ID: 902847100

View in Genome Browser
Species Human (GRCh38)
Location 1:19120144-19120166
Sequence TTGGTTTGACAGATCTGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902847100_902847110 18 Left 902847100 1:19120144-19120166 CCCTTGCAGATCTGTCAAACCAA 0: 1
1: 0
2: 1
3: 8
4: 166
Right 902847110 1:19120185-19120207 GATGTGCAGTGTCAGACAGTGGG 0: 1
1: 0
2: 0
3: 18
4: 218
902847100_902847109 17 Left 902847100 1:19120144-19120166 CCCTTGCAGATCTGTCAAACCAA 0: 1
1: 0
2: 1
3: 8
4: 166
Right 902847109 1:19120184-19120206 AGATGTGCAGTGTCAGACAGTGG 0: 1
1: 0
2: 1
3: 15
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902847100 Original CRISPR TTGGTTTGACAGATCTGCAA GGG (reversed) Intronic
902847100 1:19120144-19120166 TTGGTTTGACAGATCTGCAAGGG - Intronic
905950557 1:41947080-41947102 TGGGTTTGAAGGATCTTCAAAGG - Intronic
906583600 1:46956457-46956479 TGGGTTTGAAGGATCTTCAAAGG - Intergenic
907505419 1:54914654-54914676 TGGGTTTGAAGGATCTTCAAAGG + Intergenic
915401291 1:155623803-155623825 TGGGTTTGACAGATCTTTAAAGG + Intergenic
917981574 1:180272745-180272767 TCGATTTGACAGAGCTGCACTGG - Intronic
921092565 1:211857554-211857576 TGGGTTTGAAGGATCTTCAAAGG + Intergenic
922455497 1:225770756-225770778 TTGGTTTGTCTGGTCTACAATGG + Intergenic
922684512 1:227628870-227628892 TGGGTTTGAAGGATCTTCAAAGG + Intronic
923606146 1:235444762-235444784 TTGATTTGATGTATCTGCAAAGG - Intronic
924735250 1:246749859-246749881 CTGGTTTGACAAATCTTCACAGG + Intronic
1064571539 10:16698602-16698624 TGGGATTGACAGATCTCCAGGGG - Intronic
1065086236 10:22180305-22180327 TTTGTTTGACAAAGATGCAAAGG + Intergenic
1065199395 10:23298988-23299010 TGGGTTTGAAGGATCTTCAAAGG + Intronic
1071710614 10:88045475-88045497 TTGGTTTGAGGGATGGGCAAAGG + Intergenic
1071978984 10:90984427-90984449 TTGGTGTGACAGGTCTGGAGGGG - Intergenic
1072051937 10:91713444-91713466 TTGGTTTGACTGATTTTTAAAGG - Intergenic
1072377921 10:94836986-94837008 TGGGTTTCAAAGATCTTCAAAGG + Intronic
1078077150 11:8172510-8172532 TTACTTTGGGAGATCTGCAAGGG + Intergenic
1079118145 11:17653713-17653735 TGGGTGTAACTGATCTGCAAAGG - Intergenic
1080846372 11:36030599-36030621 TTGGTTTTGCAGATCTCAAACGG - Intronic
1082306572 11:50584599-50584621 TGTGTTTGAAAAATCTGCAAAGG + Intergenic
1082576638 11:54813862-54813884 CTGTTTTGACAGATCTGCAAAGG - Intergenic
1085601602 11:77860709-77860731 TGGGTTTGAAGGATCTTCAAAGG + Intronic
1086450282 11:86908893-86908915 TTGGTTTGGTAGATCTGGAGTGG - Intronic
1086559387 11:88149674-88149696 ATGGTTTGAAACATCAGCAAAGG - Exonic
1087773820 11:102239692-102239714 CTAGTTTGACAGACCTTCAAAGG - Intergenic
1090071236 11:123546288-123546310 TTGGCTTGACAGAGCTCCCAAGG - Intronic
1090626884 11:128615808-128615830 CTGATTGGACAGAACTGCAAAGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091635827 12:2195818-2195840 TTCGTATGTCAGATCTGGAAAGG + Intronic
1092187881 12:6494281-6494303 TAAGTCTGACAGATCCGCAACGG + Intronic
1092469276 12:8763872-8763894 TGGGTTTGAAGGATCTTCAAAGG + Intronic
1093023010 12:14220344-14220366 TGGGTTTGACGGATCTTTAAAGG - Intergenic
1093835860 12:23827428-23827450 GTTGTTTGACAGTTCTGCAAAGG - Intronic
1097606079 12:61756095-61756117 TTGGTTTCACTCATCTTCAATGG - Intronic
1099410409 12:82319441-82319463 TTGGTTTAACATTTCTGAAAAGG + Intronic
1100267116 12:92988093-92988115 TTGGTTTCAGAGTTCAGCAAGGG + Intergenic
1100567856 12:95815372-95815394 TTGGGTTGAAAGATCTGAAATGG + Intronic
1104658107 12:130589181-130589203 TTGGGTTGACAGCCCTGCCAGGG - Intronic
1106875764 13:34071004-34071026 TTCGTTTGCTAGAGCTGCAATGG + Intergenic
1108876846 13:55058628-55058650 TGGGTTTGAAGGATCTTCAAAGG - Intergenic
1109535141 13:63706876-63706898 TTGGTTTTATAGATTTGCCATGG - Intergenic
1111646475 13:91038150-91038172 TTGGTTCAACAGATCTGGAGTGG - Intergenic
1112079587 13:95954682-95954704 TTGGTTTGGTACATCTGGAAAGG - Intronic
1113032098 13:106005160-106005182 TTGGCTTGAGAGATGTGAAAGGG + Intergenic
1116564232 14:46424899-46424921 TTGATTTTATAGATCTGGAATGG - Intergenic
1116797168 14:49403997-49404019 TCTGTTTGACTGCTCTGCAAAGG + Intergenic
1117566407 14:56998306-56998328 TAGGTTTGACAAATCTTAAAAGG + Intergenic
1117672605 14:58123691-58123713 TGGGTTTGAAGGATCTTCAAAGG - Intronic
1120111647 14:80564376-80564398 TGGGTTTGACAGATCAGGTAAGG + Intronic
1120529464 14:85614646-85614668 GTGGTTTCATAGGTCTGCAAAGG - Intronic
1120737933 14:88076359-88076381 TTGGCTCGAGAGCTCTGCAATGG - Intergenic
1123027191 14:105431515-105431537 TTGGTTGGACAAATTTACAAGGG + Intronic
1131420347 15:92299755-92299777 TGGGTTTGAAGGATCTTCAAAGG - Intergenic
1133512054 16:6469128-6469150 TTCTTTTGACAGAACTCCAATGG - Intronic
1133514104 16:6490847-6490869 GTCTTTTGACAGTTCTGCAATGG - Intronic
1135889708 16:26346167-26346189 TTGGCTTGGCAGAGCTGCCAGGG + Intergenic
1136744445 16:32572481-32572503 TTTTTTTGAAGGATCTGCAAAGG + Intergenic
1138328598 16:56194330-56194352 TTGCATTTACAGATCTGCAAGGG - Intronic
1139875902 16:70145811-70145833 TTGGTTGGGCAGATCTCCACCGG + Intronic
1140359886 16:74335287-74335309 TTGGTTGGGCAGATCTCCACCGG - Intergenic
1141574532 16:84955532-84955554 TTGGTTTGGCAGAGCTCCCAAGG + Intergenic
1203025152 16_KI270728v1_random:502751-502773 TTTTTTTGAAGGATCTGCAAAGG - Intergenic
1203046569 16_KI270728v1_random:831680-831702 TTTTTTTGAAGGATCTGCAAAGG + Intergenic
1144443233 17:15302941-15302963 TTGGTCTGAGAGCTCTGAAATGG - Intergenic
1144637147 17:16917382-16917404 TAGTTTTGACAGATGTGCCAGGG + Intergenic
1146152789 17:30490543-30490565 TTTCTTTGACACATCTGCAGAGG - Intronic
1149968911 17:61196080-61196102 TTGTCTAGATAGATCTGCAAAGG - Intronic
1151299701 17:73215057-73215079 TTGTGTTCACAGACCTGCAAGGG - Intronic
1153374075 18:4356052-4356074 CTGGAGTGACAGATGTGCAATGG - Intronic
1153401720 18:4689600-4689622 TGGGTTTGAAGGATCTTCAAAGG - Intergenic
1153791555 18:8584016-8584038 TGGGATTGACAGGTCTCCAAAGG + Intergenic
1153846486 18:9054045-9054067 GTGGTTTCAGAGATGTGCAATGG + Intergenic
1154361374 18:13664867-13664889 TTGTTTTGACTTATCTGCTAAGG - Exonic
1157904800 18:51560243-51560265 TTGCTTTCACAGACCTTCAAAGG + Intergenic
1158726549 18:59978438-59978460 TGTGTTTGGCAGAGCTGCAAAGG - Intergenic
1159590353 18:70327662-70327684 TTCATTTCACAGTTCTGCAATGG + Exonic
1164738576 19:30560172-30560194 TTCATTTTACAGCTCTGCAAGGG + Intronic
1165680775 19:37772948-37772970 TTTGTTGGACAGAACTTCAAAGG + Intronic
1167115216 19:47485236-47485258 TTAGTGAGACAGATTTGCAAAGG - Intergenic
1167400967 19:49268874-49268896 TTGGTATCACAGAACTACAAAGG - Intergenic
1168321774 19:55514821-55514843 TCCTTTTGACAGCTCTGCAAGGG + Intronic
1168593522 19:57655450-57655472 TTGTTTTGAGAGATATACAATGG - Intergenic
924973964 2:156391-156413 TGGGTTTGAAGGATCTTCAAAGG + Intergenic
927012115 2:18914672-18914694 TTGCTTTTTCAGAGCTGCAAAGG - Intergenic
928677217 2:33661715-33661737 TGGGTTTGAAGGATCTTCAAAGG - Intergenic
930209619 2:48621158-48621180 TTGGTTTCCCAGAGCTGCAGAGG - Exonic
931979597 2:67680232-67680254 TAGGTTTCACAGCTCTGCCATGG - Intergenic
932233630 2:70103267-70103289 TTTGTTTAACAAATCAGCAAAGG - Intergenic
932445987 2:71781988-71782010 TTGGTTTGTCTGTTCTGCCAGGG - Intergenic
933325707 2:80834088-80834110 TTGGTGTAACAGAGCTCCAAAGG + Intergenic
938119773 2:128625319-128625341 TTGGAAGGACAGGTCTGCAAGGG - Intergenic
940348040 2:152647787-152647809 TTGGTTTCTAAGATCTGTAAAGG - Exonic
943503458 2:188722192-188722214 TTGCTTGGATAGATCTGCATGGG - Intergenic
947834839 2:233167690-233167712 TTGGTTGGACAGCTCTGGATAGG - Intronic
1168822733 20:786600-786622 CTGGTTTGGCAGATCTCCACAGG + Intergenic
1177759050 21:25382193-25382215 TTGTTTTGACTTATCTGCCAAGG - Intergenic
1179934613 21:44594146-44594168 GTGGCTTGTCACATCTGCAAGGG - Intronic
949249396 3:1964734-1964756 TTTTTTTCACAGATCTGCATGGG - Intergenic
951936705 3:28030612-28030634 TTGTCTTGACAGCTCTGCAGGGG + Intergenic
953727711 3:45415012-45415034 ATGGTTTGACACATCTGCTGTGG - Intronic
954645902 3:52131392-52131414 TTGGGTTGTCAGAGCTGCAATGG - Intronic
955672413 3:61415737-61415759 TTTGTTCTACAGATCTGCCAAGG + Intergenic
955758287 3:62249506-62249528 TAGGGTTGAGAGATCTGCCAAGG + Intronic
957000109 3:74875259-74875281 TGGGTTTGAAGGATCTTCAAAGG + Intergenic
958016072 3:87941662-87941684 TGGGTTTGAAGGATCTTCAAAGG + Intergenic
958544919 3:95533958-95533980 TTTGTTTGACTGATTAGCAATGG + Intergenic
960539412 3:118847285-118847307 TGGGTTTGAAAGATCTTTAAAGG - Intergenic
961906326 3:130266497-130266519 TGGGTTTGACAGTTCTGATATGG + Intergenic
963657463 3:148075435-148075457 TAGGTTTGAGAAATCTACAAAGG + Intergenic
971196573 4:24475828-24475850 TTGGGGTGACAGAGCTGCCAGGG - Intergenic
971963105 4:33515317-33515339 TTGGTTTGACAGAGCTTTTATGG + Intergenic
974616020 4:64283739-64283761 TTGACTTAACAGATCTGCATTGG - Intronic
975719403 4:77235343-77235365 CTGGTTTGGAAGGTCTGCAATGG + Intronic
976277819 4:83295490-83295512 TGAGTTGGACAGATCTGCAAAGG + Exonic
976901980 4:90189416-90189438 TTGGAATTACAGAGCTGCAAGGG - Intronic
977483925 4:97617544-97617566 TAGGTTTGACAGAGATTCAAGGG + Intronic
980444388 4:132886691-132886713 TGGGTTTGAAGGATCTTCAAAGG - Intergenic
982676746 4:158384667-158384689 TTGGCTTGCAAAATCTGCAAAGG + Intronic
984353547 4:178627436-178627458 TTTTCTTGACAAATCTGCAAAGG + Intergenic
984723919 4:183001954-183001976 TGGGTTTGAAGGATCTTCAAAGG - Intergenic
986886201 5:12239657-12239679 TTCATTTGACAGGTCTCCAAAGG - Intergenic
990874252 5:60466987-60467009 TTATTTTAACAGATCTGCACTGG + Intronic
991080129 5:62589535-62589557 TAGGTTTGACAGATGTTTAATGG - Intronic
992317266 5:75569336-75569358 TAAGGTTGACAGATTTGCAATGG + Exonic
993106573 5:83606926-83606948 TTGTCATGACAGATCTGCCAGGG + Intergenic
994446855 5:99886462-99886484 TTGTTTTGACAAATTTGCTATGG - Intergenic
995465820 5:112448610-112448632 TGGGTTTGAAGGATCTTCAAAGG - Intergenic
996522064 5:124438269-124438291 TTTGTTTGACAGAGATTCAAAGG - Intergenic
998215317 5:140234229-140234251 CTGGTTTGACACATAAGCAAAGG - Intronic
1000342316 5:160287381-160287403 TTGGTTTGAGGGCTCTGCAGAGG - Intronic
1002984093 6:2171053-2171075 TTGGATTGACAGATATTTAAAGG - Intronic
1003324735 6:5083763-5083785 ATGGTTTGGCAGAACTGAAAGGG - Intergenic
1005820476 6:29594417-29594439 TAGGTTTGAAACATCTGTAAGGG - Intronic
1006395486 6:33784414-33784436 TTGGCCTGACAGAACTGGAAAGG + Exonic
1006487572 6:34356341-34356363 TTGGTTTTACAGATATCGAAAGG - Intronic
1008158482 6:48047553-48047575 TTGGTTTAACTGAGCTGCTATGG + Intronic
1013022415 6:106232899-106232921 TGGGTTTGAAGGATCTTCAAAGG - Intronic
1016485611 6:144534935-144534957 GTCGTGTGAGAGATCTGCAAAGG + Intronic
1016658656 6:146549720-146549742 ATGGTTTGAAACCTCTGCAAAGG + Exonic
1017542669 6:155418592-155418614 TTGTTTTGAAAGATCTGGGAGGG - Intronic
1025585010 7:62773054-62773076 TGTGTTTGACAAATCTGCATAGG - Intergenic
1025592001 7:62872730-62872752 CTGTTTTGGAAGATCTGCAAAGG + Intergenic
1028746400 7:94331994-94332016 TTGGTTTGAGATTTCTGCTAAGG + Intergenic
1028777116 7:94690108-94690130 TTGGTTCGACAAAGTTGCAAGGG - Intergenic
1030401902 7:109062259-109062281 TGACTTTCACAGATCTGCAAGGG - Intergenic
1034645171 7:152639848-152639870 TTGATTTGACGGAATTGCAATGG - Intergenic
1035495470 7:159321579-159321601 GTGCTTTGACAGATTTGCACTGG + Intergenic
1037269952 8:17115703-17115725 TTTCTATGACACATCTGCAATGG + Intronic
1038265424 8:26035945-26035967 ATGGTTTGCCTGAGCTGCAAAGG - Intronic
1039908975 8:41809258-41809280 TTTGTTTTACAGATCCTCAAAGG - Intronic
1041540496 8:58979425-58979447 TTGGTTTGAAATATCTGGTAAGG - Intronic
1042939104 8:74089575-74089597 TTTATTTGACAGATGTGTAAAGG + Intergenic
1043490146 8:80740735-80740757 TGGGTTTGAAGGATCTTCAAAGG - Intronic
1044923638 8:97190687-97190709 CTGATTTGACAGAGTTGCAATGG - Intergenic
1047807914 8:128378592-128378614 TGGGTTTGACAGATCTTTAAAGG + Intergenic
1052175528 9:25457941-25457963 TTGTTATGACATGTCTGCAAAGG - Intergenic
1052384699 9:27809088-27809110 TTGTTTTGAGAGGTATGCAATGG + Intergenic
1057836626 9:98450575-98450597 ATGGTTTGGCAGAGCTGGAATGG - Intronic
1203382532 Un_KI270435v1:70714-70736 TTTTTTTGTAAGATCTGCAAAGG + Intergenic
1186175509 X:6921895-6921917 TTGGTTTGACAGATGAGCCCGGG - Intergenic
1186825671 X:13337646-13337668 TTGGTCTGACATATTTTCAATGG - Intergenic
1187207114 X:17193386-17193408 TTGGTTTGAGGGATGTGGAATGG + Intergenic
1187337568 X:18394356-18394378 TTTATTTGACAGCCCTGCAAGGG + Intergenic
1189501114 X:41560073-41560095 ATGGTCTCACAGATCTTCAATGG + Intronic
1191166916 X:57401339-57401361 TGGGTTTGAAGGATCTTCAAAGG + Intronic
1192993698 X:76489625-76489647 TTGTTTTGCCAGCTCTGTAAGGG + Intergenic
1193031717 X:76906289-76906311 TTGGTTTCTCATATCTGCAGTGG - Intergenic
1193306872 X:79960651-79960673 TGGGTTTGAAGGATCTTCAAAGG - Intergenic
1194220996 X:91191323-91191345 TGGGTTTGACAAAGATGCAAAGG + Intergenic
1197496946 X:127195947-127195969 TTGGTTTAATAGTTTTGCAATGG - Intergenic
1199033853 X:143029899-143029921 TTGTTTTGAGAGGTATGCAACGG + Intronic
1199210148 X:145198956-145198978 TTGGTTTGACAGAATTGATACGG - Intergenic
1199214753 X:145251516-145251538 TTGTTTTGAGAGATGTGCAATGG + Intronic
1200557501 Y:4655076-4655098 TGGGTTTGACAAAGATGCAAAGG + Intergenic