-81554892 CTTTTGGTGTGGAGTTTTCATGG - Intergenic
1131085659 15:89573692-89573714 CTCTTTTGGTTGAGTTTTCTAGG - Intergenic
1132158804 15:99517761-99517783 CTGTGCATGTGGAGTTTTCCAGG + Intergenic
1134828743 16:17306121-17306143 CTCTGTATGTGGAAATTTCAGGG + Intronic
1136601630 16:31295583-31295605 CTTTTTTGGTGGAGTTTTTAGGG + Intronic
1136915204 16:34184265-34184287 GTCTGTTTGTGGAATCTGCAAGG - Intergenic
1136921764 16:34287096-34287118 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
1137031660 16:35529832-35529854 TTCTGTTTGTGTATTTATCAGGG - Intergenic
1137138983 16:37013839-37013861 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
1137172943 16:37575344-37575366 CTCTGTTTGTAAAGTCTGCAAGG + Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1140717529 16:77740052-77740074 CTCTGAATATGGAGTTTTCCAGG - Intronic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1145628958 17:25836417-25836439 CTCTTTTTGTAGAGACTTCAAGG + Intergenic
1145911743 17:28547189-28547211 CTCTGCTTGGGGAGTTCTCCAGG - Exonic
1146242815 17:31245765-31245787 CTCTGTTCGTTGGGTTTTTATGG + Intronic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1148390706 17:47270332-47270354 CTCCCTTTCTGGAGTTTCCATGG - Intronic
1150168167 17:62965146-62965168 CTCTGTCTGTGGCGCTTCCAAGG - Intergenic
1150985136 17:70187465-70187487 CACTGTCTGTGAATTTTTCATGG + Intergenic
1152893882 17:82898662-82898684 CTTTGTTTTTGGTGTTTTCCTGG + Intronic
1153170092 18:2306404-2306426 GTCTGTTTTTGGAGTTTACTTGG - Intergenic
1153712172 18:7810665-7810687 CACTGTCTGTGAAGTTTGCAGGG + Intronic
1153944337 18:10005680-10005702 CTCTGCTTGTGATGTTCTCAAGG + Intergenic
1154563163 18:15857831-15857853 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1154590251 18:16228747-16228769 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1154596549 18:16314614-16314636 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1154646863 18:17005619-17005641 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1154674598 18:17385089-17385111 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1154689449 18:17588473-17588495 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1154779981 18:18829578-18829600 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1154811654 18:19265200-19265222 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1154913179 18:20685121-20685143 CTCTTTTTGTAGAGTATGCAAGG + Intergenic
1154922230 18:20824825-20824847 CTCTTTTTGTAGAGTATGCAAGG - Intergenic
1155535927 18:26817450-26817472 ATCTTTTTGTGAATTTTTCAAGG + Intergenic
1156899655 18:42286241-42286263 CTCTGTTATTGCATTTTTCACGG - Intergenic
1157379337 18:47197556-47197578 ATGTGTTTGTGGAGTTTCCAAGG - Intergenic
1157865899 18:51184447-51184469 CAGTGATTGTGGAGTTTTTAAGG - Intronic
1159316055 18:66774743-66774765 TGCTGTTTGTGGATATTTCATGG + Intergenic
1162910683 19:13846632-13846654 CTCTGTGTGTGGCGTTGCCATGG - Intergenic
1163188819 19:15660401-15660423 CAGTGTCTGTGGAGTTTGCAGGG - Exonic
1163454339 19:17397523-17397545 CTCTGTTTGTGGCTTTATAAAGG + Intergenic
1163788845 19:19293883-19293905 GTCTGTTTGTGGATTCTTCAGGG - Intronic
1163890843 19:20011640-20011662 CTATATTTGTGTAGTTTTGAGGG - Intronic
1164102762 19:22072788-22072810 CTGTGTTTGTGTGTTTTTCAGGG + Exonic
1164341953 19:24411037-24411059 CTCTGTTTGTAGAATCTGCAAGG + Intergenic
1164366177 19:27584515-27584537 CTCTTTTTGTAGAATCTTCAAGG + Intergenic
1165583029 19:36885985-36886007 GTCTGTTTGTGTAGCTTTCAGGG + Intronic
1166907563 19:46123789-46123811 TCCTGTTTGTGGAGTTCTAACGG - Intronic
1167268652 19:48495960-48495982 CTATGGTGGTGGAGTTGTCAGGG + Intronic
1167957220 19:53075605-53075627 CTGTCTTTTTTGAGTTTTCATGG - Intronic
925351546 2:3204308-3204330 CTGTGAGTGTGAAGTTTTCAGGG - Intronic
925367504 2:3320644-3320666 TTCTGTTTGTTGTGATTTCAGGG - Intronic
926617733 2:15014479-15014501 ATGTGTTTGTGTAGTTTCCAAGG - Intergenic
926793738 2:16601364-16601386 CTCTGTTTTTGGAGGATTGAGGG - Intronic
931362432 2:61589312-61589334 TTCTCATTGTTGAGTTTTCAGGG + Intergenic
931496802 2:62816667-62816689 ATCTGTGTATGGAGTTGTCATGG + Intronic
932867801 2:75364744-75364766 GCCTTTTTGTGGAGTTTTTAGGG + Intergenic
933547777 2:83737137-83737159 CCATCTTTGTTGAGTTTTCACGG + Intergenic
934342813 2:92294474-92294496 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934384517 2:92960068-92960090 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934392080 2:93081975-93081997 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934395654 2:93140014-93140036 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934401480 2:93234798-93234820 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934415945 2:93467287-93467309 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934417893 2:93498531-93498553 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934421881 2:93562412-93562434 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934424403 2:93602559-93602581 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934426144 2:93630568-93630590 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934426904 2:93642626-93642648 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934434602 2:93767192-93767214 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934440210 2:93857702-93857724 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
934470552 2:94527517-94527539 CTCTTTTTGTAGAATTTGCAAGG - Intergenic
934834240 2:97568574-97568596 CTCTGTTTGTGTTTTTTTGAAGG - Intronic
935701360 2:105814945-105814967 CTCTGTATGTGTCATTTTCAGGG - Intronic
936166606 2:110125957-110125979 CTGTGGTTGTATAGTTTTCATGG - Intronic
938390976 2:130905470-130905492 CTCTTACTGTGGAGTTCTCATGG + Intronic
939168379 2:138664397-138664419 CTGTGTGTATGGAGTTTTTATGG - Intergenic
940144158 2:150527813-150527835 CTGTGCTTGTGGAATTGTCAGGG - Intronic
941040095 2:160611799-160611821 TTCTGTCTGTGGAGGTTCCAGGG + Intergenic
943769586 2:191702045-191702067 CTCTGTTTGTGTTGCTATCAAGG - Intergenic
944595941 2:201260665-201260687 CTTTGATTCTGGAGTTTTCTAGG + Intronic
944672204 2:202004384-202004406 CTCTGTTTTTTTAGTTTTTAAGG - Intergenic
945227140 2:207543550-207543572 ATCTCTTTGTAAAGTTTTCAGGG + Intronic
945430228 2:209755225-209755247 ATCTGTTTGGAGAGTTGTCAGGG + Intergenic
947109616 2:226705239-226705261 CTCTAATTTTTGAGTTTTCACGG - Intergenic
1168744954 20:231231-231253 GTGTGTTCGTGAAGTTTTCAGGG - Intergenic
1170008548 20:11695346-11695368 CCCTGTTTGTAGAGTATTCAAGG + Intergenic
1171238757 20:23548387-23548409 CTCTGAGTGTGCAGTTCTCAGGG - Intergenic
1171318641 20:24219602-24219624 CTCTTTTTTTGGATGTTTCAGGG + Intergenic
1171575564 20:26310196-26310218 CTCTGTTTGTGGAATCTGCAAGG + Intergenic
1171575754 20:26313600-26313622 CTCTGTTTGTGGAATCTGCAAGG + Intergenic
1171576894 20:26337988-26338010 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1171578654 20:26370204-26370226 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1171585343 20:26514979-26515001 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1171739991 20:28872187-28872209 CTCTTTTTGTAGAGTCTTCAAGG - Intergenic
1171807474 20:29693793-29693815 CTCCGTTTGTAGAGTATGCAAGG + Intergenic
1173438579 20:43055191-43055213 CTCTGTTTTCTGGGTTTTCAGGG - Intronic
1173984836 20:47252993-47253015 ATCTGTTTATGTAGTGTTCATGG - Intronic
1175051547 20:56160076-56160098 CCCTCTTTTTGGAGTTTTCCAGG - Intergenic
1175527231 20:59643727-59643749 CCCTCTGTGTGGAGTGTTCAGGG + Intronic
1176665830 21:9686676-9686698 CTCTGTTTCTGAAGTTTAAAGGG - Intergenic
1177096759 21:16845115-16845137 TTCTCTCTGTGGAGTTTACAGGG + Intergenic
1177445710 21:21193088-21193110 CTCCGTTTATGGATTATTCAAGG + Intronic
1178553423 21:33562875-33562897 CTATTAGTGTGGAGTTTTCATGG + Intronic
1179993473 21:44960557-44960579 CTGTGCTCGTGGAGTTTTTATGG + Intronic
1183541261 22:38430703-38430725 CTCTGTAAATAGAGTTTTCAGGG + Intronic
1184449099 22:44572364-44572386 CTGTGTCTTTTGAGTTTTCACGG - Intergenic
1184963934 22:47952895-47952917 ATCTGTTTGTGGATTTCTCTAGG + Intergenic
949693315 3:6665347-6665369 CTTTGTCTCTGGAGTTATCAGGG - Intergenic
949725436 3:7039193-7039215 CTGTGATTGTGGAGTTTGCATGG + Intronic
951018415 3:17755464-17755486 CTCTCTTTGTGGCATTTTAATGG - Intronic
952832850 3:37579476-37579498 CTTTATTTATGGAGTTTTCCTGG + Intronic
953245514 3:41187745-41187767 CTTTGTTTATGGTGTTTTTATGG - Intergenic
954987844 3:54811306-54811328 CTCTGTTTTTGCATTTATCAAGG + Intronic
955665775 3:61347911-61347933 CTCTGTTTCTGCTGTTTTCTGGG + Intergenic
958209894 3:90459513-90459535 CTCTGTTTGTAGAATCTGCAAGG - Intergenic
958215926 3:90575752-90575774 CTCTTCTTGTGGAATTTGCAAGG - Intergenic
958218231 3:90622184-90622206 CTCTTTTTGTAGAATTTCCAAGG - Intergenic
958218879 3:90634350-90634372 CTCTTTTTGTGGAATTTGCAAGG - Intergenic
958219486 3:90646419-90646441 CTCTTTTTGTAGAATTTCCAAGG - Intergenic
958221001 3:90678845-90678867 CTCTTTTTGTAGAATTTCCAAGG - Intergenic
958221026 3:90679518-90679540 CTCTCTTTGTTGAATTTCCAAGG - Intergenic
958221790 3:90695592-90695614 GTCTATTTGTAGTGTTTTCAAGG - Intergenic
958222892 3:90718233-90718255 CTCTTTTTGTGGAATTTGCAAGG - Intergenic
958223738 3:90782905-90782927 CTCTTTTTGTAGAATTTCCAAGG + Intergenic
958225105 3:90805840-90805862 CTCTTTTTGTAGAATTTCCAAGG + Intergenic
958240899 3:91071735-91071757 CTCTTTTTGTAGAATTTCCAAGG + Intergenic
958248158 3:91193232-91193254 CTCTTTTTGTAGAATTTCCAAGG + Intergenic
958249891 3:91222114-91222136 CTCTTTTTGTAGAATTTCCAAGG + Intergenic
958251446 3:91247763-91247785 CTCTTTTTGTAGAATTTCCAAGG - Intergenic
958251547 3:91249462-91249484 CTCTTTTTGTAGAATTTCCAAGG - Intergenic
958273197 3:91535203-91535225 CTCTTTTTGTAGAATTTGCAAGG - Intergenic
958273513 3:91541243-91541265 CTCTGTTTTTAGAATTTGCAAGG - Intergenic
958273601 3:91542762-91542784 CTCTCTTTGTAGAATTTGCAAGG - Intergenic
958273728 3:91544972-91544994 CTCTCTTTGTAGAATTTGCAAGG - Intergenic
958273852 3:91547187-91547209 CTCTCTTTTTGGAATTTGCAAGG - Intergenic
958273924 3:91548373-91548395 CACTTTTTGTGGAATTTGCAAGG - Intergenic
958274026 3:91550069-91550091 CACTTTTTGTGGAATTTTCAGGG - Intergenic
958274165 3:91552278-91552300 CACTTTTTGTGGAATTTGCAAGG - Intergenic
958274204 3:91552956-91552978 CACTTTTTGTGGAATTTTCAGGG - Intergenic
958274331 3:91555033-91555055 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958274507 3:91557918-91557940 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958274686 3:91560812-91560834 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958274851 3:91563368-91563390 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958275025 3:91566262-91566284 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958275205 3:91569157-91569179 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958275363 3:91571708-91571730 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958275538 3:91574602-91574624 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958275647 3:91576471-91576493 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958275713 3:91577489-91577511 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958275893 3:91580378-91580400 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958276072 3:91583270-91583292 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958276245 3:91586163-91586185 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958276424 3:91589054-91589076 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958276552 3:91591097-91591119 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958276731 3:91593989-91594011 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958276922 3:91597219-91597241 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958277096 3:91600110-91600132 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958277277 3:91603003-91603025 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958277452 3:91605895-91605917 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958277560 3:91607767-91607789 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958277624 3:91608785-91608807 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958277801 3:91611677-91611699 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958277911 3:91613548-91613570 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958277979 3:91614568-91614590 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958278137 3:91617121-91617143 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958278312 3:91620013-91620035 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958278486 3:91622904-91622926 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958278656 3:91625797-91625819 CACTTTTTGTGAAATTTTCAGGG + Intergenic
958278832 3:91628689-91628711 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958278873 3:91629366-91629388 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958279011 3:91631577-91631599 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958279184 3:91634468-91634490 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958279356 3:91637359-91637381 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958279459 3:91639056-91639078 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958279616 3:91641608-91641630 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958279794 3:91644501-91644523 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958279972 3:91647393-91647415 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958280150 3:91650283-91650305 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958280323 3:91653180-91653202 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958280503 3:91656073-91656095 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958280675 3:91658968-91658990 CTCTTTTAGTGCAATTTTCAGGG + Intergenic
958280831 3:91661523-91661545 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958281006 3:91664417-91664439 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958281183 3:91667308-91667330 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958281357 3:91670201-91670223 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958281532 3:91673092-91673114 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958281706 3:91675984-91676006 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958281886 3:91678876-91678898 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958282064 3:91681764-91681786 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958282241 3:91684655-91684677 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958282414 3:91687546-91687568 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958282592 3:91690438-91690460 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958282764 3:91693329-91693351 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958283030 3:91697757-91697779 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958283204 3:91700648-91700670 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958283490 3:91705415-91705437 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958283667 3:91708307-91708329 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958283842 3:91711200-91711222 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958284017 3:91714095-91714117 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958284199 3:91716983-91717005 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958284393 3:91719873-91719895 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958284575 3:91722768-91722790 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958284749 3:91725659-91725681 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958284924 3:91728550-91728572 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958285101 3:91731444-91731466 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958285275 3:91734335-91734357 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958285447 3:91737228-91737250 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958285623 3:91740122-91740144 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958285810 3:91743011-91743033 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958285971 3:91745564-91745586 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958286145 3:91748455-91748477 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958286319 3:91751347-91751369 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958286489 3:91754238-91754260 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958286668 3:91757129-91757151 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958286841 3:91760024-91760046 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958287011 3:91762914-91762936 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958287033 3:91763254-91763276 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958287199 3:91765804-91765826 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958287285 3:91767164-91767186 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958287377 3:91768695-91768717 CACTTTTTGTGAAATTTTCAGGG + Intergenic
958287555 3:91771590-91771612 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958287731 3:91774481-91774503 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958287906 3:91777373-91777395 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958288087 3:91780266-91780288 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958288259 3:91783159-91783181 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958288429 3:91786050-91786072 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958288605 3:91788940-91788962 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958288782 3:91791832-91791854 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958288956 3:91794723-91794745 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958289132 3:91797615-91797637 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958289503 3:91803737-91803759 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958289677 3:91806623-91806645 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958289855 3:91809515-91809537 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958290032 3:91812407-91812429 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958290208 3:91815299-91815321 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958290382 3:91818191-91818213 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958290558 3:91821082-91821104 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958290732 3:91823973-91823995 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958290905 3:91826866-91826888 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958291065 3:91829419-91829441 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958291241 3:91832311-91832333 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958291417 3:91835202-91835224 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958291574 3:91837756-91837778 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958291752 3:91840648-91840670 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958291934 3:91843541-91843563 CACTTTTTGTGGAATTTTCATGG + Intergenic
958292112 3:91846434-91846456 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958292463 3:91852218-91852240 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958292640 3:91855110-91855132 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958292814 3:91858003-91858025 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958292994 3:91860898-91860920 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958293169 3:91863788-91863810 CACTTTTTCTGGAATTTTCAGGG + Intergenic
958293344 3:91866677-91866699 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958293456 3:91868553-91868575 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958293501 3:91869230-91869252 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958293602 3:91870762-91870784 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958293798 3:91873651-91873673 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958293905 3:91875347-91875369 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958293976 3:91876533-91876555 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958294041 3:91877551-91877573 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958294214 3:91880442-91880464 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958294369 3:91882995-91883017 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958294545 3:91885888-91885910 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958294725 3:91888779-91888801 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958294973 3:91892093-91892115 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958295152 3:91894985-91895007 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958295319 3:91897877-91897899 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958295491 3:91900768-91900790 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958295623 3:91902979-91903001 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958295800 3:91905869-91905891 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958296028 3:91909622-91909644 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958296200 3:91912515-91912537 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958296377 3:91915408-91915430 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958296553 3:91918300-91918322 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958296835 3:91923066-91923088 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958297009 3:91925957-91925979 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958297185 3:91928850-91928872 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958297358 3:91931742-91931764 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958297544 3:91934632-91934654 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958297723 3:91937526-91937548 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958297903 3:91940413-91940435 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958298080 3:91943306-91943328 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958298255 3:91946198-91946220 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958298424 3:91949092-91949114 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958298596 3:91951981-91952003 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958298768 3:91954873-91954895 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958298948 3:91957765-91957787 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958299144 3:91960654-91960676 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958299323 3:91963547-91963569 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958299504 3:91966441-91966463 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958299674 3:91969330-91969352 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958299850 3:91972222-91972244 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958300026 3:91975113-91975135 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958300201 3:91978005-91978027 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958300372 3:91980900-91980922 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958300551 3:91983791-91983813 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958300719 3:91986682-91986704 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958300908 3:91989573-91989595 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958301103 3:91992803-91992825 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958301278 3:91995694-91995716 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958301453 3:91998586-91998608 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958301623 3:92001479-92001501 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958301812 3:92004370-92004392 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958302117 3:92009475-92009497 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958302292 3:92012366-92012388 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958302466 3:92015257-92015279 CACTTTTTCTGGAATTTTCAGGG + Intergenic
958302643 3:92018150-92018172 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958302816 3:92021043-92021065 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958302994 3:92023937-92023959 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958303105 3:92025810-92025832 GTCTCTTTGTAGAGTTTGCAAGG + Intergenic
958303170 3:92026828-92026850 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958303338 3:92029720-92029742 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958303515 3:92032616-92032638 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958303802 3:92037383-92037405 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958303977 3:92040274-92040296 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958304149 3:92043165-92043187 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958304326 3:92046055-92046077 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958304483 3:92048608-92048630 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958304662 3:92051500-92051522 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958304836 3:92054392-92054414 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958305008 3:92057282-92057304 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958305186 3:92060175-92060197 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958305368 3:92063069-92063091 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958305525 3:92065623-92065645 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958305707 3:92068516-92068538 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958305885 3:92071408-92071430 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958306063 3:92074301-92074323 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958306368 3:92079409-92079431 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958306543 3:92082306-92082328 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958306717 3:92085199-92085221 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958306894 3:92088091-92088113 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958307076 3:92090980-92091002 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958307363 3:92095745-92095767 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958307537 3:92098636-92098658 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958307713 3:92101529-92101551 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958307869 3:92104082-92104104 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958308047 3:92106973-92106995 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958308217 3:92109860-92109882 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958308390 3:92112751-92112773 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958308563 3:92115644-92115666 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958308671 3:92117518-92117540 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958308736 3:92118536-92118558 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958308840 3:92120235-92120257 CACTTTTTGTGGAATTTTCATGG + Intergenic
958309019 3:92123127-92123149 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958309196 3:92126019-92126041 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958309371 3:92128913-92128935 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958309545 3:92131803-92131825 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958309700 3:92134356-92134378 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958309875 3:92137249-92137271 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958310046 3:92140140-92140162 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958310225 3:92143031-92143053 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958310414 3:92146264-92146286 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958310589 3:92149157-92149179 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958310766 3:92152053-92152075 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958310940 3:92154944-92154966 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958311129 3:92157835-92157857 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958311307 3:92160726-92160748 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958311481 3:92163617-92163639 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958311655 3:92166508-92166530 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958311828 3:92169402-92169424 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958312015 3:92172295-92172317 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958312197 3:92175188-92175210 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958312372 3:92178082-92178104 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958312547 3:92180972-92180994 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958312721 3:92183863-92183885 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958312831 3:92185561-92185583 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958313005 3:92188452-92188474 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958313181 3:92191345-92191367 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958313340 3:92193899-92193921 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958313532 3:92197130-92197152 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958313718 3:92200023-92200045 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958313915 3:92203256-92203278 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958314089 3:92206150-92206172 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958314274 3:92209040-92209062 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958314453 3:92211933-92211955 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958314611 3:92214486-92214508 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958314785 3:92217380-92217402 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958314961 3:92220270-92220292 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958315135 3:92223163-92223185 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958315309 3:92226058-92226080 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958315470 3:92228611-92228633 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958315657 3:92231504-92231526 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958315848 3:92234395-92234417 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958316026 3:92237290-92237312 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958316198 3:92240184-92240206 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958316372 3:92243076-92243098 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958316549 3:92245969-92245991 CACTTTTTCTGGAATTTTCAGGG + Intergenic
958316725 3:92248862-92248884 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958316901 3:92251757-92251779 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958317075 3:92254652-92254674 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958317183 3:92256349-92256371 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958317344 3:92258902-92258924 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958317521 3:92261794-92261816 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958317693 3:92264685-92264707 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958317871 3:92267578-92267600 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958318046 3:92270469-92270491 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958318222 3:92273361-92273383 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958318399 3:92276255-92276277 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958318683 3:92281019-92281041 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958318842 3:92283573-92283595 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958319017 3:92286467-92286489 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958319210 3:92289701-92289723 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958319387 3:92292592-92292614 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958319562 3:92295486-92295508 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958319734 3:92298377-92298399 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958319909 3:92301268-92301290 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958320003 3:92302797-92302819 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958320178 3:92305689-92305711 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958320336 3:92308243-92308265 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958320513 3:92311139-92311161 CACTTTTTGTGGAATTTTCCGGG + Intergenic
958320684 3:92314032-92314054 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958320859 3:92316923-92316945 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958321034 3:92319816-92319838 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958321213 3:92322706-92322728 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958321628 3:92329696-92329718 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958321788 3:92332249-92332271 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958321960 3:92335139-92335161 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958322135 3:92338033-92338055 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958322312 3:92340925-92340947 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958322487 3:92343818-92343840 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958322661 3:92346712-92346734 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958322836 3:92349607-92349629 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958323013 3:92352497-92352519 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958323185 3:92355388-92355410 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958323363 3:92358280-92358302 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958323536 3:92361173-92361195 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958323713 3:92364066-92364088 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958324101 3:92370371-92370393 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958324273 3:92373263-92373285 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958324450 3:92376154-92376176 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958324628 3:92379048-92379070 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958324813 3:92381939-92381961 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958324986 3:92384828-92384850 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958325160 3:92387721-92387743 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958325333 3:92390613-92390635 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958325455 3:92392484-92392506 GTCTGTTTGTAGAATTTGCAAGG + Intergenic
958325671 3:92396058-92396080 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958325848 3:92398951-92398973 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958326027 3:92401843-92401865 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958326202 3:92404737-92404759 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958326375 3:92407631-92407653 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958326554 3:92410524-92410546 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958326897 3:92416305-92416327 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958327075 3:92419197-92419219 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958327259 3:92422090-92422112 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958327612 3:92427875-92427897 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958327786 3:92430766-92430788 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958327964 3:92433658-92433680 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958328138 3:92436554-92436576 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958328311 3:92439445-92439467 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958328487 3:92442337-92442359 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958328663 3:92445228-92445250 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958328835 3:92448120-92448142 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958329014 3:92451012-92451034 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958329188 3:92453903-92453925 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958329366 3:92456794-92456816 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958329541 3:92459684-92459706 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958329701 3:92462238-92462260 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958329877 3:92465133-92465155 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958330053 3:92468023-92468045 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958330224 3:92470914-92470936 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958330401 3:92473805-92473827 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958330559 3:92476358-92476380 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958330733 3:92479250-92479272 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958330911 3:92482144-92482166 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958331089 3:92485036-92485058 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958331273 3:92487927-92487949 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958331455 3:92490817-92490839 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958331638 3:92493707-92493729 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958331822 3:92496598-92496620 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958331996 3:92499489-92499511 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958332167 3:92502379-92502401 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958332348 3:92505272-92505294 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958332525 3:92508164-92508186 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958332700 3:92511056-92511078 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958332874 3:92513949-92513971 CACTTTTTCTGGAATTTTCAGGG + Intergenic
958333050 3:92516841-92516863 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958333158 3:92518715-92518737 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958333224 3:92519733-92519755 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958333408 3:92522626-92522648 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958333580 3:92525517-92525539 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958333759 3:92528404-92528426 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958333936 3:92531300-92531322 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958334113 3:92534188-92534210 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958334398 3:92538960-92538982 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958334575 3:92541851-92541873 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958334754 3:92544743-92544765 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958334919 3:92547638-92547660 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958335099 3:92550530-92550552 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958335271 3:92553421-92553443 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958335447 3:92556316-92556338 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958335624 3:92559209-92559231 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958336026 3:92565848-92565870 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958336202 3:92568740-92568762 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958336377 3:92571631-92571653 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958336553 3:92574524-92574546 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958336725 3:92577415-92577437 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958336902 3:92580306-92580328 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958337074 3:92583198-92583220 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958337246 3:92586090-92586112 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958337433 3:92588980-92589002 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958337609 3:92591874-92591896 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958337784 3:92594768-92594790 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958337955 3:92597662-92597684 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958338127 3:92600555-92600577 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958338302 3:92603445-92603467 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958338455 3:92606002-92606024 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958338631 3:92608896-92608918 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958338810 3:92611792-92611814 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958338992 3:92614681-92614703 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958339494 3:92623022-92623044 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958339665 3:92625913-92625935 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958339841 3:92628807-92628829 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958340022 3:92631701-92631723 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958340205 3:92634592-92634614 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958340380 3:92637483-92637505 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958340556 3:92640375-92640397 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958340729 3:92643266-92643288 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958341025 3:92648031-92648053 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958341198 3:92650920-92650942 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958341357 3:92653473-92653495 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958341515 3:92656026-92656048 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958341690 3:92658920-92658942 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958341865 3:92661811-92661833 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958342025 3:92664364-92664386 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958342205 3:92667259-92667281 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958342387 3:92670151-92670173 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958342565 3:92673043-92673065 CACTTTTTCTGGAATTTTCAGGG + Intergenic
958342744 3:92675934-92675956 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958342919 3:92678827-92678849 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958343099 3:92681719-92681741 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958343271 3:92684610-92684632 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958343448 3:92687501-92687523 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958343624 3:92690394-92690416 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958343796 3:92693288-92693310 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958343973 3:92696180-92696202 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958344153 3:92699072-92699094 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958344326 3:92701969-92701991 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958344488 3:92704523-92704545 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958344667 3:92707413-92707435 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958344838 3:92710304-92710326 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958344997 3:92712858-92712880 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958345176 3:92715750-92715772 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958345292 3:92717621-92717643 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958345356 3:92718641-92718663 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958345515 3:92721194-92721216 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958345690 3:92724085-92724107 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958345861 3:92726975-92726997 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958346054 3:92729867-92729889 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958346233 3:92732759-92732781 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958346411 3:92735650-92735672 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958346504 3:92737008-92737030 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958346677 3:92739898-92739920 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958346855 3:92742793-92742815 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958347027 3:92745684-92745706 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958347204 3:92748576-92748598 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958347379 3:92751469-92751491 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958347553 3:92754363-92754385 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958347726 3:92757254-92757276 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958347886 3:92759809-92759831 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958348065 3:92762701-92762723 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958348238 3:92765592-92765614 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958348365 3:92767806-92767828 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958348540 3:92770697-92770719 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958348720 3:92773591-92773613 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958348893 3:92776483-92776505 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958348998 3:92778184-92778206 CACTTTTTGTGGAATTTGCAAGG + Intergenic
958349136 3:92780388-92780410 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958349308 3:92783279-92783301 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958349589 3:92788040-92788062 GTCTGTTTGTAGAATTTGCAAGG + Intergenic
958349657 3:92789058-92789080 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958349834 3:92791950-92791972 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958350013 3:92794843-92794865 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958350194 3:92797740-92797762 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958350484 3:92802509-92802531 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958350642 3:92805062-92805084 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958350817 3:92807951-92807973 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958351058 3:92811858-92811880 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958351241 3:92814749-92814771 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958351409 3:92817640-92817662 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958351588 3:92820534-92820556 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958351761 3:92823426-92823448 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958351933 3:92826318-92826340 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958352112 3:92829212-92829234 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958352243 3:92831419-92831441 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958352423 3:92834312-92834334 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958352600 3:92837203-92837225 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958352777 3:92840097-92840119 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958352949 3:92842986-92843008 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958353120 3:92845879-92845901 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958353296 3:92848770-92848792 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958353473 3:92851666-92851688 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958353650 3:92854555-92854577 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958353829 3:92857447-92857469 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958354001 3:92860338-92860360 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958354177 3:92863231-92863253 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958354347 3:92866122-92866144 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958354518 3:92869014-92869036 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958354692 3:92871905-92871927 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958354867 3:92874797-92874819 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958355045 3:92877689-92877711 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958355222 3:92880580-92880602 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958355395 3:92883472-92883494 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958355568 3:92886363-92886385 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958355743 3:92889256-92889278 CACTTTTTGTGAAATTTTCAGGG + Intergenic
958355854 3:92891125-92891147 CTCTCTTTTTGGAATTTGCAAGG + Intergenic
958356046 3:92894357-92894379 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958356217 3:92897245-92897267 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958356393 3:92900135-92900157 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958356573 3:92903027-92903049 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958356745 3:92905919-92905941 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958356785 3:92906597-92906619 CACTTTTTGTGGAATTTGCAAGG + Intergenic
958356926 3:92908809-92908831 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958357100 3:92911704-92911726 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958357277 3:92914598-92914620 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958357455 3:92917492-92917514 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958357789 3:92922938-92922960 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958357967 3:92925835-92925857 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958358143 3:92928731-92928753 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958358317 3:92931623-92931645 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958358491 3:92934515-92934537 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958358574 3:92935875-92935897 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958358667 3:92937406-92937428 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958358842 3:92940298-92940320 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958359017 3:92943190-92943212 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958359190 3:92946083-92946105 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958359365 3:92948974-92948996 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958359522 3:92951527-92951549 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958359713 3:92954758-92954780 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958359889 3:92957649-92957671 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958360063 3:92960540-92960562 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958360240 3:92963433-92963455 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958360417 3:92966325-92966347 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958360599 3:92969215-92969237 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958360706 3:92970912-92970934 CACTTTTTGTGGAATTTGCAAGG + Intergenic
958360849 3:92973118-92973140 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958361026 3:92976012-92976034 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958361116 3:92977540-92977562 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958361292 3:92980431-92980453 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958361462 3:92983318-92983340 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958361681 3:92986888-92986910 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958361855 3:92989778-92989800 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958362033 3:92992670-92992692 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958362206 3:92995562-92995584 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958362386 3:92998455-92998477 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958362566 3:93001349-93001371 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958362742 3:93004241-93004263 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958362918 3:93007133-93007155 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958363076 3:93009686-93009708 CACTTTTTGTGGAATTTTCATGG + Intergenic
958363260 3:93012576-93012598 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958363327 3:93013598-93013620 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958363438 3:93015468-93015490 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958363609 3:93018360-93018382 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958363692 3:93019720-93019742 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958363764 3:93020911-93020933 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958363943 3:93023803-93023825 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958364119 3:93026692-93026714 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958364303 3:93029581-93029603 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958364483 3:93032474-93032496 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958364655 3:93035365-93035387 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958364837 3:93038256-93038278 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958365207 3:93044041-93044063 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958365386 3:93046934-93046956 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958365562 3:93049829-93049851 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958365742 3:93052721-93052743 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958365925 3:93055614-93055636 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958366095 3:93058505-93058527 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958366273 3:93061395-93061417 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958366445 3:93064289-93064311 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958366782 3:93069734-93069756 CACTTTTTGTGAAATTTTCAGGG + Intergenic
958366960 3:93072625-93072647 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958367137 3:93075516-93075538 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958367316 3:93078410-93078432 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958367490 3:93081303-93081325 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958367675 3:93084197-93084219 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958367845 3:93087088-93087110 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958367954 3:93088961-93088983 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958368022 3:93089980-93090002 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958368312 3:93094746-93094768 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958368485 3:93097637-93097659 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958368658 3:93100529-93100551 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958368839 3:93103417-93103439 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958369014 3:93106309-93106331 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958369191 3:93109202-93109224 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958369365 3:93112093-93112115 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958369527 3:93114646-93114668 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958369825 3:93119751-93119773 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958370003 3:93122642-93122664 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958370185 3:93125535-93125557 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958370342 3:93128089-93128111 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958370501 3:93130643-93130665 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958370674 3:93133533-93133555 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958370848 3:93136425-93136447 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958371024 3:93139316-93139338 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958371201 3:93142207-93142229 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958371374 3:93145097-93145119 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958371548 3:93147988-93148010 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958371723 3:93150881-93150903 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958371897 3:93153776-93153798 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958372074 3:93156667-93156689 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958372252 3:93159560-93159582 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958372439 3:93162450-93162472 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958372617 3:93165341-93165363 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958372796 3:93168232-93168254 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958372969 3:93171124-93171146 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958373144 3:93174012-93174034 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958373318 3:93176903-93176925 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958373493 3:93179795-93179817 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958373667 3:93182687-93182709 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958373847 3:93185583-93185605 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958374022 3:93188470-93188492 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958374193 3:93191364-93191386 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958374356 3:93193918-93193940 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958374534 3:93196810-93196832 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958374708 3:93199702-93199724 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958374884 3:93202591-93202613 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958375059 3:93205484-93205506 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958375365 3:93210595-93210617 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958375540 3:93213485-93213507 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958375708 3:93216377-93216399 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958375881 3:93219267-93219289 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958376054 3:93222158-93222180 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958376238 3:93225050-93225072 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958376417 3:93227942-93227964 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958376599 3:93230834-93230856 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958376786 3:93233725-93233747 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958376949 3:93236282-93236304 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958377124 3:93239174-93239196 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958377299 3:93242065-93242087 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958377475 3:93244961-93244983 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958377635 3:93247519-93247541 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958377995 3:93253300-93253322 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958378173 3:93256190-93256212 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958378333 3:93258743-93258765 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958378513 3:93261634-93261656 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958378689 3:93264523-93264545 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958378866 3:93267416-93267438 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958379047 3:93270305-93270327 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958379228 3:93273198-93273220 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958379402 3:93276090-93276112 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958379580 3:93278983-93279005 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958379909 3:93284433-93284455 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958380086 3:93287326-93287348 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958380271 3:93290218-93290240 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958380444 3:93293114-93293136 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958380732 3:93297880-93297902 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958380903 3:93300751-93300773 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958381065 3:93303304-93303326 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958381243 3:93306196-93306218 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958381420 3:93309091-93309113 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958381594 3:93311982-93312004 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958381773 3:93314876-93314898 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958381957 3:93317768-93317790 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958382248 3:93322535-93322557 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958382441 3:93325766-93325788 CACTTTTTCTGGAATTTTCAGGG + Intergenic
958382621 3:93328656-93328678 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958382793 3:93331548-93331570 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958382964 3:93334436-93334458 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958383144 3:93337328-93337350 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958383447 3:93342268-93342290 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958383512 3:93343291-93343313 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958383864 3:93349074-93349096 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958384037 3:93351965-93351987 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958384213 3:93354857-93354879 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958384388 3:93357746-93357768 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958384565 3:93360638-93360660 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958384741 3:93363529-93363551 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958384925 3:93366421-93366443 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958385098 3:93369308-93369330 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958385274 3:93372200-93372222 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958385451 3:93375091-93375113 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958385627 3:93377983-93378005 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958385805 3:93380873-93380895 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958385979 3:93383765-93383787 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958386150 3:93386656-93386678 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958386324 3:93389543-93389565 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958386502 3:93392436-93392458 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958386680 3:93395326-93395348 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958386837 3:93397879-93397901 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958387011 3:93400768-93400790 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958387169 3:93403322-93403344 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958387343 3:93406214-93406236 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958387521 3:93409107-93409129 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958387696 3:93412000-93412022 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958387876 3:93414889-93414911 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958388056 3:93417778-93417800 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958388235 3:93420670-93420692 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958388417 3:93423564-93423586 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958388524 3:93425265-93425287 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958388698 3:93428158-93428180 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958388869 3:93431051-93431073 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958389003 3:93433267-93433289 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958389030 3:93433604-93433626 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958389212 3:93436497-93436519 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958389386 3:93439390-93439412 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958389543 3:93441942-93441964 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958389716 3:93444833-93444855 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958389892 3:93447726-93447748 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958390069 3:93450618-93450640 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958390245 3:93453508-93453530 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958390418 3:93456392-93456414 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958390595 3:93459284-93459306 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958390772 3:93462176-93462198 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958390950 3:93465067-93465089 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958391127 3:93467958-93467980 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958391320 3:93471276-93471298 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958391497 3:93474168-93474190 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958391676 3:93477058-93477080 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958391854 3:93479949-93479971 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958392036 3:93482842-93482864 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958392213 3:93485733-93485755 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958392571 3:93491514-93491536 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958392745 3:93494405-93494427 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958392920 3:93497296-93497318 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958393092 3:93500188-93500210 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958393276 3:93503080-93503102 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958393450 3:93505965-93505987 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958393623 3:93508854-93508876 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958393794 3:93511745-93511767 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958393878 3:93513105-93513127 CTCTTTTTGTGGAATTTGCAAGG + Intergenic
958393972 3:93514637-93514659 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958394147 3:93517528-93517550 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958394327 3:93520418-93520440 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958394508 3:93523312-93523334 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958394680 3:93526204-93526226 CACTTGTTGTGGAATTTTCAGGG + Intergenic
958394863 3:93529095-93529117 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958395044 3:93531985-93532007 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958395219 3:93534876-93534898 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958395391 3:93537771-93537793 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958395567 3:93540665-93540687 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958395745 3:93543559-93543581 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958395925 3:93546450-93546472 AACTTTTTGTGGAATTTTCAGGG + Intergenic
958396104 3:93549343-93549365 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958396282 3:93552238-93552260 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958396459 3:93555130-93555152 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958396634 3:93558021-93558043 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958396816 3:93560911-93560933 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958396989 3:93563802-93563824 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958397163 3:93566691-93566713 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958397339 3:93569583-93569605 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958397506 3:93572473-93572495 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958397679 3:93575367-93575389 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958397852 3:93578260-93578282 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958398036 3:93581152-93581174 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958398213 3:93584044-93584066 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958398252 3:93584721-93584743 CACTTTTTGTGGAATTTGCAAGG + Intergenic
958398384 3:93586932-93586954 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958398560 3:93589824-93589846 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958398735 3:93592717-93592739 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958398911 3:93595609-93595631 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958399086 3:93598500-93598522 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958399259 3:93601393-93601415 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958399438 3:93604282-93604304 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958399622 3:93607170-93607192 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958399802 3:93610062-93610084 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958399974 3:93612955-93612977 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958400156 3:93615848-93615870 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958400330 3:93618735-93618757 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958400503 3:93621629-93621651 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958400677 3:93624521-93624543 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958400853 3:93627412-93627434 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958401025 3:93630304-93630326 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958401201 3:93633197-93633219 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958401382 3:93636087-93636109 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958401560 3:93638979-93639001 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958401736 3:93641872-93641894 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958401908 3:93644765-93644787 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958402086 3:93647657-93647679 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958402265 3:93650549-93650571 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958402457 3:93653442-93653464 CACTTTTTGTGGAATTTTCAGGG + Intergenic
958402683 3:93707080-93707102 CACTTTTTGTGGAATTTTCAGGG - Intergenic
958402863 3:93709963-93709985 CACTTTTTGTGGAATTTTCAGGG - Intergenic
958403041 3:93712853-93712875 CACTTTTTGTGGAATTTTCAGGG - Intergenic
958403104 3:93713868-93713890 CTCTTTTAGTGCAATTTTCAGGG - Intergenic
958403167 3:93714882-93714904 CTCTCTTTGTAGAATTTGCAAGG - Intergenic
958403321 3:93717767-93717789 CTCTTTTTGTAGAATTTCCAAGG - Intergenic
959968753 3:112384813-112384835 CTTTGATGGTGGATTTTTCAGGG - Intergenic
962399205 3:135042624-135042646 CTGAGTTTGTTGAGTTTGCAAGG + Intronic
962738114 3:138343896-138343918 CTCTGCTTTCAGAGTTTTCATGG - Intergenic
962899868 3:139752437-139752459 CTTTGTGTGTGAAGTTTTTAGGG - Intergenic
964107868 3:153058254-153058276 ATCAGTTTGTGAAGTTTTCATGG + Intergenic
964253145 3:154743502-154743524 CTCTGTTTGAGGAGAGATCAAGG - Intergenic
965041009 3:163507035-163507057 CCATGTAGGTGGAGTTTTCATGG + Intergenic
966031934 3:175360256-175360278 CTCTACTTGTTTAGTTTTCAAGG + Intronic
966236541 3:177707593-177707615 CTCTGTTTGCGGTGTTGTCTGGG + Intergenic
970118728 4:12728720-12728742 CTCTATTAGTGGAGCTTTCAAGG - Intergenic
971159403 4:24118395-24118417 ATCTCCTTGTGGAGTTTTCCTGG + Intergenic
971797502 4:31247100-31247122 ATGTGTTTGTGAAGTTTCCAAGG - Intergenic
973038318 4:45436935-45436957 CTCGGTTTGGAGATTTTTCAAGG + Intergenic
975346416 4:73297274-73297296 ATGTGTTTGTGTAGTTTCCAAGG - Intergenic
976549502 4:86378679-86378701 TTCGCTTTGTGGAATTTTCAAGG - Intronic
978417845 4:108496993-108497015 CTATTTTGGTGGAGTTTTTATGG - Intergenic
978899709 4:113932556-113932578 ATGTGTTTGTGCAGTTTCCAAGG - Intronic
979033912 4:115687100-115687122 CTGAGATTGTGGAGTTTTCCAGG + Intergenic
979103007 4:116646418-116646440 GTGTGTTTGTGTAGTTTCCAAGG - Intergenic
980148404 4:129017247-129017269 CTATGTTTGTGAGTTTTTCATGG + Intronic
981454335 4:144936256-144936278 CTCTGTGTGTGGAATCTTTAGGG + Intergenic
983089322 4:163485687-163485709 TCCTGTTTCTGTAGTTTTCAAGG - Intergenic
983522502 4:168724777-168724799 CTCTGTATGTGAAGGTTTCCTGG + Intronic
984376232 4:178933988-178934010 CTGTGTTTCTGTGGTTTTCATGG + Intergenic
984778221 4:183503012-183503034 CTCTGTTTCTGGAGTACTCTAGG + Intergenic
985411559 4:189690934-189690956 CTCTGTTTCTGAAGTTTAAAGGG - Intergenic
986032225 5:3905249-3905271 CTGTGATTGCGGAGTTTTCCAGG - Intergenic
986973655 5:13369368-13369390 CTTTTTTTGTGGAGTTTTTAGGG - Intergenic
987056672 5:14199944-14199966 TTCTCTATGTGGAGTGTTCAAGG + Intronic
988251688 5:28766995-28767017 GTCTATTTGTTGAGTTTTTATGG - Intergenic
988331421 5:29845196-29845218 CTCTATTTATCCAGTTTTCAAGG + Intergenic
989862275 5:46392473-46392495 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
989863908 5:46422113-46422135 CTCTTTTTGTAGAATTTGCAAGG - Intergenic
989864461 5:46431279-46431301 CTCTTTTTGTAGAATTTGCAAGG - Intergenic
989896654 5:47096975-47096997 CTCTTTTTGTTGATTCTTCAAGG - Intergenic
989900729 5:47169332-47169354 CTCTTTTTGTGGAAGTTGCACGG + Intergenic
990223547 5:53623465-53623487 GTTTTTTTGTTGAGTTTTCAGGG + Intronic
991147978 5:63329704-63329726 GTCTTTTGGTGGAGTTTTTAGGG + Intergenic
992540184 5:77756835-77756857 TTCTGTTTGTGGAGTTTCAAGGG - Intronic
993381115 5:87209185-87209207 CTACCTTTGTGGAGCTTTCATGG + Intergenic
993633718 5:90318578-90318600 TTCAGTTTGTGGATTTTTCTTGG + Intergenic
994356795 5:98801782-98801804 CTGTATTTGTTGAGTTTTGAGGG + Intergenic
994887582 5:105584170-105584192 ATGTGTTTGTAGAGTTTTGAGGG - Intergenic
995468963 5:112480075-112480097 CTGTCTTTGAGGAGTTTTCTAGG - Intergenic
995567697 5:113448836-113448858 CTCTATTTGTGGAGCTGTCCTGG - Intronic
995606223 5:113858531-113858553 ATGTGTTTGTGTAGTTTCCAAGG + Intergenic
997113354 5:131099634-131099656 CTATGTTTTCGGAGATTTCAGGG - Intergenic
997197259 5:131988423-131988445 CTCTGCTTGAGGAGGTTCCATGG - Intronic
1000173974 5:158731846-158731868 CTCTTCTTTTGGTGTTTTCAAGG - Intronic
1001667130 5:173442647-173442669 CTCTGGTTGTGTAATTTTAATGG - Intergenic
1202772331 5_GL000208v1_random:20335-20357 CTCTTTTTGTTGATTCTTCAAGG - Intergenic
1003647281 6:7924128-7924150 CTTTGTGTGTGGAGTTCTCAGGG - Intronic
1004863728 6:19833892-19833914 CCTTGTTTGGGGAGTTTTAAAGG - Intergenic
1005184019 6:23143129-23143151 TTCTGTATTTGTAGTTTTCATGG - Intergenic
1006730073 6:36230152-36230174 CTCTGTTTGGAGAGTTGTAAGGG - Intronic
1007099004 6:39231655-39231677 CCCTGTTTGTGAAGAGTTCAGGG + Intergenic
1007235980 6:40391856-40391878 AAGTGTTTGTGGAGTTTCCATGG - Exonic
1008306870 6:49913944-49913966 CTCTGGTTGAGGGGTTGTCACGG - Intergenic
1009065197 6:58452099-58452121 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009065478 6:58556010-58556032 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009065693 6:58559067-58559089 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009065912 6:58562124-58562146 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009066131 6:58565183-58565205 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009066351 6:58568241-58568263 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009066567 6:58571300-58571322 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009066786 6:58574362-58574384 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009067006 6:58577417-58577439 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009067226 6:58580475-58580497 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009067444 6:58583534-58583556 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009067667 6:58586592-58586614 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009067886 6:58589650-58589672 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009068107 6:58592706-58592728 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009068335 6:58595765-58595787 CTCTTTTTGTAGACTTTGCAAGG + Intergenic
1009068553 6:58598822-58598844 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009068774 6:58601879-58601901 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009068991 6:58604917-58604939 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009069210 6:58607974-58607996 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009069428 6:58611031-58611053 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009069647 6:58614089-58614111 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009069867 6:58617146-58617168 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009070084 6:58620202-58620224 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009070302 6:58623252-58623274 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009070519 6:58626309-58626331 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009070734 6:58629369-58629391 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009070949 6:58632406-58632428 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009071172 6:58635463-58635485 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009071387 6:58638521-58638543 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009071606 6:58641578-58641600 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009071827 6:58644635-58644657 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009072043 6:58647693-58647715 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009072259 6:58650750-58650772 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009072478 6:58653807-58653829 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009072696 6:58656864-58656886 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009072918 6:58659921-58659943 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009073134 6:58662978-58663000 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009073355 6:58666036-58666058 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009073575 6:58669095-58669117 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009073797 6:58672147-58672169 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009074016 6:58675205-58675227 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009074236 6:58678262-58678284 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009074458 6:58681319-58681341 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009074678 6:58684376-58684398 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009075113 6:58690490-58690512 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009075335 6:58693546-58693568 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009075554 6:58696603-58696625 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009075768 6:58699660-58699682 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009075987 6:58702717-58702739 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009076205 6:58705774-58705796 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009076639 6:58711889-58711911 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009076862 6:58714947-58714969 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009077082 6:58718006-58718028 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009077304 6:58721063-58721085 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009077520 6:58724119-58724141 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009077740 6:58727176-58727198 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009077959 6:58730233-58730255 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009078176 6:58733290-58733312 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009078403 6:58736347-58736369 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009078622 6:58739407-58739429 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009078839 6:58742444-58742466 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009079061 6:58745503-58745525 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009079281 6:58748560-58748582 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009079502 6:58751618-58751640 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009079721 6:58754677-58754699 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009079902 6:58757226-58757248 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009080118 6:58760284-58760306 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009080562 6:58766400-58766422 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009080783 6:58769457-58769479 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009080999 6:58772494-58772516 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009081221 6:58775552-58775574 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009081438 6:58778608-58778630 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009081656 6:58781665-58781687 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009081873 6:58784723-58784745 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009082091 6:58787782-58787804 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009082311 6:58790840-58790862 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009082532 6:58793897-58793919 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009082971 6:58800012-58800034 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009083190 6:58803072-58803094 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009083406 6:58806129-58806151 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009083625 6:58809166-58809188 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009083844 6:58812223-58812245 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009084067 6:58815279-58815301 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009084290 6:58818337-58818359 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009084508 6:58821395-58821417 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009084730 6:58824452-58824474 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009084953 6:58827512-58827534 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009085173 6:58830568-58830590 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009085394 6:58833625-58833647 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009085611 6:58836683-58836705 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009085826 6:58839721-58839743 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009086042 6:58842778-58842800 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009086265 6:58845835-58845857 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009086484 6:58848893-58848915 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009086702 6:58851951-58851973 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009086922 6:58855008-58855030 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009087142 6:58858065-58858087 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009087360 6:58861104-58861126 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009087581 6:58864161-58864183 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009087798 6:58867218-58867240 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009088017 6:58870276-58870298 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009088238 6:58873335-58873357 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009088458 6:58876392-58876414 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009088675 6:58879449-58879471 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009088897 6:58882508-58882530 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009089114 6:58885545-58885567 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009089330 6:58888582-58888604 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009089550 6:58891640-58891662 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009089768 6:58894697-58894719 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009089988 6:58897755-58897777 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009090210 6:58900814-58900836 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009090430 6:58903872-58903894 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009090651 6:58906929-58906951 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009090870 6:58909987-58910009 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009091088 6:58913043-58913065 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009091307 6:58916100-58916122 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009091522 6:58919157-58919179 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009091742 6:58922214-58922236 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009091961 6:58925270-58925292 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009092179 6:58928308-58928330 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009092398 6:58931365-58931387 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009092618 6:58934423-58934445 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009092840 6:58937480-58937502 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009093061 6:58940538-58940560 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009093279 6:58943595-58943617 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009093496 6:58946652-58946674 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009093712 6:58949710-58949732 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009093929 6:58952767-58952789 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009094148 6:58955824-58955846 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009094365 6:58958881-58958903 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009094583 6:58961939-58961961 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009094805 6:58964996-58965018 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009095026 6:58968054-58968076 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009095243 6:58971112-58971134 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009095460 6:58974167-58974189 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009095681 6:58977224-58977246 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009095899 6:58980283-58980305 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009096117 6:58983340-58983362 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009096338 6:58986399-58986421 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009096559 6:58989456-58989478 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009096780 6:58992513-58992535 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009097004 6:58995571-58995593 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009097225 6:58998626-58998648 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009097444 6:59001683-59001705 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009097667 6:59004739-59004761 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009097888 6:59007795-59007817 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009098107 6:59010852-59010874 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009098328 6:59013908-59013930 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009098545 6:59016965-59016987 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009098760 6:59020002-59020024 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009098982 6:59023056-59023078 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009099203 6:59026113-59026135 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009099427 6:59029167-59029189 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009099647 6:59032224-59032246 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009099866 6:59035281-59035303 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009100087 6:59038336-59038358 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009100306 6:59041394-59041416 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009100525 6:59044453-59044475 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009100748 6:59047510-59047532 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009100969 6:59050567-59050589 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009101406 6:59056682-59056704 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009101625 6:59059740-59059762 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009101847 6:59062799-59062821 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009102067 6:59065856-59065878 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009102286 6:59068914-59068936 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009102501 6:59071971-59071993 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009102722 6:59075028-59075050 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009102943 6:59078085-59078107 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009103156 6:59081120-59081142 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009103382 6:59084177-59084199 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009103606 6:59087235-59087257 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009103827 6:59090293-59090315 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009104047 6:59093351-59093373 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009104270 6:59096408-59096430 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009104491 6:59099465-59099487 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009104714 6:59102522-59102544 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009104935 6:59105579-59105601 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009105332 6:59111183-59111205 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009105549 6:59114240-59114262 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009105767 6:59117297-59117319 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009105985 6:59120356-59120378 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009106202 6:59123411-59123433 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009106422 6:59126470-59126492 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009106644 6:59129520-59129542 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009106862 6:59132577-59132599 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009107083 6:59135635-59135657 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009107303 6:59138693-59138715 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009107524 6:59141752-59141774 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009107742 6:59144789-59144811 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009107968 6:59147846-59147868 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009108188 6:59150905-59150927 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009108407 6:59153963-59153985 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009108625 6:59157022-59157044 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009108845 6:59160079-59160101 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009109063 6:59163136-59163158 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009109282 6:59166194-59166216 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009109505 6:59169251-59169273 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009109719 6:59172307-59172329 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009109936 6:59175364-59175386 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009110376 6:59181477-59181499 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009110594 6:59184533-59184555 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009110814 6:59187588-59187610 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009111031 6:59190625-59190647 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009111249 6:59193684-59193706 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009111466 6:59196743-59196765 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009111686 6:59199800-59199822 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009111904 6:59202857-59202879 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009112124 6:59205914-59205936 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009112347 6:59208972-59208994 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009112566 6:59212029-59212051 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009112780 6:59215066-59215088 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009113004 6:59218121-59218143 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009113224 6:59221178-59221200 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009113441 6:59224237-59224259 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009113657 6:59227289-59227311 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009114096 6:59233406-59233428 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009114312 6:59236463-59236485 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009114535 6:59239523-59239545 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009114757 6:59242579-59242601 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009114975 6:59245636-59245658 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009115191 6:59248694-59248716 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009115411 6:59251752-59251774 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009115630 6:59254812-59254834 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009115851 6:59257870-59257892 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009116075 6:59260928-59260950 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009116299 6:59263985-59264007 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009116520 6:59267043-59267065 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009116685 6:59269251-59269273 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009116907 6:59272310-59272332 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009117126 6:59275367-59275389 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009117347 6:59278424-59278446 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009117565 6:59281482-59281504 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009117782 6:59284539-59284561 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009118000 6:59287597-59287619 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009118219 6:59290654-59290676 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009118485 6:59294347-59294369 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009118706 6:59297398-59297420 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009118924 6:59300454-59300476 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009119147 6:59303511-59303533 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009119366 6:59306548-59306570 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009119585 6:59309606-59309628 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009119803 6:59312664-59312686 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009119979 6:59315212-59315234 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009120199 6:59318269-59318291 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009120420 6:59321324-59321346 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009120639 6:59324382-59324404 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009120857 6:59327439-59327461 CTCTTTTTGTAGAATTTGCAGGG + Intergenic
1009121077 6:59330498-59330520 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009121281 6:59333384-59333406 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009121500 6:59336440-59336462 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009121727 6:59339498-59339520 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009121948 6:59342556-59342578 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009122174 6:59345614-59345636 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009122391 6:59348672-59348694 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009122607 6:59351729-59351751 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009122833 6:59354786-59354808 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009123054 6:59357827-59357849 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009123272 6:59360887-59360909 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009123488 6:59363925-59363947 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009123712 6:59366984-59367006 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009123933 6:59370041-59370063 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009124154 6:59373098-59373120 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009124374 6:59376155-59376177 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009124593 6:59379212-59379234 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009124811 6:59382269-59382291 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009125031 6:59385326-59385348 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009125250 6:59388385-59388407 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009125468 6:59391443-59391465 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009125689 6:59394500-59394522 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009125908 6:59397539-59397561 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009126131 6:59400596-59400618 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009126345 6:59403654-59403676 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009126562 6:59406713-59406735 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009127004 6:59412830-59412852 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009127223 6:59415887-59415909 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009127446 6:59418946-59418968 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009127673 6:59422005-59422027 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009127883 6:59425063-59425085 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009128102 6:59428122-59428144 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009128326 6:59431181-59431203 CTCTTTTTGTAGACTTTGCAAGG + Intergenic
1009128546 6:59434233-59434255 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009128765 6:59437290-59437312 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009128998 6:59440541-59440563 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009129217 6:59443598-59443620 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009129435 6:59446654-59446676 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009129657 6:59449713-59449735 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009129878 6:59452770-59452792 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009130101 6:59455827-59455849 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009130320 6:59458884-59458906 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009130544 6:59461942-59461964 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009130761 6:59464999-59465021 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009130982 6:59468059-59468081 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009131199 6:59471116-59471138 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009131416 6:59474173-59474195 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009131637 6:59477232-59477254 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009131858 6:59480291-59480313 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009132077 6:59483349-59483371 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009132299 6:59486406-59486428 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009132513 6:59489463-59489485 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009132735 6:59492522-59492544 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009132962 6:59495749-59495771 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009133182 6:59498807-59498829 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009133399 6:59501863-59501885 CTCTTTTTGTAGAATTTTCAAGG + Intergenic
1009133621 6:59504920-59504942 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009133839 6:59507978-59508000 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009134062 6:59511035-59511057 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009134284 6:59514093-59514115 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009134503 6:59517151-59517173 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009134727 6:59520210-59520232 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009134999 6:59523959-59523981 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009135218 6:59527018-59527040 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009135435 6:59530078-59530100 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009135655 6:59533136-59533158 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009135873 6:59536193-59536215 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009136098 6:59539250-59539272 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009136313 6:59542311-59542333 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009136532 6:59545370-59545392 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009136969 6:59551482-59551504 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009137187 6:59554540-59554562 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009137405 6:59557597-59557619 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009137622 6:59560654-59560676 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009137850 6:59563712-59563734 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009138295 6:59569829-59569851 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009138510 6:59572869-59572891 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009138731 6:59575927-59575949 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009138880 6:59578139-59578161 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009139108 6:59581196-59581218 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009139330 6:59584254-59584276 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009139553 6:59587312-59587334 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009139773 6:59590371-59590393 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009139994 6:59593431-59593453 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009140215 6:59596487-59596509 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009140432 6:59599546-59599568 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009140656 6:59602605-59602627 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009140871 6:59605663-59605685 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009141094 6:59608718-59608740 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009141312 6:59611777-59611799 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009141530 6:59614832-59614854 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009141752 6:59617888-59617910 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009141974 6:59620945-59620967 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009142190 6:59623982-59624004 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009142410 6:59627040-59627062 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009142632 6:59630078-59630100 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009142854 6:59633138-59633160 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009143074 6:59636194-59636216 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009143293 6:59639231-59639253 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009143522 6:59642288-59642310 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009143740 6:59645344-59645366 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009143962 6:59648404-59648426 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009144183 6:59651461-59651483 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009144408 6:59654517-59654539 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009144626 6:59657575-59657597 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009144844 6:59660634-59660656 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009145063 6:59663671-59663693 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009145286 6:59666728-59666750 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009145502 6:59669785-59669807 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009145720 6:59672842-59672864 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009145939 6:59675895-59675917 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009146163 6:59678952-59678974 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009146384 6:59682012-59682034 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009146605 6:59685069-59685091 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009146822 6:59688126-59688148 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009147039 6:59691183-59691205 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009147252 6:59694240-59694262 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009147478 6:59697298-59697320 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009147702 6:59700355-59700377 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009147923 6:59703412-59703434 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009148144 6:59706468-59706490 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009148364 6:59709524-59709546 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009148586 6:59712581-59712603 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009148804 6:59715639-59715661 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009149020 6:59718689-59718711 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009149238 6:59721746-59721768 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009149455 6:59724809-59724831 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009149671 6:59727866-59727888 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009149890 6:59730923-59730945 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009150110 6:59733975-59733997 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009150329 6:59737031-59737053 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009150546 6:59740089-59740111 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009150765 6:59743147-59743169 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009150982 6:59746205-59746227 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009151205 6:59749265-59749287 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009151425 6:59752322-59752344 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009151648 6:59755380-59755402 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009151867 6:59758438-59758460 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009152087 6:59761495-59761517 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009152306 6:59764551-59764573 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009152527 6:59767608-59767630 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009152743 6:59770664-59770686 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009152962 6:59773721-59773743 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009153402 6:59779835-59779857 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009153626 6:59782893-59782915 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009153848 6:59785952-59785974 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009154298 6:59792069-59792091 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009154525 6:59795126-59795148 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009154744 6:59798183-59798205 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009154964 6:59801241-59801263 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009155181 6:59804282-59804304 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009155400 6:59807339-59807361 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009155619 6:59810397-59810419 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009155838 6:59813454-59813476 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009156056 6:59816511-59816533 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009156290 6:59819829-59819851 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009156506 6:59822886-59822908 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009156720 6:59825942-59825964 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009156943 6:59829000-59829022 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1009248104 6:61264694-61264716 CTTTGTTTATGGATATTTCAGGG + Intergenic
1009253367 6:61340719-61340741 CTCTTTTTGTAGAATTTGCATGG + Intergenic
1009254372 6:61363949-61363971 CTCTTTTTGTGGATTCTACAAGG + Intergenic
1009255222 6:61382831-61382853 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
1009255868 6:61397156-61397178 CTCTTTTTGTAGAATTTCCAAGG + Intergenic
1009258053 6:61442540-61442562 CTCTTTTTGTAGAATTTGCATGG + Intergenic
1009923481 6:70092200-70092222 CCCTGTTTGAGGACTTTTCAGGG + Intronic
1010132481 6:72510613-72510635 ATCAGATTGTGAAGTTTTCATGG + Intergenic
1010611181 6:77955044-77955066 GTTTTTTTGTGGAGTTTTTAGGG - Intergenic
1012326934 6:97931242-97931264 TTCTATTTGTGTAATTTTCATGG - Intergenic
1014145070 6:117988097-117988119 CTGGCTTTGTGGAGTTCTCAAGG - Intronic
1014367112 6:120558010-120558032 ATATGATTGTGTAGTTTTCAGGG - Intergenic
1014819373 6:125969876-125969898 TCCTGTTGGTGGAGTCTTCAGGG + Intronic
1015779430 6:136848972-136848994 GTCTGGTTCTGGAGTTTTCTTGG + Intronic
1016462902 6:144296771-144296793 CTCTTTTTTTGTAGTTTTCAGGG + Intronic
1017848254 6:158278848-158278870 CTCTATTTGGGGAGCTTTCCTGG + Intronic
1020586345 7:10074471-10074493 TTCTTGCTGTGGAGTTTTCAGGG + Intergenic
1021284685 7:18766255-18766277 ATCTGTCTGTGGAGTAATCATGG - Intronic
1022039531 7:26567079-26567101 CTCTGTGCCTGGATTTTTCATGG - Intergenic
1022947025 7:35296236-35296258 TTCTGTTAGTGGAGTTTATAGGG + Intergenic
1024343932 7:48293636-48293658 ATATGTTTGTGGTGTTTTCTGGG + Intronic
1024822237 7:53345800-53345822 CTCTTTTTGTAAAGTTTTCATGG + Intergenic
1025040267 7:55636978-55637000 ATGTGTTTGTGTAGTTTCCAAGG + Intergenic
1025327241 7:58243640-58243662 CTCTTTTTGTGGAGTTTGCAAGG + Intergenic
1025489730 7:61100340-61100362 CTCTCTTTGTAGAATTTACAAGG + Intergenic
1025500298 7:61282620-61282642 CTCTTTTTGTAGAGTTTGCAGGG + Intergenic
1025515154 7:61628844-61628866 CTCTTTTTGTAGAGTTTGCAGGG + Intergenic
1025537156 7:61963634-61963656 CTCTTTTTTTGGAATTTGCAAGG + Intergenic
1025539494 7:62057670-62057692 CTCTTTTTGTAGAGTTTGCAGGG + Intergenic
1025568197 7:62516880-62516902 CTCTTTTTGTAGAATTTCCAAGG + Intergenic
1025568298 7:62518576-62518598 CTCTTTTTGTAGAATTTCCAAGG + Intergenic
1025568474 7:62521977-62521999 CTCTTTTTGTAGAATTTCCAAGG + Intergenic
1025568564 7:62523679-62523701 CTCTTTTTGTAGAATTTCCAAGG + Intergenic
1028726460 7:94093088-94093110 CCCTGTATGTGGGGATTTCATGG - Intergenic
1028839493 7:95412592-95412614 CTCTGTTTTTTGAGTTTTTGTGG - Intronic
1029421323 7:100473148-100473170 CTCTGTTGGGTGGGTTTTCAGGG - Intronic
1029434109 7:100552419-100552441 CTCTGATTATGGAATTGTCAGGG + Intronic
1029510355 7:100990767-100990789 CTGAGTTTGTGGAGCTGTCAAGG - Exonic
1029746155 7:102516840-102516862 CTCGATTTGGGGAGGTTTCAGGG - Intronic
1029764093 7:102615819-102615841 CTCGATTTGGGGAGGTTTCAGGG - Intronic
1030259471 7:107547631-107547653 CTCTTTTGGTGGAGTCTTTAGGG - Intronic
1031838577 7:126708940-126708962 TACTTTTTATGGAGTTTTCAAGG - Intronic
1034465415 7:151225667-151225689 GGCTGTTTAGGGAGTTTTCAGGG + Intronic
1035441562 7:158906014-158906036 CTCTGTTTGTGGAATTTTTGTGG + Exonic
1036075283 8:5492242-5492264 CTGTGTTTGTGAACTTATCATGG - Intergenic
1036115701 8:5958717-5958739 CTCTGTTTTTGGACTTTTCCAGG - Intergenic
1037095780 8:14984923-14984945 CTTTTTTTGTGGATTTTTCTGGG + Intronic
1037233591 8:16689742-16689764 CTCTATTTTTAAAGTTTTCAGGG - Intergenic
1039644667 8:39267658-39267680 CTCTGTTTGGGGTGCTCTCATGG - Intronic
1040274003 8:45992459-45992481 CTCTTTTTGTAGAGTATGCAAGG + Intergenic
1040326544 8:46345752-46345774 CTCTTTTTGTGGAATCTGCAAGG + Intergenic
1040370494 8:46767023-46767045 CTTTGTTTTTGGGGTTGTCAAGG - Intergenic
1040507230 8:48059804-48059826 CTGTGTGAGTGGAGTTTTCCAGG + Intronic
1040720704 8:50318845-50318867 CTCTTTTTGAGGACTTTTCAAGG + Intronic
1044445210 8:92267194-92267216 AGCTGTTTGTGGAGGATTCAAGG + Intergenic
1044943626 8:97369418-97369440 CTCTGTTAGTGGAATTTGCCTGG + Intergenic
1047285932 8:123487245-123487267 CTCTGTTTCTGGAGCTTACATGG + Intergenic
1047738038 8:127783872-127783894 ATCTGCTTGTGGAGTGGTCATGG - Intergenic
1051099917 9:13509155-13509177 GTCTTTTTGTGGCCTTTTCATGG + Intergenic
1053713062 9:40843788-40843810 CTCTTTTTGTAGAATTTTCAAGG + Intergenic
1055256339 9:74376202-74376224 CTCTGTCTCTGGAGTTGTAAAGG + Intergenic
1055675807 9:78659254-78659276 GCCTGTTTGTGGAGTCTTGAGGG + Intergenic
1056231652 9:84552026-84552048 CCCTATTTAGGGAGTTTTCAGGG - Intergenic
1056572700 9:87829705-87829727 CTCAGTTGGTGAAGTTCTCATGG - Intergenic
1057011279 9:91603928-91603950 CTCAGTGTGTGGAGTTTTGACGG + Intronic
1057556350 9:96091248-96091270 CTCTGGAGGTGAAGTTTTCATGG - Intergenic
1058583056 9:106479854-106479876 GTCTGTTTGTGGGGTTATCAGGG - Intergenic
1059137561 9:111821643-111821665 CTCTCTATGTGGAGTGGTCAGGG - Intergenic
1060336752 9:122731129-122731151 CTATGTTTGAGAAGTTCTCATGG - Intergenic
1062246182 9:135567635-135567657 CTGGTTTTGTGGAGTTTTGATGG - Intergenic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1203339160 Un_KI270303v1:1559-1581 CTCTTTTTGTGGAATTTGCAAGG - Intergenic
1203417772 Un_KI270364v1:2669-2691 CTCTGTTTGTAGAATCTGCAAGG - Intergenic
1203420112 Un_KI270376v1:847-869 CTCTTTTTGTAGAGTTTGCAGGG - Intergenic
1203660270 Un_KI270753v1:35085-35107 CTCTGTTTCTGAAGTTTAAAGGG + Intergenic
1203671037 Un_KI270755v1:12048-12070 CTCTGTTTCTGAAGTTTAAAGGG + Intergenic
1186081452 X:5937821-5937843 CTCTGTTTGTACAGACTTCAGGG - Intronic
1186385261 X:9104643-9104665 CTCTTTTTGTGGACTTATCATGG + Intronic
1188642609 X:32524653-32524675 CTCTGTCTGTGAAGATTTTAAGG + Intronic
1189191792 X:39115589-39115611 GTGTGTGTGTGGTGTTTTCATGG + Intergenic
1189851326 X:45178985-45179007 CTTTGTTTGTGTAGTTTTCTTGG - Intronic
1191274832 X:58531241-58531263 CTCTTTTTGTAGAATTTGCAAGG + Intergenic
1191570242 X:62605634-62605656 CTCTTTTTGTAGAGTCTGCAAGG + Intergenic
1191572171 X:62641723-62641745 CTCTTTTTGTAGAATCTTCAAGG + Intergenic
1191572613 X:62649660-62649682 CTCTTTTTGTGGAATCTACAAGG + Intergenic
1192989091 X:76429810-76429832 TTCTGTCTGTGGAGTTTGTATGG + Exonic
1193140862 X:78025158-78025180 CTTTGTTTTTGGTGCTTTCAGGG - Intronic
1193570489 X:83135884-83135906 CTGTCTTTATGGAGTTTTCTGGG - Intergenic
1194110531 X:89827991-89828013 CTCAGATTTTGGAATTTTCATGG - Intergenic
1194979580 X:100426746-100426768 CTGAATTAGTGGAGTTTTCATGG - Intergenic
1197801111 X:130350009-130350031 TTCTATTTGTGGGGTCTTCATGG + Intronic
1198624187 X:138550693-138550715 CTCTGTTTGAGGAATTTTTAAGG - Intergenic
1199111027 X:143934948-143934970 CTCAGGTTTTGGATTTTTCATGG - Intergenic
1199790008 X:151144357-151144379 GTCTTTTGGTGGAGTTTTCTGGG - Intergenic
1200463192 Y:3482731-3482753 CTCAGATTTTGGAATTTTCATGG - Intergenic
1200901837 Y:8440453-8440475 CTCTATTTGTGTAGGGTTCAAGG + Intergenic
1201513576 Y:14792026-14792048 CTCTGTTTGTACAGACTTCAAGG + Intronic