ID: 902848703

View in Genome Browser
Species Human (GRCh38)
Location 1:19134816-19134838
Sequence AGGTGCAGGGAAGAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 853
Summary {0: 1, 1: 0, 2: 7, 3: 65, 4: 780}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902848703_902848709 4 Left 902848703 1:19134816-19134838 CCTTCACACTCTTCCCTGCACCT 0: 1
1: 0
2: 7
3: 65
4: 780
Right 902848709 1:19134843-19134865 CCCCGACCCCACTCTAGCCTAGG 0: 1
1: 0
2: 6
3: 42
4: 1331
902848703_902848715 15 Left 902848703 1:19134816-19134838 CCTTCACACTCTTCCCTGCACCT 0: 1
1: 0
2: 7
3: 65
4: 780
Right 902848715 1:19134854-19134876 CTCTAGCCTAGGAGCCTATAAGG 0: 1
1: 0
2: 1
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902848703 Original CRISPR AGGTGCAGGGAAGAGTGTGA AGG (reversed) Intronic
900104067 1:974748-974770 TGGGGCAGGGAAGGGTGGGAGGG + Exonic
900315141 1:2052540-2052562 AGGAGCAGGGAAGAGCCAGAGGG - Intronic
900679270 1:3907408-3907430 AGATGCAGGAAAGAGTGAGTGGG + Intergenic
901145895 1:7064507-7064529 AAGTGCTGGGAGGAGGGTGATGG + Intronic
901451220 1:9338037-9338059 GGGTGCAGGGAAGAGGGAGCAGG + Intronic
901761247 1:11473121-11473143 AGGAGCAGGGCAGAGTGGGGAGG + Intergenic
902078015 1:13802910-13802932 GGCTGCAGGGGAGCGTGTGATGG + Intronic
902120445 1:14160431-14160453 TGCTGCAGGGAGGAGGGTGAGGG + Intergenic
902398096 1:16143258-16143280 AGGTGGATGGAAGAGTGAGTGGG + Intronic
902848703 1:19134816-19134838 AGGTGCAGGGAAGAGTGTGAAGG - Intronic
903651093 1:24922850-24922872 AGGTGCAGGGAATAGAGAAAGGG - Intronic
903885619 1:26539415-26539437 AGAGGCAGGGAAGAGAGTCAGGG + Intronic
903907797 1:26697810-26697832 GGGTGCGGGGCAGAGTGTGCGGG + Intronic
904256870 1:29259849-29259871 CGCTGCAGGGAAGAGAGTGAGGG - Exonic
904433449 1:30479538-30479560 GGGTGGAGGGAAGAGTGGGCTGG - Intergenic
905202956 1:36326156-36326178 GGGTGCAGGGGAGAGTGGCAGGG + Intronic
905271261 1:36789289-36789311 AGCTGCAGGAAGGAGTGTGGGGG + Intergenic
905892859 1:41528108-41528130 AGGTGAGGGTAAGGGTGTGAGGG - Intronic
906659307 1:47571360-47571382 AGGGGCAGGGGAGAGGGTGTGGG - Intergenic
907245905 1:53109077-53109099 AGGCACAGGGCAGAGTGTGTGGG - Intronic
907775840 1:57513835-57513857 AGGGGCTGGGAAGAGAGTGTTGG - Intronic
907887241 1:58604676-58604698 AGGTGAAGGGAAGAATCTTAAGG - Intergenic
908175516 1:61552073-61552095 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
908299061 1:62743886-62743908 ACTTGAGGGGAAGAGTGTGAAGG + Intergenic
908518298 1:64915900-64915922 AGCTGCAGGGAAGAGGGTGAAGG - Intronic
908953962 1:69598471-69598493 AGACTCAGGGAAGAGTGTGTGGG + Intronic
909195297 1:72613390-72613412 AGATACTGGGAAGAGTATGAGGG + Intergenic
909270423 1:73617213-73617235 AAGTGGAGGGAAGAGTGGGAAGG - Intergenic
909271361 1:73627418-73627440 AAGTGGAAGGAAGAGTGAGAAGG + Intergenic
909667651 1:78153764-78153786 AAGCGGAGGGAAGAGTGCGAAGG - Intergenic
909924465 1:81422933-81422955 AGGGGCAGGGAACAGTGTGGAGG - Intronic
910042763 1:82873463-82873485 AGGTGCAGAGAAGAGTAAGGAGG + Intergenic
910107048 1:83642848-83642870 AGGGGCAGGGAGGAGAGGGAGGG + Intergenic
911019913 1:93375713-93375735 AAGAGGAGGGAAGAGTGAGAAGG + Intergenic
911050854 1:93669928-93669950 ACTTGGAGGGAAGAGTGGGAGGG + Intronic
911637266 1:100249197-100249219 AAGTGCAGGGGAGATGGTGATGG + Intronic
912516740 1:110221048-110221070 AGGTACAGTGAGGTGTGTGATGG + Intronic
912991538 1:114492142-114492164 ATGTGTAGGGATGACTGTGAAGG + Intronic
913045604 1:115071148-115071170 AGGCCCAGGGGAGGGTGTGAGGG + Intronic
913087228 1:115450249-115450271 AGGTGAAGGGAAGAGATAGAGGG + Intergenic
913483507 1:119312325-119312347 GGGAGCAGGGAAAAGTGGGAAGG + Intergenic
913670724 1:121095262-121095284 GAGTGGAGGGAAGAGTGGGAGGG - Intronic
913707858 1:121445447-121445469 GGGGGCAGGGAAGAAAGTGATGG - Intergenic
913963706 1:143357726-143357748 AGCTCCAGGGAAGAGGATGATGG - Intergenic
914022487 1:143882687-143882709 GAGTGGAGGGAAGAGTGGGAGGG - Intergenic
914058067 1:144183330-144183352 AGCTCCAGGGAAGAGGATGATGG - Intergenic
914061498 1:144211133-144211155 AGAAGCAGGGAACAGTGTGTAGG + Intergenic
914117652 1:144755236-144755258 AGAAGCAGGGAACAGTGTGTAGG - Intergenic
914121079 1:144783041-144783063 AGCTCCAGGGAAGAGGATGATGG + Intergenic
914442660 1:147720835-147720857 AGGTGAAGGGATTACTGTGAAGG - Intergenic
914660971 1:149790629-149790651 GAGTGGAGGGAAGAGTGGGAGGG - Intronic
915585227 1:156840719-156840741 AGGAGCAGGGAAGGCTGTGGGGG - Exonic
915903044 1:159859997-159860019 AGGTGGAGGGCAGAGTGTCCAGG - Intronic
916369400 1:164073608-164073630 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
916783829 1:168067634-168067656 AGGTGAGGGTAAGATTGTGAAGG + Intronic
916857614 1:168766882-168766904 AGGTGCACAGTAGATTGTGAGGG - Intergenic
917389887 1:174523791-174523813 AGGGGCAGGGAAGAGCGTGATGG - Intronic
917485447 1:175450997-175451019 TGGTGCAAGGCAGACTGTGAAGG + Intronic
917891847 1:179447219-179447241 AGATGCTGGGAAGGGTGTGTGGG - Intronic
918358059 1:183724588-183724610 AGGGGGAGGGAGGAGTATGAGGG + Intronic
918377905 1:183927622-183927644 ACTTGGAAGGAAGAGTGTGATGG - Exonic
918423090 1:184383953-184383975 AGGTGCAGGGAAGTGTGTGTTGG + Intergenic
918844894 1:189595855-189595877 TGGTGCAGGAGAGAGAGTGAAGG - Intergenic
919008530 1:191929628-191929650 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
919012154 1:191978960-191978982 AGAGGCTGGGAAGAGTGTGTGGG - Intergenic
919689355 1:200515425-200515447 AGGAGCAGGCAAGATTGGGAAGG - Intergenic
919802011 1:201359777-201359799 AGGAGCATGGAAGAGTAGGAGGG + Intronic
920053702 1:203178289-203178311 GGGTGGAGGGATGAGTGTTAGGG + Intergenic
920329808 1:205198502-205198524 AGGTGCAAGGAGGAATGTGGGGG - Intronic
920446466 1:206022266-206022288 ATCTGCAAGGAAGAGTGAGAAGG + Exonic
920744975 1:208617575-208617597 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
920842405 1:209565762-209565784 AGGTACAGGAGAGAGTATGAGGG + Intergenic
921181433 1:212634893-212634915 AGGGGCAGGGTAGATTGTGAGGG - Intergenic
921496202 1:215844836-215844858 AGGTGCAGGGGAGGGAGGGAAGG + Intronic
921694511 1:218192112-218192134 AGGTGGGGGGATGAGTTTGAGGG + Intergenic
921738367 1:218654911-218654933 AAGTGAGAGGAAGAGTGTGAGGG + Intergenic
921823176 1:219640857-219640879 AAGTGGAGGGAAGAGTGGGAAGG + Intergenic
921994053 1:221397537-221397559 AAGGGAAGGGAAGAGTGGGAAGG + Intergenic
922388491 1:225113702-225113724 AAGGGAAGGGAAGAGTGAGAAGG - Intronic
923098623 1:230794943-230794965 TGGTGCAGGGGCGAGTGTGCGGG - Intronic
923902092 1:238337079-238337101 AGGGGAAGGGAAGAGAGTGTGGG + Intergenic
923960140 1:239071946-239071968 AAGTGGAGGAAAGAGTATGAAGG + Intergenic
1063303623 10:4876447-4876469 TGCTGCAAGGGAGAGTGTGATGG - Intergenic
1063435555 10:6026945-6026967 AGGTGCTGGGCAGAGTCTAAGGG - Intronic
1063459053 10:6203914-6203936 AGATGCACGGAAGAGAGAGAAGG - Intronic
1063991020 10:11563269-11563291 AAGTGCAGGGAGGTGTGGGAAGG + Intronic
1064510718 10:16087609-16087631 AGGTTCAGGGGAACGTGTGAAGG - Intergenic
1064696738 10:17974985-17975007 AAGGGAAGGGAAGAGTGAGAAGG - Intronic
1065041177 10:21698221-21698243 AGAGGCTGGCAAGAGTGTGAGGG - Intronic
1065431395 10:25660985-25661007 AAGGGGAGGGAAGAGTGAGAAGG - Intergenic
1066084571 10:31963533-31963555 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1067048001 10:42996705-42996727 AGGCGCAGGGAAGCCTGGGAGGG + Intergenic
1067239232 10:44476318-44476340 AGGTGCAAGAAGGAGTTTGAAGG - Intergenic
1067743067 10:48911247-48911269 AGGTGAAGAGAAAAATGTGAAGG + Intronic
1067941414 10:50660047-50660069 AGGTTCAGGGAGGAGTTTGAGGG + Intergenic
1068103889 10:52590678-52590700 AAGGGAAGGGAAGAGTGAGAAGG - Intergenic
1068645518 10:59462478-59462500 ATGTGCATGGCAGAGTCTGAAGG + Intergenic
1068943019 10:62699372-62699394 AGGGGCTGGGAGGAGTGGGAGGG + Intergenic
1069343555 10:67440261-67440283 AAGTGGAGGGAAGAGTGGGAAGG + Intronic
1070195211 10:74150742-74150764 AGGTGTTGGGGTGAGTGTGAGGG - Exonic
1070201231 10:74207964-74207986 AGGTGCAGAGAAGCATGGGAAGG - Intronic
1070677247 10:78420598-78420620 AGGAGTATGGAAGACTGTGAAGG + Intergenic
1070830561 10:79415620-79415642 GGGTGCAGGGAGGAGTGAGGGGG - Intronic
1070862650 10:79685009-79685031 AGGTTCAGAGAGGAGTCTGAGGG + Intergenic
1072256034 10:93621147-93621169 GGGTGCAGGGGAGTGTGTGTGGG - Intronic
1072442379 10:95468424-95468446 AGGGGCTGGGAAGAGGGAGAGGG - Intronic
1072567435 10:96628688-96628710 TGGTGCAAGGAAGAGCCTGAGGG - Intronic
1072568033 10:96634246-96634268 AGGTGCAGGGAGGAGAGAGGGGG + Intronic
1072688485 10:97553702-97553724 AGGTGCAGTGATGACTGAGAAGG + Intronic
1072855732 10:98944088-98944110 AGGTACAGGGAAGATGCTGATGG + Intronic
1072906127 10:99455676-99455698 AGGTCCAGGGAATAGTGTAGCGG + Intergenic
1075203499 10:120426228-120426250 AGGGGCAGGGAAGAGTAAGAAGG - Intergenic
1075380290 10:122013254-122013276 AGGCTAAGGGGAGAGTGTGAAGG + Intronic
1075549446 10:123381419-123381441 TGGTGTAGAGAAGAGTGAGAAGG + Intergenic
1076123322 10:127953646-127953668 GGGTGCAGGCAAGAGAGAGAAGG - Intronic
1076472948 10:130732109-130732131 AGGCACAGGGAAATGTGTGAGGG + Intergenic
1076621708 10:131793118-131793140 AGGTGCAGGGCAGCATGAGAAGG + Intergenic
1076675642 10:132146256-132146278 AGGTGCAGGGAAGGGAGTGCAGG + Intronic
1076834531 10:133014447-133014469 AGGTGCAGTGAAGACTGCGGTGG + Intergenic
1076835517 10:133019250-133019272 AGGTGCCGGAAAGAGTCTCAGGG - Intergenic
1076925595 10:133482642-133482664 AGATGCTGGGAAGAGTGTGGGGG - Intergenic
1077020308 11:414262-414284 GGGTGCAGGGGAGAGGGTGCAGG - Intronic
1077895467 11:6450241-6450263 AGGTGCAGGGAACTGTGGGAAGG - Intronic
1078921275 11:15832911-15832933 ACTTGCGGGGAAGAGTGGGAGGG + Intergenic
1078932214 11:15921303-15921325 AGGTGCCTGGAAGACTCTGAGGG - Intergenic
1079037990 11:17037209-17037231 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1079146622 11:17858033-17858055 TGCTGCAGGGAACAGTGAGAAGG + Intronic
1079272228 11:18999525-18999547 AGGGGGAGGGAAGAGTGGTAAGG - Intergenic
1079318695 11:19431788-19431810 AGGTGCAAGGTAGAGAGTGCTGG + Intronic
1079341778 11:19617621-19617643 AAGTGCATGGTAAAGTGTGAGGG + Intronic
1080842726 11:35999613-35999635 AGCTGAATGGAAGAGCGTGAGGG - Intronic
1081292967 11:41349274-41349296 AGTTGCAGGCAAGTGTGTGCTGG - Intronic
1081529628 11:43949086-43949108 AGGAGCTGGGAAGACTGGGAGGG - Intergenic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1084178729 11:67436335-67436357 AGGTGCAGGGCAGAGCCTGTGGG + Exonic
1084220986 11:67679016-67679038 ACTTGGAGGGAAGAGTGGGAAGG + Intronic
1084634701 11:70383816-70383838 AGAGGCAGGGAAGAGGGTGCAGG - Exonic
1085038229 11:73312163-73312185 TGTTGGAGGGATGAGTGTGATGG + Intronic
1086468128 11:87076256-87076278 AAGGGGAGGGAAGAGTGGGAAGG - Intronic
1087178581 11:95119889-95119911 AAGGGGAGGGAAGAGTGAGAAGG - Intronic
1087402333 11:97683866-97683888 AGGAGGAGGGAGGAGTGGGAAGG - Intergenic
1087520912 11:99234237-99234259 AGAGGCTGGGAAGAGTGTGTTGG + Intronic
1087693241 11:101346269-101346291 AAGGGCAGGAAAGAGTGGGAAGG + Intergenic
1087953153 11:104250911-104250933 AGGAACAGGGAAGAGTGCAAAGG - Intergenic
1088198915 11:107308335-107308357 AGGTTCATGGAAGAAGGTGAAGG - Intergenic
1088724149 11:112619721-112619743 GGCTGGAGGGAAGAGTGTGTAGG - Intergenic
1089189001 11:116640890-116640912 GGGTACAGGGGAGGGTGTGAGGG - Intergenic
1089310050 11:117552029-117552051 AGGTGGGGGACAGAGTGTGATGG + Intronic
1089578806 11:119468684-119468706 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1089657894 11:119965035-119965057 AGGTGCAGGCAAGAGTGAGCAGG - Intergenic
1090352833 11:126118503-126118525 ACTTGCAGGGAAGGGTGGGAAGG + Intergenic
1091010445 11:131996286-131996308 AGGTGCAGGGGAGGGGGTCAGGG - Intronic
1091692407 12:2605990-2606012 AGGTGAAGTGGAGAGGGTGAGGG - Intronic
1091719732 12:2803859-2803881 ACGTGCAGAGAAGAGGCTGAGGG - Exonic
1091827563 12:3524431-3524453 AGGGGCGGGGAAGAGGGGGAAGG - Intronic
1091839294 12:3608035-3608057 AGGTCAAGGGCAGAGTGTCAGGG - Intronic
1091916588 12:4274711-4274733 AGGTGGAGGGAGGAGGGAGAAGG + Intronic
1092761269 12:11813247-11813269 AGGGGCAGGGAAGAAAGGGAAGG - Intronic
1093524891 12:20094167-20094189 TGGCTTAGGGAAGAGTGTGAGGG + Intergenic
1094258629 12:28465132-28465154 AAGGGGAGGGAAGAGTGGGAAGG + Intronic
1094380699 12:29840353-29840375 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1094498646 12:31004940-31004962 AGGTGGAGAGAGGAGTGGGAAGG - Intergenic
1095181659 12:39153778-39153800 AAGCGGAGGGAAGAGTGGGAAGG - Intergenic
1095904243 12:47361144-47361166 TGGGGCAGGGAAGAGGGAGAGGG - Intergenic
1095909293 12:47409545-47409567 TGGGGCATGGAAGAGTGTGGGGG - Intergenic
1096343888 12:50828486-50828508 AAATGGAGGGAAGAGTGGGAAGG - Intergenic
1096417730 12:51428023-51428045 AGGTGCAAGAAAGAGAGTGGAGG - Intronic
1096980516 12:55725965-55725987 AGGGGCAGGGAAGAGACTGATGG - Intronic
1097652641 12:62320301-62320323 AGGAGCAGGAGAGAGTGCGAAGG - Intronic
1098205240 12:68102119-68102141 AGGTGTAGGCAAGATAGTGATGG + Intergenic
1098207855 12:68132321-68132343 AAGAGGAGGGAAGAGTGGGAAGG - Intergenic
1098843784 12:75510665-75510687 AGGTGCACGTAAGGGTTTGAGGG + Intronic
1099770098 12:87041329-87041351 AGGTCAAGGGAAGTGTCTGAAGG + Intergenic
1101226732 12:102694808-102694830 AAGTGTAGGGGAGAGTGGGAAGG + Intergenic
1101634720 12:106529513-106529535 ACGTGGGGGGAAGAGTGGGAGGG - Intronic
1101766806 12:107708547-107708569 AGGGATAGGGAAGAGTGTCAAGG - Intronic
1101935638 12:109053852-109053874 AACTGAAGGGAAGAGTGTCAAGG - Intronic
1102037967 12:109782970-109782992 AGGGGCAGGGGTGAGAGTGAGGG - Intergenic
1102495908 12:113319552-113319574 AGGGGCAGGGAAGGGGGTGGTGG - Intronic
1102516087 12:113447825-113447847 GGCTGCAGGGAAGAGGGTGAGGG + Intergenic
1102637531 12:114337110-114337132 AGGTGCAGGGACCAGTGTGATGG - Intergenic
1103028513 12:117593381-117593403 AGGTGCAGGGCAGGGGGAGATGG + Intronic
1103344161 12:120238235-120238257 AGGTGCAGGGGAGAGGGATAGGG + Intronic
1103958262 12:124591819-124591841 AAGTGCCTGGAAGAGAGTGAGGG - Intergenic
1103995621 12:124828249-124828271 AGGTGCAGGGGAGAGTGCTGTGG - Intronic
1104077273 12:125401093-125401115 AAGGGCAGGGAAGGGGGTGAAGG - Intronic
1104078707 12:125411858-125411880 AGGTGCTGGGAAGGCTGTGCTGG + Intronic
1104856247 12:131903765-131903787 AAGTGCAGGGAAGAGGCTGGAGG + Intronic
1104998533 12:132674205-132674227 AGGTTCCGGGTAGAGTGTGGGGG - Intronic
1105242471 13:18620363-18620385 AGGTGAAGGGAGCAGTCTGAAGG - Intergenic
1105607310 13:21936842-21936864 GTGTGTAGGGAAGAGTGTGTAGG + Intergenic
1106154896 13:27145121-27145143 AGGTTCAGTGAAGAGTGGGATGG - Intronic
1107054613 13:36089569-36089591 AGGTGGAAAGAAGAGAGTGATGG - Intronic
1107062176 13:36171608-36171630 GGGTTCCTGGAAGAGTGTGATGG - Intronic
1107178165 13:37423519-37423541 AAGAGGAGGGAAGAGTGGGAAGG + Intergenic
1107178425 13:37427162-37427184 ACTTGGAGGGAAGAGTGGGAGGG + Intergenic
1107524150 13:41213761-41213783 AAGGGGAGGGAAGAGTGTGAAGG - Intergenic
1107584446 13:41829779-41829801 AGGGGCAGGGAAGCTTGTGGGGG + Intronic
1107807809 13:44171638-44171660 AAGAGGAGGGAAGAGTGGGAAGG - Intergenic
1108105399 13:47003247-47003269 GGGTGCTAGGAAGAGTGGGAAGG - Intergenic
1108494204 13:51008057-51008079 AGGTGGTGGGAAGGGGGTGAGGG - Intergenic
1108760762 13:53560986-53561008 AGTTGCAGGGAGAAGTGGGAGGG - Intergenic
1109225789 13:59693143-59693165 AGGTAGAGGGAACAGCGTGAAGG + Intronic
1109336631 13:61003208-61003230 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1110210070 13:72961302-72961324 AGAAGCAGGGAACAGTGGGATGG - Intronic
1110330056 13:74260981-74261003 ACTTGGAGGCAAGAGTGTGAGGG + Intergenic
1110512880 13:76373748-76373770 AGGAGCAGATAAGAGTGAGAGGG + Intergenic
1110889468 13:80680234-80680256 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1111291999 13:86182991-86183013 AAGAGGAGGGAAGAGTGGGAAGG + Intergenic
1111610695 13:90603223-90603245 AGGTGCAGGGGCCAGGGTGAGGG + Intergenic
1111991609 13:95122627-95122649 AGGTGGATGGAAGAGAGGGAAGG - Intronic
1112296288 13:98190047-98190069 CGGTGCAGGGATGAGGGGGAGGG - Intronic
1112924501 13:104657350-104657372 AGAAGAAGGGAAGAGGGTGAGGG - Intergenic
1112991766 13:105522503-105522525 AGGTGGAAGAAAGAATGTGAAGG - Intergenic
1113198080 13:107832977-107832999 AGCTCCATGGTAGAGTGTGAGGG - Intronic
1113536233 13:111068325-111068347 AAGGGCTGGGAAGTGTGTGAGGG - Intergenic
1113661884 13:112113193-112113215 AGGTGGAGGCAAGGGTGGGAAGG + Intergenic
1113818628 13:113194424-113194446 AGGTGGAGAGAAGAGGGGGATGG - Intronic
1113825719 13:113251651-113251673 GGGAGCAGGGAAGAGAGAGAAGG - Intronic
1114066073 14:19060586-19060608 AGGTGAAGGGAGCAGTCTGAAGG - Intergenic
1114096195 14:19339439-19339461 AGGTGAAGGGAGCAGTCTGAAGG + Intergenic
1114176687 14:20327574-20327596 AAGAGTAGGGAATAGTGTGAAGG - Intronic
1115115346 14:29874827-29874849 AGATGCTGGGAAGGGTATGAGGG + Intronic
1115961476 14:38838643-38838665 AGGTGCAGGGGTGTGTGTGGGGG - Intergenic
1116021578 14:39468605-39468627 AAGTGGAGGGAAGAGCGGGAAGG - Intergenic
1116045797 14:39740785-39740807 AAGAGGAGGGAAGAGTGGGAAGG + Intergenic
1116394134 14:44428429-44428451 ACATTCAGGGAAGAGTATGAGGG - Intergenic
1116434109 14:44877508-44877530 AAGGGGAGGGAAGAGTGAGAAGG + Intergenic
1116489764 14:45492252-45492274 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1116497739 14:45582964-45582986 AAGTGGAGGGAAGAGTGGAAAGG - Intergenic
1116982930 14:51190465-51190487 AGGGGCAGTGAAGACTGGGAAGG - Intergenic
1116996642 14:51331691-51331713 ATGTGCAGTGAAGAGGGTGTGGG + Intergenic
1117264863 14:54076525-54076547 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1117935284 14:60897901-60897923 AGAGGCTGGGAAGGGTGTGAGGG - Intronic
1118080036 14:62348116-62348138 AGGTGTAGTGAGGAATGTGACGG + Intergenic
1118732609 14:68678976-68678998 AGGGGCAGGGAGGAGGGAGAAGG - Intronic
1119478927 14:74947856-74947878 AGGTTCAGGGAAGAGAGAAATGG - Intronic
1119566962 14:75636959-75636981 AGTTGGTAGGAAGAGTGTGAGGG + Intronic
1120543553 14:85781496-85781518 AGCTTCAGGGAAGATTGAGAAGG - Intergenic
1121468340 14:94130064-94130086 ATTTGCAAGGCAGAGTGTGAAGG - Intronic
1121837162 14:97102354-97102376 AGGGGCATGGAAGAGGGTGGGGG + Intergenic
1121994766 14:98593341-98593363 AGGGGCAGGGAGGAGAGGGAAGG - Intergenic
1122010891 14:98746036-98746058 AGGTGCAGGGCACAGGGTGCAGG - Intergenic
1122051019 14:99059990-99060012 AGTTACAGGGAAGACTGGGAAGG - Intergenic
1122199661 14:100114739-100114761 AGGAGCAGGGAGGAGAGAGAGGG - Intronic
1122484133 14:102066555-102066577 AGGGCCAGGGATGAGGGTGAAGG - Intergenic
1123135293 14:106022214-106022236 AGGTGGAGGGCAGTGTCTGAGGG + Intergenic
1123397920 15:19955544-19955566 AGGTGGAGGGCAGTGTCTGAGGG + Intergenic
1123488826 15:20764228-20764250 AGGTGAAGGGAGCAGTCTGAAGG + Intergenic
1123508583 15:20972076-20972098 AGGAAGAGGGAAGAGTGGGAAGG - Intergenic
1123545325 15:21333315-21333337 AGGTGAAGGGAGCAGTCTGAAGG + Intergenic
1123585834 15:21760074-21760096 AGGTGGAGGGCAGTGTCTGAGGG + Intergenic
1123622476 15:22202662-22202684 AGGTGGAGGGCAGTGTCTGAGGG + Intergenic
1124025514 15:25961877-25961899 AGGTGCAAGGGAGAGGGTGTTGG - Intergenic
1124094172 15:26633378-26633400 AGGTACAGGGAAGAGAGAGTGGG - Intronic
1124122072 15:26895990-26896012 GGGTGCAGGGAAGGGTGGAAGGG - Intronic
1125276941 15:38003620-38003642 AAGAGGAGGGAAGAGTGAGAAGG - Intergenic
1125303541 15:38283403-38283425 AGGTATAGGGAATAATGTGAAGG + Intronic
1125334523 15:38614409-38614431 AGGAGTCGGGAAGACTGTGATGG + Intergenic
1125679676 15:41522965-41522987 AGGTGAAGTGGAGAGTCTGAGGG + Intronic
1126145208 15:45467358-45467380 GGGAGCAGGGAAGGGTGGGAGGG - Intergenic
1126221924 15:46223973-46223995 ATGATCAGGGAAGAGTATGAGGG - Intergenic
1126333466 15:47559700-47559722 ATGTGCAGGAAAGACTGGGAAGG + Intronic
1126440607 15:48683915-48683937 AAGTGGAGGGAAGAGTGGGAAGG + Intergenic
1126887778 15:53170353-53170375 TGGTACAGGGAAGATTATGATGG + Intergenic
1127493289 15:59485039-59485061 AAGTGGAGGGAAGAGTGGGAAGG + Intronic
1127971462 15:63965675-63965697 AAGGGGAGGGAAGAGTGGGAAGG - Intronic
1128239936 15:66094941-66094963 AGGTGGGGGGAAAAGTGAGAAGG - Intronic
1128508779 15:68300700-68300722 AGGTCTGGGGAAGGGTGTGAAGG + Intronic
1128981489 15:72190680-72190702 AGGTCCAGGCAAGAGTTGGAGGG + Intronic
1129077341 15:73008271-73008293 AGGAGAAGGGGAGAGGGTGAGGG + Intergenic
1129324357 15:74792310-74792332 AGGAGGAGGAGAGAGTGTGAAGG + Intronic
1129522769 15:76196232-76196254 AGAAGCAGGGAAGAGTGGGCAGG - Intronic
1130151517 15:81315164-81315186 AGGAGCAGGGAGGAGAGAGAAGG - Intronic
1130767586 15:86887683-86887705 AGGTGCATGGAACAATGTCAGGG - Intronic
1131716271 15:95113976-95113998 AAGAGGAGGGAAGAGTGGGAAGG + Intergenic
1131971775 15:97900760-97900782 AGGTGCAGGGTAGAGAGGGTGGG - Intergenic
1202953670 15_KI270727v1_random:60586-60608 AGGTGAAGGGAGCAGTCTGAAGG + Intergenic
1132668227 16:1091407-1091429 AGGGGCTGGGAAGAGGGGGAGGG + Intronic
1133677396 16:8087784-8087806 AGGTGGGGGGAAGAGAGAGAGGG - Intergenic
1134135255 16:11673073-11673095 AGGTGCAGGGGAGAGGGAGGTGG + Intronic
1135967138 16:27045444-27045466 AGAGGCTGGGAAGAGTGTGCAGG - Intergenic
1136054579 16:27678896-27678918 AGGGGCAGGGAGGAGAGAGAAGG + Intronic
1136162690 16:28430893-28430915 AGGTTCAGGGAGGCGTGTGTGGG + Intergenic
1136200276 16:28684095-28684117 AGGTTCAGGGAGGCGTGTGTGGG - Intergenic
1136216624 16:28798288-28798310 AGGTTCAGGGAGGCGTGTGTGGG - Intergenic
1136283874 16:29230196-29230218 AGGTGCAGGGAGGACGGTGCTGG + Intergenic
1136373324 16:29849428-29849450 AGGGGCAGGGCAGAGAGGGAGGG - Intergenic
1136682576 16:31976674-31976696 GGGTGCAGGGAGGAGGGGGAAGG - Intergenic
1136782836 16:32917842-32917864 GGGTGCAGGGAGGAGGGGGAAGG - Intergenic
1136886960 16:33936008-33936030 GGGTGCAGGGAGGAGGGGGAAGG + Intergenic
1137044168 16:35640978-35641000 GGGTGCAGGGCTGAGTGGGAGGG + Intergenic
1137676701 16:50307151-50307173 AGTTGCAGGGAGGGGTGTGGGGG + Intronic
1137997743 16:53237302-53237324 AAGTGCAGGGAAGAAAGTGTGGG - Intronic
1138193755 16:55036920-55036942 TGGAGGAGGGAAGGGTGTGATGG - Intergenic
1138211903 16:55170224-55170246 GGGTTCAGAGGAGAGTGTGATGG + Intergenic
1138815531 16:60199168-60199190 AGGTGCAGGGGTGAGGGTGGAGG + Intergenic
1138844880 16:60553898-60553920 AGGCGGGGGGAAGAGTGGGAAGG - Intergenic
1139103756 16:63801679-63801701 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1139364340 16:66424585-66424607 TGCTGGAGGGAAGAGTCTGAGGG - Intergenic
1139660326 16:68416391-68416413 TTGTGGAGGGAAGAGTGGGACGG - Intronic
1140031839 16:71345247-71345269 AGGTGGAGTGAAGACTGAGAGGG + Intergenic
1140220018 16:73036868-73036890 AGGTGAAGCGAAGAGTCTGAGGG + Intronic
1140716372 16:77728948-77728970 GGGTGCAGGGAGGAGGGTGGAGG - Intronic
1140989180 16:80191770-80191792 AGAGGCAGGGAAGAGGGGGAGGG - Intergenic
1141173246 16:81704236-81704258 AGGGGCAGGGAGGAGAGTAAGGG - Intronic
1141173253 16:81704256-81704278 GGGAGCAGGGAGGAGGGTGAAGG - Intronic
1141173260 16:81704277-81704299 GGGGGCAGGGAGGAGGGTGAGGG - Intronic
1141173285 16:81704338-81704360 GGGGGCAGGGAGGAGGGTGAGGG - Intronic
1141173295 16:81704359-81704381 AGGGGCAGGGAGGAGAGTAAGGG - Intronic
1141173302 16:81704379-81704401 GGGAGCAGGGAGGAGGGTGAAGG - Intronic
1141173309 16:81704400-81704422 GGGGGCAGGGAAGAGGGTGAGGG - Intronic
1141173346 16:81704478-81704500 GGGGGCAGGGAGGAGGGTGAGGG - Intronic
1141173431 16:81704697-81704719 GGGGGCAGGGAGGAGGGTGACGG - Intronic
1141173439 16:81704717-81704739 AGGGGCAGGGAGGAGGGTGAGGG - Intronic
1141580021 16:84991247-84991269 AGAAGCAGGGTAGAGTGTCAAGG - Intronic
1142051920 16:87964686-87964708 AGGTGCAGGTGACAGTGAGACGG + Intronic
1142088906 16:88199706-88199728 AGGTGCAGGGAGGACAGTGCTGG + Intergenic
1142234283 16:88914669-88914691 GGGTGCAGGGCAGAGGGTCAGGG - Intronic
1142268249 16:89075252-89075274 AGCTGCAGGGGAGGGTGTCACGG + Intergenic
1203085484 16_KI270728v1_random:1181826-1181848 GGGTGCAGGGAGGAGGGGGAAGG - Intergenic
1142977822 17:3656094-3656116 AGGGGCAGGGCAGGGGGTGAGGG - Intronic
1143557047 17:7668351-7668373 AGGTGCAGGGGTGAGTGAGGAGG - Intronic
1144176712 17:12714716-12714738 AGGTCATGGGAAGAGAGTGAAGG + Intronic
1144466675 17:15502768-15502790 AGAGGGAGGGAAGAGAGTGACGG - Exonic
1145019440 17:19417973-19417995 AGCTCCAGGGAAGTGTGTGGTGG + Intergenic
1145206836 17:20989006-20989028 AGGAGCAGGGAAGGCTGTGAGGG + Intergenic
1145775157 17:27522572-27522594 AGCTCCAGGGAAAAGTGGGAGGG + Intronic
1146262332 17:31430203-31430225 TGGGGCAGAGAAGAGTGTGGTGG + Intronic
1146494753 17:33311671-33311693 AGGTGCAGGTAGGAGTGGGGTGG + Intronic
1146674505 17:34764060-34764082 AGCAGCAGGGAAGAGAGGGAGGG + Intergenic
1146694369 17:34897573-34897595 AGGTGTAGGGGAAAGTGTGGAGG - Intergenic
1146776926 17:35627719-35627741 AGGTGGAGGCAAGTGTCTGATGG + Exonic
1147365094 17:39953847-39953869 AGGGTCAGGGATGAGGGTGAGGG + Intergenic
1147595269 17:41712628-41712650 CAGGGCTGGGAAGAGTGTGAAGG - Intronic
1148087090 17:45000848-45000870 AGGTGCCAGGCAGAGTGTGATGG - Intergenic
1148225361 17:45895201-45895223 AGGTGCAGGGAGGGGCGTGCAGG - Intronic
1148508841 17:48150798-48150820 AGGTGCAAGGAAGATTATGTGGG + Intronic
1148894672 17:50832870-50832892 ACCCACAGGGAAGAGTGTGAGGG + Intergenic
1148974087 17:51511605-51511627 ACTTGCGGGGAAGAGTGGGAGGG - Intergenic
1149329568 17:55567299-55567321 AGGGGCAGGGAAGAGGGAGGAGG + Intergenic
1149336467 17:55641123-55641145 AGGTGGAGGCAAGAGAGTCAGGG - Intergenic
1150628385 17:66858489-66858511 AGGTGCTGGGGAGAGCGTGGCGG - Intronic
1150947685 17:69765600-69765622 AGGGGGAGGGAAGAGGGGGAAGG - Intergenic
1151631746 17:75315756-75315778 GGGTGGAGGGAAGCGTGTCAGGG + Intergenic
1151801229 17:76381127-76381149 AGCTTCAGGGAAGGGTGAGATGG + Intronic
1152199136 17:78935047-78935069 AGAGGCAAGGCAGAGTGTGATGG - Intergenic
1152764185 17:82127142-82127164 AGGTGCAGAGAAGAGTCTCAGGG + Intronic
1152898782 17:82928368-82928390 AGGTGCAGGGAACTGAGTGATGG - Intronic
1152914064 17:83023779-83023801 AGCTGCAGGGAAGAGCTGGAAGG + Intronic
1153429561 18:5000579-5000601 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1153471420 18:5450471-5450493 GGGTGAGGGGAAGAGTGTGAGGG + Intronic
1154219051 18:12436105-12436127 TGTTGCAGGGAGGAGTGGGAAGG - Intergenic
1154219337 18:12438396-12438418 TGTTGCAGGGAGGAGTGGGAAGG + Intergenic
1155530176 18:26758853-26758875 AGGTACAGGGAACAGCTTGAAGG - Intergenic
1155533859 18:26795268-26795290 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1155782010 18:29849241-29849263 AAGGGGAGGGAAGAGTGGGAGGG - Intergenic
1156367025 18:36438733-36438755 TGGTGCAGAGGAGAGTGAGAGGG - Intronic
1156506685 18:37600272-37600294 GGGTGGGGGGAAGTGTGTGAAGG - Intergenic
1156843939 18:41641328-41641350 AGGTACAGAAAAGAGTGGGAGGG + Intergenic
1156912322 18:42425730-42425752 AAGAGGAGGGAAGAGTGGGAAGG - Intergenic
1156965616 18:43087676-43087698 AGTTTCAGGTAAGAGTCTGAGGG + Intronic
1157366693 18:47071386-47071408 TGGTACGGGGAAGAGTGTCAGGG + Intronic
1157541365 18:48512712-48512734 ACTTGGAGGGAAGAGTGGGAGGG + Intergenic
1158123120 18:54072208-54072230 AGAAGCTGGGAAGAGTGTGTGGG - Intergenic
1158308969 18:56138742-56138764 GAGTGCAGGGATGAGTGGGAAGG + Intergenic
1158820226 18:61150720-61150742 AGGTGCAGAAAGGAGTGAGAGGG + Intergenic
1160040679 18:75342727-75342749 AGGCGAAGGGAAGAGTGGGAGGG - Intergenic
1160448632 18:78946988-78947010 AGGAGGAGGGAAGAGGGGGAGGG + Intergenic
1160879017 19:1311152-1311174 AGGTCCAGGGCAGAGGGAGAGGG + Intergenic
1160992434 19:1865176-1865198 AGGTTCAGCGAAGTGTGGGAGGG + Intergenic
1161374649 19:3933303-3933325 AGGAGGAGGGAAGAGGGTGGGGG + Intronic
1161623403 19:5311371-5311393 AGGTGTTGGGAACAGAGTGACGG - Intronic
1161821467 19:6533346-6533368 AGGTGCTGGGAGGAGTGTCTTGG - Intronic
1162053748 19:8050720-8050742 AGGGGCAGGGCAGAGTGAGTGGG - Intronic
1162187291 19:8915479-8915501 ATGAGCAGGGCAGAGTGTGGAGG + Intronic
1162932722 19:13965434-13965456 GGGTGAAGGTGAGAGTGTGAGGG - Exonic
1163153362 19:15427658-15427680 AGGTGCAGGTAAGGGAGTGGAGG + Intronic
1163251930 19:16131216-16131238 AAGTGCTGGGAAGGGTATGATGG + Intronic
1163567586 19:18060658-18060680 AGGGGTAGGGAAGGGTCTGATGG - Intronic
1163577719 19:18120386-18120408 TGGTACAGGGAAAAGTGTGGGGG + Intronic
1163650750 19:18516305-18516327 TGTCGCAGGGAAGGGTGTGAAGG - Intronic
1164455400 19:28402726-28402748 AGGAGCATGAAACAGTGTGATGG + Intergenic
1164704450 19:30309954-30309976 AGGGGCAGGGACAAGTGGGAAGG + Intronic
1165483583 19:36081635-36081657 AGGGGCAGGAGAGAGTCTGATGG + Intronic
1165645478 19:37431953-37431975 AAGGGGAGGGAAGAGTGGGAAGG + Intronic
1165984109 19:39752300-39752322 AAGAGCAAGGAAGAGTGGGAAGG + Intergenic
1166094677 19:40531237-40531259 ACGTGCAGGGAAGAGTCCAACGG - Intronic
1166342940 19:42149770-42149792 AGGGGCAGGGGAGAGGGTGTTGG - Intronic
1166383545 19:42368410-42368432 GGATGCAGGGAAGAGAGAGATGG - Intronic
1166881591 19:45933650-45933672 AGGTGCAGGGAGGAGGGAGAGGG + Intergenic
1167562616 19:50234884-50234906 AGGGCCAGGGAAGAGTGGGAAGG - Intronic
1168353104 19:55687592-55687614 AGGGGCAGGGAAGAGCAGGAGGG + Intronic
1168472217 19:56648988-56649010 TGGTGCAGGGATGAGGGCGAGGG + Intronic
1202697550 1_KI270712v1_random:135991-136013 AGCTCCAGGGAAGAGGATGATGG - Intergenic
925146760 2:1587511-1587533 AGGGACAGGGAAGAGAGAGAGGG - Intergenic
925343558 2:3153546-3153568 ACTTGCAGGGAAGGGTGGGAGGG + Intergenic
925637680 2:5957307-5957329 TGGAGCAGGAGAGAGTGTGAAGG + Intergenic
925861223 2:8177772-8177794 AGTTGCAGGAAGTAGTGTGAAGG - Intergenic
926195470 2:10761220-10761242 AGGTGGAGGGAAGAGATGGATGG + Intronic
926478404 2:13357177-13357199 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
926944819 2:18175916-18175938 ACTTGGAGGGAAGAGTGAGAGGG + Intronic
927014280 2:18940914-18940936 AGTTGTAGGGGAAAGTGTGATGG - Intergenic
927518986 2:23688036-23688058 ATGCTCAGGGAAGAGGGTGAAGG - Intronic
927570205 2:24152914-24152936 AAGGGGAGGGAAGAGTGGGAAGG - Intronic
927864097 2:26577747-26577769 ACGTGCAGTGCAGAGAGTGATGG + Intronic
928172908 2:29014789-29014811 AGGTGCAGGGAAGACTGCAGAGG + Intronic
928862412 2:35874854-35874876 AAGGGGAGGGAAGAGTGAGAAGG - Intergenic
928932396 2:36637570-36637592 AAGGGGAGGGAAGAGTGGGAAGG + Intronic
928944742 2:36762025-36762047 AGTTGCAGGGAAAAGAGTGTAGG + Intronic
929664101 2:43820499-43820521 AGGTTCAGGGAAGGGGGTGCTGG - Intronic
929722409 2:44383628-44383650 ACTTGCGGGGAAGAGTGGGAGGG - Intronic
929889361 2:45906511-45906533 AAGGGCAGGGAAGAGGGGGACGG + Intronic
929926498 2:46216792-46216814 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
930337901 2:50073206-50073228 AAGTGCAGGGAATAGTCTAAAGG - Intronic
930692008 2:54373831-54373853 AGGTGCAGGGAAGAGATGGGAGG - Intronic
930848706 2:55934631-55934653 AGGTGCAAGGTAGAGGGGGATGG + Intergenic
930944827 2:57061284-57061306 AAGGGGAGGGAAGAGTGAGAAGG - Intergenic
931637324 2:64352208-64352230 AAGGGGAGGGAAGAGTGAGAAGG + Intergenic
931758505 2:65395451-65395473 AGCTGAATGGATGAGTGTGAGGG - Intronic
931985188 2:67734587-67734609 AGGTTCAGGGAAGAGTGAGTTGG - Intergenic
932405828 2:71512142-71512164 CGGTGCAGGGAGTAATGTGAGGG + Intronic
932601400 2:73129053-73129075 AAGAGGAGGGAAGAGTGTGCTGG - Intronic
932720901 2:74138502-74138524 TGGAGCAGGCAAGAGTGAGAGGG + Intronic
933226197 2:79752052-79752074 AGGGGCAGGGGAGAGTGTACGGG + Intronic
934111793 2:88750193-88750215 GGGTGGGGGGAAGAGTGGGAGGG + Exonic
934171832 2:89546510-89546532 AGAAGCAGGGAACAGTGTGTAGG + Intergenic
934278722 2:91592983-91593005 AGCTCCAGGGAAGAGGATGATGG - Intergenic
934282140 2:91620828-91620850 AGAAGCAGGGAACAGTGTGTAGG + Intergenic
934565951 2:95341246-95341268 AGGAGCAAGAAAGAGAGTGAGGG - Intronic
934937026 2:98472949-98472971 AGGTGCAGTGTAGAGTGAGGAGG + Intronic
934937036 2:98473009-98473031 GGGTGCAGTGAAGAGTGTGGAGG + Intronic
934937041 2:98473039-98473061 GGGTGCAGTGAAGAGTGAGGAGG + Intronic
934937057 2:98473129-98473151 GGGTGCAGTGAAGAGTGTGGAGG + Intronic
934937076 2:98473219-98473241 GGGTGCAGTGGAGAGTGTGGAGG + Intronic
934937081 2:98473249-98473271 GGGTGCAGTGTAGAGTGTGGCGG + Intronic
935033952 2:99349944-99349966 AGATGCTGGGAAGAGTAGGAAGG - Intronic
935284372 2:101550936-101550958 GGGTGTAGGGATGTGTGTGATGG + Intergenic
935356546 2:102206966-102206988 AAGGGGAGGGAAGAGTGGGAAGG - Intronic
935955844 2:108375920-108375942 AGGTTCAGGGAAGAATTAGAGGG + Intergenic
936109176 2:109650970-109650992 TGGTGCAGGGCAGAGAGTGGAGG + Intergenic
936516759 2:113185899-113185921 AGGTGCAGGGAAGAGATTCCTGG - Exonic
937058369 2:118959949-118959971 ACTTGGAGGGAAGAGTGGGAGGG + Intronic
937197788 2:120175190-120175212 AGGTGGAGCCAAGAGTTTGAAGG - Exonic
937309241 2:120891977-120891999 AGGTGCAGGGTGGGGTGGGATGG - Intronic
937913401 2:127087292-127087314 AGCTGCAGAGATGAGTGTGGAGG - Intronic
938160372 2:128980082-128980104 AGGAGCAGGGACCACTGTGATGG + Intergenic
938483481 2:131680719-131680741 AGGTGAAGGGAGCAGTCTGAAGG - Intergenic
938564420 2:132505554-132505576 AGGAGCTGGGAAGGGTGTGTGGG - Intronic
938693680 2:133815705-133815727 GGGTGCATGCAAGGGTGTGATGG - Intergenic
938943598 2:136190832-136190854 AGGTGGAGGGAGGAGTGGGGAGG + Intergenic
939405006 2:141745402-141745424 AGGGGGAGGGAAGAGTAGGAAGG - Intronic
939725262 2:145712007-145712029 AGGAGCAGGGAAGAGGGTTGGGG - Intergenic
940503723 2:154527104-154527126 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
940803084 2:158154494-158154516 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
941227718 2:162868967-162868989 AAGGGGAGGGAAGAGTGAGAAGG + Intergenic
941357556 2:164512055-164512077 AAGTGGGGGGAAGAGTGGGAAGG + Intronic
941529771 2:166653296-166653318 AGGTGCTGGGAGGAGTGGGGAGG - Intergenic
941851747 2:170190574-170190596 AAGGGGAGGGAAGAGTGGGAAGG - Intronic
942352390 2:175065850-175065872 ATGGGTAGGGAAGAGTGTGAAGG + Intergenic
943099477 2:183471138-183471160 AAGAGGAGGGAAGAGTGGGAAGG - Intergenic
943118894 2:183709954-183709976 AAGGGAAGGGAAGAGTGGGAAGG - Intergenic
943226729 2:185187750-185187772 AAGTGGAGGGAAGAGTGGGAAGG - Intergenic
944096763 2:195976347-195976369 AAGGGGAGGGAAGAGTGGGAAGG + Intronic
944193273 2:197026195-197026217 CAGTGCAGGGAACAGTGTCAGGG - Intronic
946041506 2:216786675-216786697 AGGTGGAAGGAAGAGTGTTTGGG + Intergenic
947456502 2:230259247-230259269 ACTTGGAGGGAAGAGTGGGAGGG - Intronic
948344371 2:237282770-237282792 AGGTGAGGGGAAGGGTGGGAAGG + Intergenic
948930535 2:241129041-241129063 AGGTACAGGGGAGAGAGAGATGG - Intronic
949060867 2:241956615-241956637 AGTGGCAGGGAAGCCTGTGAGGG + Intergenic
1169204169 20:3730787-3730809 AGGGGCAGGCATGAGTGTGAGGG + Intergenic
1169251151 20:4062411-4062433 AGGTGGAGGAAGGAGGGTGATGG + Intergenic
1169359879 20:4938952-4938974 ATGTGGAGGGCTGAGTGTGATGG + Intronic
1169623483 20:7536216-7536238 ACTTGCAGGGAAAAGTGGGAGGG + Intergenic
1170404222 20:16019537-16019559 AGTTGGAGGGAGGTGTGTGAGGG + Intronic
1170793129 20:19524169-19524191 AGGAGCAGGGAAGTGAGTCAGGG - Intronic
1170882082 20:20305578-20305600 GGCCGCAGGGAAGCGTGTGAGGG - Intronic
1171021256 20:21586409-21586431 AGATGTAGGGAAGCGTCTGAGGG - Intergenic
1171315644 20:24191282-24191304 AAGTGTAGGCAAGAGTGTGAAGG - Intergenic
1171339993 20:24420158-24420180 TGGGCCAGGGAAGAGTGGGACGG + Intergenic
1171438848 20:25145406-25145428 AAGTGCAGGGAAGAGAGAGGAGG + Intergenic
1171964539 20:31519399-31519421 AGGTGCAAGGAAGAGTGTACTGG - Intronic
1172100565 20:32482529-32482551 AGGTGGAGGGAGGAGAGAGAGGG + Intronic
1172190570 20:33059731-33059753 AGGGTCAGGGAAGAGGGTGCAGG + Intronic
1172457842 20:35092156-35092178 AGGGGAAGGAAAGAGTGTCAAGG + Intronic
1173004095 20:39126627-39126649 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1173248512 20:41352278-41352300 GAGGGCAGGGAAGACTGTGAGGG + Intronic
1173424845 20:42933413-42933435 GGGTTCAGGGAAGAGTGAGGTGG - Intronic
1173427925 20:42958627-42958649 AGGTGCAGGGGACAATGTGGAGG - Intronic
1173570842 20:44075098-44075120 AGCTCCAGGGATGAGTGTGAGGG + Intergenic
1173825267 20:46044013-46044035 AGGTGCTGGGACCTGTGTGAGGG + Intronic
1173858058 20:46263711-46263733 AGGGGAAGAGCAGAGTGTGAGGG + Intronic
1174291666 20:49513273-49513295 AGGTGCAAGGAAGAGTCAGCGGG + Intronic
1174917809 20:54671638-54671660 AGATGCAGGGGAGAGTGCTAAGG - Intergenic
1175339930 20:58222218-58222240 AGGGGCAGAGGAGAGTGTGGAGG + Intronic
1175495579 20:59411887-59411909 AGGTGGAGAGATGAGTGTGGGGG - Intergenic
1175657817 20:60787071-60787093 AGGAGGAGGGAAGAGGGTGGTGG - Intergenic
1175676486 20:60950453-60950475 AGGTGGAGGGAATAGATTGATGG + Intergenic
1175712172 20:61230203-61230225 AGGTGCAGGCAGGAGGGAGAAGG + Intergenic
1175912741 20:62412583-62412605 AGGTGCAGGGAAGGGGGCGAGGG - Intronic
1175981652 20:62741660-62741682 AAGTGCAGGGAACAGAGTGGAGG + Intronic
1176449509 21:6850329-6850351 AGGTGAAGGGAGCAGTCTGAAGG - Intergenic
1176827679 21:13715353-13715375 AGGTGAAGGGAGCAGTCTGAAGG - Intergenic
1177487941 21:21783256-21783278 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1177855768 21:26398826-26398848 AGGAGCAAGAAAGAGTGTGGTGG + Intergenic
1177940265 21:27401575-27401597 AGGTGCAGGGAAGTTGGTAAGGG - Intergenic
1178059943 21:28841659-28841681 AGTTGCGGGGAAGAGTGGGAGGG + Intergenic
1178779968 21:35593341-35593363 AAATGCAGGGGAGGGTGTGACGG + Intronic
1178860764 21:36287137-36287159 AGAAGCAGGGGAGAGTGTTAGGG + Intronic
1180036426 21:45252639-45252661 ACCTGCACGGAGGAGTGTGAGGG - Intergenic
1180484553 22:15783178-15783200 AGGTGAAGGGAGCAGTCTGAAGG - Intergenic
1180599993 22:17009330-17009352 GGATGCAAGGAAGAGTGTGTGGG + Intergenic
1180673520 22:17571385-17571407 AGCTGCAGGGAGGAGCGTGCTGG - Intronic
1181008279 22:20024984-20025006 ATGGGCAGGGAAGAGAGGGAAGG - Intronic
1181045169 22:20210901-20210923 GGGTGCAGGCAAGGGTGTGAGGG + Intergenic
1181851229 22:25751388-25751410 AGGGGTAGGGCAGAGTGTGCAGG - Intronic
1182294544 22:29305380-29305402 AGGTGCAGAGAAGACAGGGATGG - Intergenic
1182774313 22:32819564-32819586 AGGTGCTGGGCAGAGTGCTAAGG + Intronic
1182887286 22:33786157-33786179 AGGTGCTGGGAAGACAGGGAAGG + Intronic
1183999709 22:41664171-41664193 AGGGGCGGGTGAGAGTGTGACGG + Intergenic
1184048321 22:41986271-41986293 AGGTTCAGGGAAGAGAGAGCAGG + Intronic
1184330317 22:43823105-43823127 AGGTGCTGTGAGGACTGTGAGGG - Intergenic
1184874259 22:47263147-47263169 AGGTGCAAGGGACAGTGTGCTGG + Intergenic
949576359 3:5342538-5342560 AGGTATAGGGATGTGTGTGAGGG + Intergenic
949887862 3:8710679-8710701 AGCTCCAGAGAAGTGTGTGAAGG + Intronic
949888368 3:8713987-8714009 AGGCGCAAGGAAGACTGAGAGGG + Intronic
949922607 3:9014663-9014685 ATGAGCAGGGAATAGTGTGGAGG + Intronic
949947070 3:9198713-9198735 AGGTGCAAGGAAGAGGTTGCAGG + Intronic
950472297 3:13193776-13193798 AGGTGCAGGCAGGAGGGTGTGGG - Intergenic
950695577 3:14698995-14699017 AGAGGGAGGGAAGAGTGGGAAGG - Intronic
950716444 3:14850823-14850845 AAGTGCAGGGGAGGGTGGGAAGG + Intronic
951032176 3:17895131-17895153 AAGGGGAGGGAAGAGTGGGAAGG - Intronic
951102374 3:18703673-18703695 AAGTGGAGGGAAGAGTGGGAAGG + Intergenic
951284250 3:20790208-20790230 AGGTCCAGAGAAGAGAGTGCTGG + Intergenic
951435402 3:22657108-22657130 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
951460726 3:22948943-22948965 AGGTGAAGGGAAGACTGTGGAGG - Intergenic
951925853 3:27908167-27908189 AGGAGCAAGAACGAGTGTGAGGG + Intergenic
952132660 3:30383453-30383475 AGGTGCAAGAAAGAGTGGGGCGG - Intergenic
953391018 3:42533807-42533829 AGGTCCAGGAAGGAGTGGGAGGG + Intronic
954305001 3:49720999-49721021 GGCTGCAGGGAGGAGAGTGAAGG - Exonic
954421162 3:50419760-50419782 ATGTGCAGGGAGGCGTCTGAGGG - Intronic
954575960 3:51676369-51676391 TGGTCTAGGGAAGAGTGAGATGG + Intronic
955137341 3:56232791-56232813 AGGTGCAGCAAAGAGTGTGGTGG - Intronic
955370387 3:58346297-58346319 AGGTGCAGTGGAAAGGGTGAAGG + Intronic
957536363 3:81509391-81509413 AGGTGCAGGAGAGTGTGTGTAGG - Intronic
957768240 3:84654747-84654769 ATGTGTAAAGAAGAGTGTGAAGG + Intergenic
958141190 3:89564507-89564529 AAAGGGAGGGAAGAGTGTGAAGG + Intergenic
958876745 3:99625124-99625146 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
959115196 3:102169270-102169292 AGGTTCAGGGATGCATGTGAAGG + Intronic
959280382 3:104330080-104330102 ACTTGAGGGGAAGAGTGTGATGG + Intergenic
959474418 3:106791262-106791284 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
959547384 3:107612968-107612990 AAGGGGAGGGAAGAGTGAGAAGG - Intronic
959953057 3:112202969-112202991 AGTTGCAGGGTAGAGTATGGAGG - Intronic
960309103 3:116098600-116098622 AGGTGGGGGAAAGTGTGTGATGG - Intronic
960324299 3:116276516-116276538 ACTTGCAGGGAAGGGTGGGAGGG + Intronic
960404208 3:117239120-117239142 ATGGGAAGGGAAGAGTGGGAGGG + Intergenic
960421959 3:117457538-117457560 AGGTGTTGGGAATAGTGTAAAGG + Intergenic
961001900 3:123379573-123379595 AAGTGCAGGGAGCAGTGGGAAGG + Intronic
961650682 3:128415351-128415373 AGGCCCAGGGAAGAGGGTGGTGG + Intergenic
963179487 3:142338871-142338893 AAGTGAAGGGAAGAGTGGGAAGG + Intronic
964952720 3:162316793-162316815 AAGTGGAGGGAAGACTGGGAAGG - Intergenic
966142005 3:176767372-176767394 AAGAGGAGGGAAGAGTGAGAAGG + Intergenic
966927787 3:184656807-184656829 TGCTGCAGGGAAGACTGGGAAGG - Intronic
966927868 3:184657314-184657336 AGGGGCAGGGATAAGTGGGAGGG - Intronic
967281203 3:187825847-187825869 AGGTGAAGGGTGGAGTGGGAAGG - Intergenic
967377969 3:188826777-188826799 AGGTGCAGAGATGAGAGTGGGGG - Intronic
967696901 3:192543229-192543251 AAAGGGAGGGAAGAGTGTGAAGG - Intronic
967975715 3:195033792-195033814 AGGTTCAGAGAAGAGTGTTTAGG + Intergenic
968004927 3:195236318-195236340 AAGAGGAGGGAAGAGTGGGAAGG - Intronic
968606622 4:1538427-1538449 AGGTGAGGGGAGGAGTGGGAGGG + Intergenic
968792072 4:2672244-2672266 AGGTGCAGTGCAGGGTGTGTGGG - Exonic
969027918 4:4189377-4189399 AGAAGCAGGGAACAGTGTGTAGG - Intronic
969238671 4:5885790-5885812 GGGTGCCAGGAAGAGTGGGAAGG - Intronic
970155998 4:13142315-13142337 AGGAGAAGGGAAGAGGGAGAAGG + Intergenic
970537300 4:17042456-17042478 AGGTGCTGGGAAGAGACTGAGGG - Intergenic
970601828 4:17646861-17646883 ATGTGCAGGGAAGGGGCTGATGG + Intronic
971541882 4:27828505-27828527 AGAGGCTGGGAAGAGTGTGGGGG + Intergenic
972556587 4:40187982-40188004 AAGTGCAAGGAACAGAGTGAGGG + Intergenic
972904517 4:43728438-43728460 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
974327860 4:60438380-60438402 ACTTGCGGGGAAGAGTGAGAGGG + Intergenic
974337541 4:60569810-60569832 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
974630283 4:64479867-64479889 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
974912641 4:68141769-68141791 AGGCTCAGGGACGAGTATGATGG + Intergenic
975375896 4:73645703-73645725 AAGTGGAGGGAAGAGTGGGAAGG - Intergenic
975502211 4:75099743-75099765 AAGTGGAGGGAAGAGTGGGAAGG - Intergenic
975621212 4:76298732-76298754 AGAGGCAGGGAAGGGTGTGTAGG + Intronic
976171659 4:82310939-82310961 AGGGAGAGGGAAGAGTGAGAAGG - Intergenic
976479762 4:85527092-85527114 AGCTCCAGAGAAAAGTGTGATGG + Intronic
976841725 4:89439779-89439801 AGGATCAGGGAAGATTTTGAGGG + Intergenic
977105027 4:92871602-92871624 AGGAGCAGGGAAGAGGGTATAGG + Intronic
977753419 4:100635839-100635861 AAGAGGAGGGAAGAGTGAGAAGG + Intronic
978438426 4:108709960-108709982 AGGTGCAGACAAGAATGAGAAGG + Intergenic
978538052 4:109784026-109784048 ACTTGGAGGGAAGAGTGGGAGGG + Intronic
978617859 4:110613876-110613898 GGGGGCAGGGAAGGGTGGGAGGG + Intergenic
978822455 4:112981110-112981132 AGTTGTAAGGAAGAGTGTGGAGG + Intronic
979573054 4:122252574-122252596 AAGGGGAGGGAAGAGTGGGAAGG + Intronic
979787076 4:124729830-124729852 AGGTGCAGAGAATAGAGTGGAGG - Intergenic
980686896 4:136240608-136240630 AAGGGGAGGGAAGAGTGGGATGG + Intergenic
980723482 4:136727509-136727531 AAATGGAGGGAAGAGTGAGAAGG - Intergenic
981870988 4:149486362-149486384 AACTGGAGGGAAGAGTGGGAAGG - Intergenic
983388975 4:167103511-167103533 AGGGACAGGGAAGAGTGGGAAGG + Intronic
983867827 4:172789565-172789587 ATGTGCAGGGCAAGGTGTGAGGG + Intronic
985097725 4:186429515-186429537 TGGGGCAGGGAGGAGTGTGGAGG - Intronic
985104565 4:186488014-186488036 AGGTGCAGGGGACGGGGTGAGGG - Intronic
985257818 4:188086949-188086971 AGCTACAGGGAAGAGTGAGGTGG - Intergenic
985361333 4:189178871-189178893 ATATGTAGGGAAGAGTGAGAAGG - Intergenic
985561158 5:586711-586733 GGGTGGAGGGCAGCGTGTGAGGG + Intergenic
985952874 5:3236812-3236834 AGGTGCTGGGAAGAGTGACCAGG + Intergenic
985986622 5:3521692-3521714 AGGTGCAGGGAAGAGGGGGCAGG - Intergenic
986319471 5:6616487-6616509 AGGGGCAGGGAAGAGAGAGATGG + Intronic
986324561 5:6662255-6662277 AGGGGCAGGGCAGAGTGAGGGGG - Intronic
986411314 5:7483002-7483024 AGAGGCTGGGAAGGGTGTGAGGG + Intronic
986416837 5:7537486-7537508 AGATGGAGGGGTGAGTGTGATGG - Intronic
987006313 5:13713681-13713703 ACTTGGGGGGAAGAGTGTGAGGG + Intronic
988860871 5:35277009-35277031 CTGTGCAGGACAGAGTGTGATGG - Intergenic
988961944 5:36379266-36379288 AGGCAGAGGGAAGGGTGTGAGGG + Intergenic
989099214 5:37808758-37808780 ACGTGCAGTGAAGGGTGTCATGG - Intergenic
989489349 5:42032454-42032476 AGTGGGAGGGAAGAGTGGGAAGG - Intergenic
989504779 5:42215223-42215245 AAGTGGAGGGAAGAGTGAGAAGG - Intergenic
989970242 5:50515321-50515343 GGGGGCAGGGAAGAAAGTGATGG + Intergenic
990375678 5:55168149-55168171 AGGGGAAGGGAAGAGTGGGAAGG - Intronic
990400802 5:55435733-55435755 TGGGGGAGGGAGGAGTGTGAAGG - Intronic
990461049 5:56031451-56031473 AGAGGCTGGGAAGAGTGTGTGGG + Intergenic
993403378 5:87481006-87481028 AGGTCCAGGGAAAAGTGTGAAGG - Intergenic
993582359 5:89678011-89678033 AAGGGCAGGGAAGAGTAGGAAGG + Intergenic
993766531 5:91865351-91865373 AAGGGCAGGGGAGAGTGGGAAGG + Intergenic
993916777 5:93753764-93753786 AGGGGCAAGGAATAATGTGATGG + Intronic
994530019 5:100957119-100957141 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
994866400 5:105277364-105277386 AGAGGCTGGGAAGAGTGTGTGGG + Intergenic
995770669 5:115665640-115665662 AAGGGAAGGGAAGAGTGGGAAGG + Intergenic
996325903 5:122273060-122273082 ACTTGGAGGGAAGAGTGGGACGG + Intergenic
996962618 5:129269654-129269676 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
997361674 5:133299244-133299266 AGGTGCACACATGAGTGTGAAGG + Intronic
997381213 5:133439841-133439863 AGGTGTGGGGAAGAGGGTGGGGG - Intronic
997725240 5:136114658-136114680 GTGTGCAGGGAAGAGAGGGAGGG - Intergenic
997832714 5:137164839-137164861 AAGGGGAGGGAAGAGTGAGAAGG + Intronic
997998083 5:138602635-138602657 GGGTGGAGGAAAGAGTGTGTCGG + Intergenic
998391949 5:141792835-141792857 AGGTGGACGGCAGACTGTGATGG - Intergenic
998695269 5:144631068-144631090 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
999621521 5:153479635-153479657 GGCTGCAGGGAAGAGTGCGGAGG - Intergenic
999652838 5:153784338-153784360 GGGTGGAGGAAAGAGTCTGAAGG - Intronic
999666751 5:153920662-153920684 AGAGGCAGGGAAGTGTATGATGG - Intergenic
1000345070 5:160307652-160307674 TGGTTCAGGGAAGAGGGTCAAGG + Intronic
1000427509 5:161109658-161109680 AGAGGCAGGGAAGAGTGTGCAGG - Intergenic
1000723794 5:164742446-164742468 GGGAGCAGGGAAGGGAGTGAAGG + Intergenic
1000918669 5:167113073-167113095 AGTTTCAGGTAAGAGTGTGTTGG + Intergenic
1002666139 5:180826691-180826713 AGGAGCAAGGAAGAGTGGAAAGG + Intergenic
1002705681 5:181159905-181159927 AGGTGCAGGGAAGGGGCTCATGG + Intergenic
1003544869 6:7051351-7051373 TGGGGCAGAGGAGAGTGTGAAGG - Intergenic
1004222208 6:13756670-13756692 AGATCCAGGAAAGAGTGTGAGGG - Intergenic
1004479775 6:16007481-16007503 ATATGCACTGAAGAGTGTGATGG - Intergenic
1004847761 6:19664232-19664254 ATGTGCGGGGAACAATGTGATGG - Intergenic
1005048267 6:21662756-21662778 ATTGGCAGGGAAGAGAGTGAAGG + Intergenic
1006104284 6:31707282-31707304 AGGTGGAGAGAAGAGGGTAAGGG - Intronic
1006213253 6:32415354-32415376 GGGTCCTGGGAGGAGTGTGATGG - Intergenic
1006296252 6:33171358-33171380 AGGTGATGGGTAGAGTGGGAAGG + Intronic
1006423605 6:33950359-33950381 GGATGCAGGGAAGGGAGTGAGGG - Intergenic
1006468662 6:34212662-34212684 ATGTGTAGGGAAAAGAGTGAAGG - Intergenic
1006716539 6:36124057-36124079 AGGTGCAGGGGAGTGGGGGAGGG + Intergenic
1007207050 6:40161240-40161262 AGTGGCAGGGAAGTGTGTGATGG - Intergenic
1007261605 6:40567916-40567938 AGGGGCATTGAAGAATGTGATGG - Intronic
1007624243 6:43234089-43234111 TGGTGCAGTGAAGTATGTGAAGG + Intergenic
1007767064 6:44166881-44166903 AGGGGAAGAGAAGAGAGTGAAGG - Intronic
1008150006 6:47938881-47938903 AGGGGCCAGGAAGAGGGTGAGGG + Intronic
1008733384 6:54511328-54511350 AGGTGCAGGGCAGAAAATGAAGG + Intergenic
1008906447 6:56682439-56682461 AGATGTAAGAAAGAGTGTGAGGG - Intronic
1009454202 6:63835573-63835595 ACTTGGAGGGAAGAGTGGGAGGG + Intronic
1010175791 6:73026503-73026525 AGGTGCTGGGAAGAGATGGAAGG - Intronic
1010901020 6:81427524-81427546 AGGTGCTGGAAAGAGTGAGGAGG - Intergenic
1011033259 6:82944885-82944907 AAGGGGAGGGAAGAGTGGGAAGG + Intronic
1011053322 6:83178017-83178039 AGGTACAGGGACTAATGTGATGG - Intronic
1011739447 6:90345424-90345446 AGGTGCAGGGTATTGTGTGGGGG + Intergenic
1012135777 6:95554097-95554119 AGGTGCACAGAATAGGGTGAGGG - Intergenic
1013111593 6:107069134-107069156 AGGTTCCGGGAGGAGTTTGAGGG - Exonic
1014840743 6:126217972-126217994 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1016019081 6:139216857-139216879 ACTTGCAGGGAAGAGTTGGAGGG + Intergenic
1016054586 6:139565985-139566007 TGGGGGAGGGAAGAGTGGGAAGG - Intergenic
1016135273 6:140532832-140532854 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1016251621 6:142049462-142049484 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1016864266 6:148749421-148749443 GGGTGTAGGGAAAAGTGTAATGG + Intronic
1017858780 6:158376102-158376124 AGGTGCAGGGAAAAGGGGGCTGG - Intronic
1017884175 6:158585416-158585438 ATGTGCAGGGGTGAGTGTGTGGG + Exonic
1018177442 6:161189383-161189405 AGGAGCAGGGAAGAGGAGGAAGG + Intronic
1018325448 6:162662949-162662971 AGCTGAAGGGAAAGGTGTGAAGG + Intronic
1018945989 6:168346841-168346863 GGGTGCAGGTGAAAGTGTGAAGG + Intergenic
1019230466 6:170556927-170556949 AGTTGCTGAGAAGAGTGTGCTGG + Exonic
1020283543 7:6663785-6663807 GGGTGAAGGGAAGAGGGAGAGGG + Intergenic
1020506354 7:8993637-8993659 AGGTGCAATGAAGAATGCGATGG - Intergenic
1020812715 7:12865198-12865220 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1020870267 7:13620662-13620684 AGATGCAGAGATGAGTTTGAGGG - Intergenic
1020943774 7:14574794-14574816 AGGTGAGGGTAAGAGAGTGATGG - Intronic
1021641046 7:22736134-22736156 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1022302638 7:29115465-29115487 AGATGGCGGGAAGAGTGGGAGGG - Intronic
1023150545 7:37197695-37197717 GGGTGCAGGCAAGAGAGGGAAGG - Intronic
1023716308 7:43047387-43047409 AAGGGAAGGGAAGAGTGGGAAGG + Intergenic
1024586094 7:50843313-50843335 AGGAGCAGGGCAGGGTGTGTGGG - Intergenic
1024662367 7:51510759-51510781 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1026308806 7:69166214-69166236 AGGGGAAGGGAAGAGGGGGAGGG + Intergenic
1026308815 7:69166233-69166255 AGGGGAAGGGAAGAGGGGGAGGG + Intergenic
1027808305 7:82859025-82859047 AAAGGCAGGGAAGAGTGGGAAGG + Intronic
1029111928 7:98217102-98217124 AGGGGAAGGGAAGGGTGGGAGGG + Exonic
1029382102 7:100221094-100221116 ACGTGCAGGGATGGGTGTGGAGG - Exonic
1030408264 7:109142869-109142891 AAGTGGAAGGAAGAGTGAGAAGG - Intergenic
1030598936 7:111570992-111571014 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1031023081 7:116649655-116649677 AGGGGCAGGGAGGAGTATGTTGG - Intergenic
1032216879 7:129964332-129964354 AGGTGCAGGGATGCATGTGCAGG + Intergenic
1032625107 7:133583477-133583499 AGGTGCAGGCAAGATTTTGCAGG + Intronic
1032889152 7:136175301-136175323 GGGTTCAGGGAAGTGTTTGAAGG + Intergenic
1033435410 7:141329247-141329269 AGGGGGTGGGAAGAGTTTGAGGG - Intronic
1033797437 7:144863894-144863916 AGAGGCTGGGAAGAGTGTGGGGG - Intergenic
1034062830 7:148108694-148108716 AGGTGCAGGGAATGGGGAGATGG + Intronic
1034100125 7:148443829-148443851 AGTTCAAGGGAAGAGTGGGAAGG - Intergenic
1034356529 7:150454527-150454549 GGGTGCAGGCAAGGGTGTGCTGG + Intronic
1034854438 7:154528859-154528881 AGGTGCAGGGAGCAGTGTGAGGG + Intronic
1035121361 7:156570617-156570639 ACTTGCAGGGAAGAGTGGGGGGG + Intergenic
1035139152 7:156739216-156739238 AGGAGCAGGGAAGAATAGGAAGG + Intronic
1035428530 7:158799307-158799329 GGGTGCAGAGAAGACTCTGATGG - Intronic
1035442743 7:158917332-158917354 AGGTGGAGGGTGGAGTGTGGAGG - Intronic
1035442769 7:158917458-158917480 AGGTGGAGGGTGGAGTGTGGAGG - Intronic
1035442798 7:158917584-158917606 AGGTGGAGGGTGGAGTGTGGAGG - Intronic
1035442819 7:158917668-158917690 AGGTGGAGGGTGGAGTGTGGAGG - Intronic
1035550863 8:523719-523741 AAGGGGAGGGAAGAGTGGGAAGG + Intronic
1035905371 8:3503845-3503867 AGGGGCTAGGAAGAGTGTGGGGG - Intronic
1036936257 8:13004858-13004880 AAGGGGAGGGAAGAGTGGGAAGG + Intronic
1037016808 8:13917899-13917921 AGCTGCTGGGGAGAATGTGATGG - Intergenic
1037034183 8:14144902-14144924 AAGGGAAGGGAAGAGTGGGAAGG + Intronic
1037834212 8:22206833-22206855 GGCTGCAGGGAAGCGAGTGACGG - Exonic
1038214032 8:25545363-25545385 AGGAGCAAGAAAGAGAGTGAGGG + Intergenic
1039562434 8:38523403-38523425 AAGTGCAGGGATGACTGTCATGG - Intronic
1039886861 8:41659715-41659737 AGGCACAGGGACAAGTGTGAGGG - Intronic
1040020715 8:42738407-42738429 AGGTGAAGGGAAAAAGGTGAAGG - Intergenic
1041042187 8:53858650-53858672 AGAGGCAGGGAAGAGTGAAAAGG + Intronic
1041606981 8:59793133-59793155 AGGAGGTGGGAAGAGTGGGAAGG + Intergenic
1042718151 8:71798008-71798030 TGGTCCAGGCAAGACTGTGAGGG - Intergenic
1042898436 8:73695791-73695813 AAGGGGAGGGAAGAGTGGGAGGG + Intronic
1042985946 8:74583055-74583077 AAGTGCAGGGAAGAAGCTGATGG + Intergenic
1043042120 8:75276339-75276361 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1043080144 8:75755903-75755925 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1043739853 8:83797348-83797370 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1044115167 8:88327060-88327082 ATGTGGAGGTAAGAGTGCGAGGG - Exonic
1044380853 8:91531568-91531590 GGGTGGAGGAAAGAGTGTGCAGG + Intergenic
1044524367 8:93235108-93235130 AGGTGCAGTGAAGAATATAATGG + Intergenic
1044902024 8:96956974-96956996 AGCTGCAGGACAGAGTGTCAAGG - Intronic
1044942772 8:97360355-97360377 AGGTACAGGGATGAGAATGAAGG - Intergenic
1045172470 8:99686578-99686600 AAGTGGAGGGAGGAGTGGGAAGG - Intronic
1045932962 8:107648175-107648197 ATGTGCAGGGGAGAGTGCAAAGG + Intergenic
1046181609 8:110656170-110656192 AGGAGCAGGGGAGATTGTGTTGG - Intergenic
1046211290 8:111080614-111080636 ATGGGGAGGGAAGAGTGAGAAGG - Intergenic
1046239939 8:111477177-111477199 AGGTCCAGGGCAGAAAGTGAAGG - Intergenic
1046782329 8:118229126-118229148 ACTTGAAGGGAAGAGTGGGAGGG + Intronic
1047603012 8:126446003-126446025 AAGTGGAGGGAACAGTGAGAAGG - Intergenic
1047771404 8:128032968-128032990 AGGTGCATGGTGGAGGGTGAGGG + Intergenic
1047933002 8:129749407-129749429 AAGTTCAGGGAAGAGGGTGAGGG - Intronic
1047937928 8:129800093-129800115 AAGAGAAGGGAAGAGTGGGAAGG - Intergenic
1048029825 8:130620975-130620997 AGAGGGAGGGAAGAGTGGGAAGG - Intergenic
1048038065 8:130696372-130696394 AGGTGCAAGGGAGAGAGTCAGGG - Intergenic
1048384358 8:133897824-133897846 AGGGGCAGAGAAGACTGTGGAGG - Intergenic
1048398485 8:134038915-134038937 AGATGCTGGGAAGATTGTGGAGG - Intergenic
1048919132 8:139211828-139211850 AGGTCCAGGGAAGAGTGGGAAGG + Intergenic
1048972380 8:139652488-139652510 AGGTGCAAGGCAGAGAGGGAAGG - Intronic
1049301513 8:141872958-141872980 ATGTGCAGGTGAGGGTGTGATGG + Intergenic
1050045851 9:1544537-1544559 AGGTGGATGGAAGAAGGTGAAGG - Intergenic
1050508284 9:6369500-6369522 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1050807097 9:9694692-9694714 AAGTGAAGGGAAGAGTGGGAAGG - Intronic
1050865133 9:10488680-10488702 AAGGGGAGGGAAGAGTGGGAAGG - Intronic
1050999228 9:12259621-12259643 ACTTGTAGGGAAGAGTGGGAAGG + Intergenic
1051245942 9:15111020-15111042 AGGAGCTGCAAAGAGTGTGAAGG - Intergenic
1051465117 9:17368268-17368290 AAGGGAAGGGAAGAGTGGGAAGG + Intronic
1051875602 9:21790217-21790239 AGGTGAAGGGAAGAGAGGGGAGG + Intergenic
1051916799 9:22217869-22217891 AAGGGGAGGGAAGAGTGAGAAGG + Intergenic
1052214580 9:25950936-25950958 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1052385325 9:27816367-27816389 AGAGGCAGGGAAGAGTGTGTTGG + Intergenic
1052728815 9:32261867-32261889 AGGAGTAGGGATGCGTGTGAAGG - Intergenic
1052966364 9:34343508-34343530 AGGTCCAGGGAAGGTTGTGCTGG + Exonic
1054977464 9:71164547-71164569 AGGGTAAGAGAAGAGTGTGAGGG + Intronic
1055467754 9:76582382-76582404 GGCTGCAGTGAAGGGTGTGATGG + Intergenic
1055641137 9:78319879-78319901 AGGTCCGTGGAAGTGTGTGAGGG + Intronic
1055940807 9:81647662-81647684 ATGTTCAGGGAAGGGTGGGAAGG + Intronic
1056424635 9:86464693-86464715 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1057226490 9:93295972-93295994 AGGTGAAGGGAGGATGGTGAGGG - Intronic
1057601725 9:96464051-96464073 CGGTGCAGGGAGGAGTGGGTGGG + Intronic
1058241658 9:102569674-102569696 AAGAGGAGGGAAGAGTGGGAAGG + Intergenic
1058373331 9:104295002-104295024 AGGTTCAGGCAAGGGTGTGATGG + Intergenic
1058389050 9:104473488-104473510 AGGAGGAGGGGGGAGTGTGATGG - Intergenic
1058524160 9:105840417-105840439 TGGTGCATGAAAGAGTGTGCTGG + Intergenic
1058779570 9:108319324-108319346 TAGTGCAGGGAAAGGTGTGAGGG + Intergenic
1060793536 9:126500743-126500765 AGGTGCAGAGGAGAGTGCCACGG - Intronic
1060952481 9:127612752-127612774 GGGTGAAGGGAAGAGAGGGAGGG - Intronic
1061215253 9:129218017-129218039 AGAGGCAGGGAAGCGTGTGCAGG - Intergenic
1061429085 9:130519827-130519849 AGGTGCCAGGAAGACTGGGATGG - Intergenic
1061496418 9:130977435-130977457 AATTGCAGGGAAGAGTGTTCCGG + Intergenic
1061638351 9:131929686-131929708 AAGGGGAGGGAAGAGTGGGAAGG + Intronic
1062467943 9:136689475-136689497 AGGTGCAGAGAAGAGGGAGGAGG - Intergenic
1062564079 9:137156257-137156279 AGGTGGAGGGAAGGGCGTGCTGG + Intronic
1062610032 9:137369468-137369490 AGGTGCAGGGAAGTGGAGGATGG + Intronic
1203519678 Un_GL000213v1:34188-34210 AGGTGAAGGGAGCAGTCTGAAGG + Intergenic
1185492310 X:526957-526979 AGGTGCAGGAAGGAGAGCGATGG + Intergenic
1186034224 X:5403390-5403412 AGGGTCAAGGAAGAGTGTCAGGG + Intergenic
1186656717 X:11619931-11619953 AGGGACAGTGAAGACTGTGAGGG - Intronic
1187459829 X:19477242-19477264 AGGTGCAGAGAAAAGTTTTATGG + Intronic
1187770234 X:22687501-22687523 AGATGCAGGGATGAGGGTGGCGG - Intergenic
1188210684 X:27419727-27419749 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1188264908 X:28061166-28061188 AGAGGCTGGGAAGGGTGTGAGGG - Intergenic
1188736097 X:33718179-33718201 TGGTAGGGGGAAGAGTGTGAAGG - Intergenic
1189239178 X:39512504-39512526 AGGGGCAGGGAGGTGTGGGATGG - Intergenic
1189313455 X:40036238-40036260 AGGGGCAGGGGAGAGGGTGGAGG - Intergenic
1189411825 X:40779526-40779548 AAGTGGAGGGAAGAGTGGGAAGG - Intergenic
1189628233 X:42921824-42921846 AAGGGAAGGGAAGAGTGGGAAGG + Intergenic
1189690507 X:43612843-43612865 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1189932217 X:46025102-46025124 ACTTGCAGGGAAGAATGGGAGGG + Intergenic
1190015183 X:46820285-46820307 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1190374280 X:49774355-49774377 AGGAGGAGGGAAGAGTGGGAAGG - Intergenic
1190523067 X:51299468-51299490 AAGGGGAGGGAAGAGTGGGAAGG + Intergenic
1190614647 X:52217717-52217739 AAGAGGAGGGAAGAGTGAGAAGG + Intergenic
1191030625 X:55966057-55966079 AGAAGGAGGCAAGAGTGTGAAGG + Intergenic
1191777971 X:64838423-64838445 ACTTGCGGGGAAGAGTGGGAGGG - Intergenic
1192374082 X:70541340-70541362 AGTGGGAGAGAAGAGTGTGAGGG + Intronic
1192380860 X:70614429-70614451 AGTGGGAGGGAAGAGTGGGAAGG + Intronic
1192393466 X:70754367-70754389 AGGGGGAGGGAAGAGTGGGAGGG + Intronic
1192403204 X:70858047-70858069 ATTTGGAGGGAAGAGTGGGAGGG + Intronic
1192505588 X:71680242-71680264 ACGGGCACGGAAGAGTGGGAAGG - Intergenic
1193169113 X:78315679-78315701 ATGGGGAGGGAAGAGTGGGAAGG + Intronic
1193193355 X:78600262-78600284 ACTTGGAGGGAAGAGTGGGAGGG + Intergenic
1193683673 X:84552413-84552435 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1193762342 X:85482989-85483011 GGGCTGAGGGAAGAGTGTGATGG - Intergenic
1193869306 X:86777377-86777399 ATGTGCAGGGACAAGTGTGAAGG - Intronic
1194196658 X:90903011-90903033 AAGTGGAGGAAAGAGTGAGAAGG - Intergenic
1194218856 X:91167251-91167273 AAGTGGAGGGAAGATTGCGAAGG - Intergenic
1194530779 X:95045621-95045643 AAGGGAAGGGAAGAGTGGGAAGG + Intergenic
1194542988 X:95197918-95197940 ACTTGCAGGGAAGAGTGGAAGGG - Intergenic
1194623669 X:96202613-96202635 AAGGGAAGGGAAGAGTGGGAAGG + Intergenic
1194788780 X:98119323-98119345 AGGGGGAAGGAAGAGTGGGAAGG + Intergenic
1196399491 X:115299515-115299537 AAGGGAAGGGAAGAGTGGGAAGG - Intronic
1196552569 X:117046091-117046113 AAGGGGAGGGAAGAGTGAGAAGG + Intergenic
1197363157 X:125532451-125532473 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1197438031 X:126456366-126456388 AAGAGGAGGGAAGAGTGGGAAGG + Intergenic
1197746934 X:129937877-129937899 AGCTGCAGGGCACAGTGAGAAGG - Intergenic
1198199326 X:134399504-134399526 AGGGGCAGGGAATAGTTAGAAGG + Intronic
1198430748 X:136564443-136564465 AAGGGGAGGGAAGAGTGGGAAGG - Intergenic
1198506649 X:137308005-137308027 AGGTGAAAGGAAGAGTGAAAAGG + Intergenic
1198818013 X:140614066-140614088 AAGAGGAGGGAAGAGTGGGAAGG - Intergenic
1198927399 X:141814578-141814600 AAGGGGAGGGAAGAGTGAGAAGG - Intergenic
1200144233 X:153918214-153918236 AGATGCAGGGAAGCGTGTGGTGG + Intronic
1200373241 X:155750280-155750302 GGGGGAAGGGAAGAGTGTAAGGG + Intergenic
1200555364 Y:4631005-4631027 AAGTGGAGGGAAGATTGCGAAGG - Intergenic
1201182316 Y:11360514-11360536 AAGTGCAGGAAAAAGTGTTAAGG + Intergenic
1201638137 Y:16148311-16148333 AGGATCAAGGAAGAGTGTCATGG - Intergenic
1201641018 Y:16177054-16177076 AACTACAGGGAAGAGTGTGTAGG + Intergenic
1201661797 Y:16408272-16408294 AACTACAGGGAAGAGTGTGTAGG - Intergenic
1202174618 Y:22085868-22085890 AGGGACAGGGAAGTGTGTGGAGG + Intronic
1202216744 Y:22500514-22500536 AGGGACAGGGAAGTGTGTGGAGG - Intronic
1202326443 Y:23695556-23695578 AGGGACAGGGAAGTGTGTGGAGG + Intergenic
1202544327 Y:25974498-25974520 AGGGACAGGGAAGTGTGTGGAGG - Intergenic