ID: 902851038

View in Genome Browser
Species Human (GRCh38)
Location 1:19156953-19156975
Sequence TCTCTGAGAGGACCAGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902851038_902851042 12 Left 902851038 1:19156953-19156975 CCTACTCCTGGTCCTCTCAGAGA 0: 1
1: 0
2: 0
3: 19
4: 296
Right 902851042 1:19156988-19157010 TAACAAAAACTCTTTCAATAGGG 0: 1
1: 0
2: 2
3: 39
4: 412
902851038_902851041 11 Left 902851038 1:19156953-19156975 CCTACTCCTGGTCCTCTCAGAGA 0: 1
1: 0
2: 0
3: 19
4: 296
Right 902851041 1:19156987-19157009 GTAACAAAAACTCTTTCAATAGG 0: 1
1: 0
2: 1
3: 18
4: 224
902851038_902851043 20 Left 902851038 1:19156953-19156975 CCTACTCCTGGTCCTCTCAGAGA 0: 1
1: 0
2: 0
3: 19
4: 296
Right 902851043 1:19156996-19157018 ACTCTTTCAATAGGGATAACAGG 0: 1
1: 0
2: 1
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902851038 Original CRISPR TCTCTGAGAGGACCAGGAGT AGG (reversed) Intronic
901374314 1:8826601-8826623 ACTCTGGGAGGCCGAGGAGTGGG + Intergenic
902168490 1:14592032-14592054 TGAGTGAGAGGACCAGGAGCAGG - Intergenic
902851038 1:19156953-19156975 TCTCTGAGAGGACCAGGAGTAGG - Intronic
903795953 1:25929074-25929096 TCTCTGTGAGCACCTGGTGTTGG - Intergenic
904696132 1:32332557-32332579 TCACTGGGAGGACCAGGGATGGG + Intronic
905732773 1:40307816-40307838 TGTCTCAGAGGAACAGGGGTGGG - Intronic
906126200 1:43428392-43428414 GGGCTGAGAGGACCAGGACTTGG - Exonic
906687669 1:47772781-47772803 TCCCTGAGAGGCCCAGGTGCAGG - Intronic
907400823 1:54223728-54223750 TCACTGAGAGGTGCCGGAGTCGG - Intronic
908544820 1:65151943-65151965 TCTCTTAGATTGCCAGGAGTTGG + Intronic
908595814 1:65687859-65687881 TCTCTGAGATGACCAGCAGGTGG - Intergenic
909412182 1:75367535-75367557 TGGCTCAGAGGACCTGGAGTTGG + Intronic
910629577 1:89341449-89341471 TCTCTGACAAGACCAGGTCTAGG - Intergenic
913233327 1:116760036-116760058 GCTCTGAGAGGTCCAGTAGGTGG - Intronic
914449495 1:147778187-147778209 GCTCTGAGAGTCCCAGGACTGGG + Intergenic
915059826 1:153172120-153172142 CCCATGAGAGGACCAGGAATTGG + Intergenic
915512273 1:156392785-156392807 TGCCTGAGAGGGCCAGGTGTGGG + Intergenic
916897435 1:169179807-169179829 CCTGTCAGAGGACCAGGGGTGGG + Intronic
918535507 1:185569975-185569997 TCTTTGAGAGGCCAAGGAGAGGG + Intergenic
919059192 1:192609096-192609118 TCTCTAGGAGGCCCAGAAGTTGG + Intergenic
919844384 1:201632125-201632147 TCTTTGAGCGGAGCAGGAGAAGG + Intronic
919876735 1:201874845-201874867 TATGTGGGAGGACCAGGAGGAGG + Exonic
920201096 1:204260073-204260095 TCGCAGAGAGGACCAAGACTAGG - Intronic
920377601 1:205517539-205517561 TCAGTGGGAAGACCAGGAGTTGG - Intronic
921573792 1:216809779-216809801 TCTCTGGAAGGACCAGGATGTGG + Intronic
921746527 1:218746610-218746632 TATCTGAGAGGACCAGTATTGGG - Intergenic
923410561 1:233704644-233704666 TCTCTGAGAGGATGAGGAATGGG + Intergenic
1062797595 10:356488-356510 CCTCTGAGAGGAACAGGAACTGG + Exonic
1064396625 10:14987387-14987409 CCTCTGAGAGTCCCAGGAGGAGG + Intronic
1064399417 10:15008768-15008790 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1064543442 10:16427875-16427897 TCTTTGAGACAACCTGGAGTTGG + Intergenic
1064855831 10:19766339-19766361 TCACTGAGATGACAGGGAGTCGG + Intronic
1066986948 10:42476160-42476182 ACTCTGAGAGGGCGAGGAGGAGG - Intergenic
1068006164 10:51394014-51394036 CCTCTGAGGGGCCCAGGAGAAGG + Intronic
1068080564 10:52313787-52313809 CCTCTGAGAGGGCCAGGTGGCGG - Intergenic
1068414925 10:56708235-56708257 ACTCTGAGAGGCTCAGAAGTAGG - Intergenic
1069815079 10:71188586-71188608 TCCAGGAGAGAACCAGGAGTGGG - Intergenic
1070510187 10:77153835-77153857 CCTCTGAGAGAAGCAGGACTTGG - Intronic
1073138873 10:101234791-101234813 TCAGAGAGAGGACCAGGGGTAGG + Intergenic
1074325262 10:112445058-112445080 TCTCTGTGAGGACAAACAGTAGG + Intronic
1076076112 10:127534986-127535008 TCTGGGAGAGGAGCAGGAGATGG + Intergenic
1077420337 11:2446993-2447015 TCTCTGAGATGTCCAAGGGTGGG + Intronic
1077604632 11:3600555-3600577 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1078064930 11:8072109-8072131 GCTGTGATCGGACCAGGAGTCGG + Intronic
1078337881 11:10478070-10478092 TCTCAGAAAGGACCAGGAATAGG - Intronic
1078832218 11:14988572-14988594 CCTCTGAGAGTCCCAGGAGGAGG + Intronic
1078926625 11:15880994-15881016 CCACTGAGAGGCCAAGGAGTTGG - Intergenic
1081664910 11:44911077-44911099 TCTCTAAGAGGTCCTGGACTTGG + Intronic
1082025821 11:47571136-47571158 GCTCGGAGAGGACGTGGAGTAGG + Intronic
1082666317 11:55980022-55980044 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1083052683 11:59791160-59791182 TCTCTGAGAGGCACAGGGGCAGG + Intronic
1083595065 11:63915256-63915278 TCTCTGAAAGGCCGAGGAGCAGG + Exonic
1084227090 11:67723370-67723392 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1084260529 11:67975143-67975165 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1084812243 11:71620105-71620127 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1084845215 11:71893499-71893521 CCTCTGAGAGTCCCAGGAGGAGG - Intronic
1084972286 11:72778506-72778528 GTGCTGAGAGGATCAGGAGTGGG + Intronic
1085067264 11:73508576-73508598 TCCCTGAGAATACCAGGGGTGGG + Intronic
1090480054 11:127059977-127059999 TCTCTGAGTGGAACAGCAGAGGG + Intergenic
1091302901 11:134518988-134519010 TCTGGGAGAGGAGCAGGAGGGGG - Intergenic
1091588209 12:1827954-1827976 TAACTGAGAGGAACAGGAGAGGG + Intronic
1092067273 12:5601935-5601957 TCTCAGAAAGGCTCAGGAGTTGG + Intronic
1092431789 12:8415691-8415713 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1092434740 12:8438311-8438333 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1092529988 12:9336087-9336109 TTTCAGAGAGGCCCAGGAGCTGG - Intergenic
1094764301 12:33574380-33574402 TGCCTGAGAGGTTCAGGAGTTGG + Intergenic
1096411053 12:51377403-51377425 TCCCTGGGAGTACCAGGTGTGGG + Intronic
1096841986 12:54385366-54385388 ACTCTGAGAGGAGGAGGAGAAGG - Intronic
1097566487 12:61275996-61276018 TCTGTCAGAGGTCAAGGAGTGGG + Intergenic
1097820468 12:64123728-64123750 TCACTGTGTGGCCCAGGAGTTGG - Intronic
1097926421 12:65133664-65133686 TATCTGAGGGGACCAAGAGTGGG + Intergenic
1098803559 12:74992690-74992712 TCACTGAGAGAGCCAGGAATTGG + Intergenic
1099428900 12:82557216-82557238 TCCCTGGAAGGACCAGGAGATGG + Intergenic
1100332297 12:93595555-93595577 TCTGTGAGAGGAGAAGGAGCAGG - Intergenic
1103345083 12:120244047-120244069 TCTTAGGGAGGACCAGGAGGTGG - Intronic
1107822742 13:44300953-44300975 TCTGGGAGAGGGCCAGGAGACGG + Intergenic
1108787105 13:53917971-53917993 TCTCTGACAAGACCATGATTTGG - Intergenic
1108819477 13:54329774-54329796 TCTTTGACAGGACTATGAGTAGG + Intergenic
1109633658 13:65085566-65085588 GCTCAGAGAGGACCTGGAGTGGG + Intergenic
1109839330 13:67902291-67902313 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1114465507 14:22919453-22919475 TCTACGCGAGCACCAGGAGTGGG - Intergenic
1114535179 14:23418053-23418075 TCCCTGAGAGGAGAAGGAGGTGG + Intronic
1115701462 14:35957238-35957260 TAGCTCAGAGGACCAGCAGTAGG - Intergenic
1117039531 14:51757052-51757074 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1121273471 14:92652526-92652548 TCTCTGGGTGGACCCGGCGTGGG - Exonic
1121310964 14:92934791-92934813 TCTCTCCTAGGACCAGGAGCTGG + Exonic
1123684618 15:22787827-22787849 TCTCTGAGTGAGCCAGGCGTTGG + Intronic
1126808560 15:52378158-52378180 TGGGTGAGAGGACCAGGAATAGG + Intronic
1127291326 15:57573947-57573969 TCACTCAGAGGCCCAGGAGTGGG - Intergenic
1127531328 15:59846297-59846319 TCTCTGAGAGGGCCAGCCTTGGG - Intergenic
1127531344 15:59846378-59846400 CCTCTGTGGGTACCAGGAGTGGG - Intergenic
1127673316 15:61216574-61216596 TCTCTGAGAGCACCAGGGCAAGG + Intronic
1128246204 15:66134481-66134503 TGGCTGAGAAGGCCAGGAGTGGG - Intronic
1128618449 15:69128722-69128744 TCTCTGAGAGGGACAGGAAAAGG + Intergenic
1129869144 15:78929628-78929650 TCTCTGAGAGGCCCAGCCTTGGG + Intronic
1131569729 15:93522536-93522558 GCTCTGAGAGTCCCAGGAGGTGG - Intergenic
1131602439 15:93863195-93863217 TCTCTGAGAGCACCAGCAGCAGG + Intergenic
1134040089 16:11061784-11061806 TCACTGGGAAGTCCAGGAGTAGG + Intronic
1136172463 16:28497129-28497151 TGTCTCAGAGAACCAGGAGCTGG + Exonic
1139361108 16:66400835-66400857 TGTCTGAGATGACCACGGGTAGG - Exonic
1139545842 16:67649185-67649207 TGTCTGGGAGGCCCAGGAGTAGG - Intronic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1141294712 16:82756902-82756924 GCTCTGTGAGGGCCAGGATTTGG + Intronic
1141507299 16:84486325-84486347 CCTCCGAGGGGACCAGGAGATGG - Intronic
1142262057 16:89047718-89047740 GCTCTGAGCAGCCCAGGAGTGGG + Intergenic
1142908308 17:3063550-3063572 TCTCTGAGATCCCCAGGAGAAGG + Exonic
1142926259 17:3240711-3240733 TCTCTGAGATCCCCAGGAGAAGG - Intergenic
1142928855 17:3265646-3265668 TCTCTGAGATCCCCAGGAGAAGG - Intergenic
1143498244 17:7324478-7324500 TCCCTGGGAGGACAAGGAGCAGG + Exonic
1143966575 17:10759789-10759811 ACTCTCAGAGGACCCTGAGTCGG + Intergenic
1144096483 17:11904801-11904823 TCTCTGTTAAGACCAGGAGCTGG + Intronic
1144456736 17:15424975-15424997 ACTCTGAGAGGACCCTGTGTGGG - Intergenic
1145246282 17:21271984-21272006 TCTCCGACAGGTCCAGGAGGGGG - Intergenic
1145258783 17:21342534-21342556 TCCCAGAGAGGCCCAGGAGGTGG - Intergenic
1145317841 17:21745470-21745492 TCCCAGAGAGGCCCAGGAGGTGG + Intergenic
1145812377 17:27772210-27772232 ACTCTGAGACATCCAGGAGTGGG + Intronic
1145866353 17:28244400-28244422 TCTCTGAGAGGACCCAGAAGAGG + Intergenic
1146054656 17:29575047-29575069 CCAAAGAGAGGACCAGGAGTGGG - Intronic
1146058202 17:29591508-29591530 TCTCTGAGCCAACCAGGAGATGG - Intronic
1146795134 17:35775206-35775228 TTCCTGAGAGGACCAGGGGAGGG + Intronic
1147333279 17:39711573-39711595 CCTCTCACAGGAACAGGAGTGGG + Intronic
1148873207 17:50670798-50670820 TCTCTGGCATGACTAGGAGTTGG + Intronic
1150006904 17:61475597-61475619 TCACTGAGTGGACCTGGAGGTGG + Intronic
1151415381 17:73958838-73958860 ACTCTGTCAGGAGCAGGAGTGGG - Intergenic
1151507940 17:74541690-74541712 GCTCCAAGAGGACCAGGAGCAGG + Exonic
1152258712 17:79255080-79255102 TTTCTGAGGGGTCAAGGAGTTGG - Intronic
1153128699 18:1828963-1828985 TCTGTGAAAGGTCCAGGAGGAGG - Intergenic
1155297562 18:24398742-24398764 ACTTTGGGAGGCCCAGGAGTTGG - Intergenic
1155735418 18:29216484-29216506 TCTCTGAGAAGACCATTAGAGGG + Intergenic
1156029312 18:32693756-32693778 GCCCTGAGAGGAACAGCAGTTGG - Intronic
1158248271 18:55456344-55456366 TCTGGGAGAGTACCATGAGTAGG + Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161626281 19:5328858-5328880 GCTCTGAGAGTACTCGGAGTGGG - Intronic
1162229136 19:9251133-9251155 CCTCTGAGAGTCCCAGGAGGAGG - Exonic
1162915414 19:13872121-13872143 ACTTTGGGAGGCCCAGGAGTTGG + Intronic
1165103045 19:33450265-33450287 TGTCTGGGAGGACCAGGAGAAGG - Intronic
925990499 2:9250662-9250684 ACCCAGAGAGGAACAGGAGTAGG + Intronic
926147334 2:10404739-10404761 TCTCTTTGAAGAACAGGAGTTGG + Intronic
926911111 2:17853008-17853030 TAGCTGAGGGGACCTGGAGTGGG - Intergenic
926911133 2:17853086-17853108 TGGCTGAGGGGACCTGGAGTGGG - Intergenic
926911145 2:17853125-17853147 TGGCTGAGGGGACCTGGAGTGGG - Intergenic
926911187 2:17853281-17853303 TGGCTGAGGGGACCTGGAGTGGG - Intergenic
926958781 2:18331920-18331942 ACTCAGAGAAGACCAGCAGTGGG + Intronic
928108928 2:28490807-28490829 TCTCTGAGAGGTCAGGGAGTAGG - Intronic
928186523 2:29115640-29115662 GCTCCGAGAGGACCCGGAGGAGG + Exonic
928402793 2:30991412-30991434 TCTCTCAGATGCCAAGGAGTAGG + Intronic
928759273 2:34562159-34562181 ACTCTGAGAGTAACAAGAGTGGG + Intergenic
928962923 2:36947689-36947711 TTTGTGAGAGAACCAGGAGTAGG - Intronic
929141060 2:38666896-38666918 TCTCTGAGAAGACACTGAGTTGG - Intronic
930155615 2:48104822-48104844 CCACTGAGCTGACCAGGAGTTGG - Intergenic
930684795 2:54296370-54296392 ACTCTGAGGGGACCAATAGTTGG + Intronic
932350682 2:71028964-71028986 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
932354176 2:71055227-71055249 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
933046383 2:77542182-77542204 CCTCAGAGAGGACCAAGAATTGG - Intronic
934102535 2:88666684-88666706 CCCCTGAGAGGAGCAGCAGTTGG - Intergenic
934534460 2:95121684-95121706 GCTCTGAGCGGGCCGGGAGTGGG - Intronic
934590577 2:95546622-95546644 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
935187931 2:100751218-100751240 CCACTGAGAGGAGCAGGAGGTGG + Intergenic
935210826 2:100938392-100938414 TGTCTGGGTGGACCAGGAGAGGG + Intronic
936098063 2:109549199-109549221 TGTGGGAGAGGAGCAGGAGTGGG + Intronic
937085032 2:119165946-119165968 TCTCTGAGAGGGCCAAGTGAGGG - Intergenic
938312179 2:130300636-130300658 TGGCTTAGAGGACCAGGAATGGG - Intergenic
938406856 2:131037557-131037579 TCCCTGCTAGGACCAGGTGTTGG - Intronic
938601722 2:132849299-132849321 TGTCTGAGATAAGCAGGAGTTGG - Intronic
940704002 2:157081329-157081351 TCTCTAAGAAGACCAAGAGAAGG - Intergenic
940870207 2:158853642-158853664 CCTCTGAGAGTCCCAGGAGGAGG - Intronic
940872919 2:158874731-158874753 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
941071242 2:160956676-160956698 GCTCTGAGAGAGCCAGGAGATGG + Intergenic
941515746 2:166474607-166474629 TCTCTAAGGAGACCAGGGGTTGG - Intronic
943127700 2:183816258-183816280 TCTCACAGAGGAGCAGCAGTTGG - Intergenic
943642476 2:190374511-190374533 TATCTGATGGGAACAGGAGTTGG + Intergenic
944897564 2:204180646-204180668 TCTCTGAGCCAACCAGGACTAGG - Intergenic
946122816 2:217531173-217531195 GCTCTGAGAGGTCCAGGAGATGG - Intronic
946123158 2:217534493-217534515 TCTCTGAGAGGGCAAGGATTTGG - Intronic
947708538 2:232295460-232295482 TCTCTGAGATGACAAGGGATTGG - Intronic
948550165 2:238765755-238765777 TCTCTGACTGGACCAGGTGAGGG - Intergenic
1171292260 20:23989175-23989197 TCTCTGTGGGGCCCAGGAGCCGG + Intergenic
1171356265 20:24547720-24547742 TCTCTGGGAATACCAGCAGTGGG + Intronic
1172357714 20:34291497-34291519 TCTCTGAGGAGACCACGACTGGG - Exonic
1173546652 20:43903120-43903142 TCTCAGAGATGACCAGGAGCCGG - Intergenic
1175703771 20:61160425-61160447 TCTCTGAGAGGCAGAGGGGTGGG - Intergenic
1175879643 20:62249883-62249905 CCTCTGAGAAGTCCAGGGGTGGG + Intronic
1176796349 21:13373257-13373279 TGGCTTAGAGGACCAGGAGAAGG - Intergenic
1179922479 21:44514642-44514664 TCCCTGAGCTGACGAGGAGTAGG - Intronic
1180694877 22:17745311-17745333 ACTTTGAGAGGCCAAGGAGTTGG - Intronic
1180823325 22:18846938-18846960 TCTCTGTGGGGCCCAGGAGCCGG + Exonic
1180850761 22:19018891-19018913 TCTCTGTGGGGCCCAGGAGCAGG - Intergenic
1181123751 22:20690037-20690059 TCTCTGTGGGGCCCAGGAGCTGG + Intergenic
1181189418 22:21127608-21127630 TCTCTGTGGGGCCCAGGAGCCGG - Exonic
1181209782 22:21282887-21282909 TCTCTGTGGGGCCCAGGAGCCGG + Intergenic
1181399735 22:22644057-22644079 TCTCTGTGGGGCCCAGGAGCCGG - Intergenic
1181649680 22:24252011-24252033 TCTCTGTGGGGCCCAGGAGCCGG + Intergenic
1181677146 22:24462766-24462788 GCACAGAGAGGCCCAGGAGTCGG + Intergenic
1181707692 22:24658735-24658757 TCTCTGTGGGGCCCAGGAGCCGG - Intergenic
1182492898 22:30685412-30685434 TCCCTGAGAGGCTCAGGAGAAGG - Intergenic
1183708469 22:39489036-39489058 TTCTTGAGGGGACCAGGAGTGGG + Exonic
1184042455 22:41952199-41952221 GCTCTGAGTGGGCCAGGAGGGGG - Intergenic
1184465148 22:44664556-44664578 CCTCTGAGGGGCCCAGGACTGGG - Intergenic
1203217164 22_KI270731v1_random:12546-12568 TCTCTGTGGGGCCCAGGAGCCGG - Intergenic
1203273465 22_KI270734v1_random:72844-72866 TCTCTGTGGGGCCCAGGAGCCGG + Intergenic
950344837 3:12284026-12284048 TATCTGAGTGTACCAGGAGTTGG - Intergenic
954771026 3:52968953-52968975 TCTCTGAGAGGTACAGAAGATGG + Intronic
955444984 3:59000290-59000312 TTACTGAGATGGCCAGGAGTGGG + Intronic
956691833 3:71885700-71885722 TCACAGAAAGGACCAGGAATGGG + Intergenic
957075481 3:75599562-75599584 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
959232535 3:103673920-103673942 TCACTGAGAAGTCCAGAAGTTGG - Intergenic
959662023 3:108879585-108879607 TCTCTAAAAGGACCAGGATAGGG + Intergenic
959973739 3:112435287-112435309 TCCCTCAGAGGACCAGAACTGGG + Intergenic
961136867 3:124519511-124519533 TTTCTGAGAGGTCCTGAAGTTGG + Exonic
961275706 3:125724572-125724594 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
961278621 3:125747167-125747189 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
961475060 3:127141053-127141075 CCTCTGAGAGGACAGGGAGCTGG + Intergenic
961875781 3:130022466-130022488 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
961916317 3:130378756-130378778 TCTCTGAGAGGATCACATGTGGG - Intronic
962367290 3:134795033-134795055 TCTCCGAGAGCACCACGAGGGGG + Intronic
963650213 3:147969706-147969728 TCACTGAGTGGACAAGGAGAAGG - Intergenic
966851247 3:184166424-184166446 CCTGGGAAAGGACCAGGAGTGGG - Exonic
968287266 3:197516197-197516219 ACTTTGAGAGGAGCAGGATTAGG - Intronic
968517067 4:1019828-1019850 TCTCAGAGAGGCCAAGGACTGGG + Intronic
968830068 4:2928712-2928734 GCTCTGAGAGGACAAGGGGCAGG - Exonic
968988140 4:3890213-3890235 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
969730048 4:8949681-8949703 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
969734914 4:8981486-8981508 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
969786215 4:9459311-9459333 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
969794132 4:9512961-9512983 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
970118129 4:12722227-12722249 TCTCAGAGAGGCACAGGAGAGGG + Intergenic
970328776 4:14957075-14957097 TATCAGAGATGACTAGGAGTTGG - Intergenic
971426697 4:26523096-26523118 TCTCTGAGAAGGACAGGAATTGG + Intergenic
972790465 4:42366783-42366805 TTTCTGAGGGGTCTAGGAGTGGG + Intergenic
973740920 4:53918794-53918816 GCTCTGAGAGGATCAGTGGTTGG - Intronic
975484668 4:74922344-74922366 TCTCAGAGAGAACCAGAAATGGG - Intergenic
975704223 4:77095907-77095929 TCTCTGGGATGACCTGAAGTGGG - Intergenic
975936534 4:79588020-79588042 CCTCTGAGAGTCCCAGGAGAAGG + Intergenic
979145264 4:117239497-117239519 TCTTGGAGGGGACCAGGAGCAGG + Intergenic
980367951 4:131830925-131830947 TTTCTGAAAGTTCCAGGAGTTGG + Intergenic
987278229 5:16385212-16385234 ACTCAGAGAGAACCAGGAGTTGG + Intergenic
989362848 5:40623300-40623322 TCTCTGAGAGTACCCTAAGTGGG - Intergenic
991933768 5:71782003-71782025 TCTCTCAGAGACCCAGGACTTGG - Intergenic
993850224 5:92999379-92999401 TTTCAGAGAGGAGCAGGGGTAGG - Intergenic
994593834 5:101806657-101806679 TCTCAGTGGGCACCAGGAGTGGG - Intergenic
997359907 5:133288429-133288451 TCAGTGAGCGGGCCAGGAGTGGG - Intronic
998127552 5:139634718-139634740 TCTCTGAGTGGGAAAGGAGTGGG + Intergenic
999293043 5:150440121-150440143 GCTCTGAGAGGGCAGGGAGTGGG + Intergenic
999827577 5:155288814-155288836 TCTCTGAAGGGACCAAGAGAAGG - Intergenic
1000783824 5:165518190-165518212 TCTCAGAGAGAAACAGGATTAGG - Intergenic
1001661334 5:173395774-173395796 TGTCAGAGAGGACAAGGAGAGGG - Intergenic
1004082989 6:12414310-12414332 ACTTTGAGAGGACAAGGAGAGGG + Intergenic
1006377236 6:33678334-33678356 GCTCTGACAGGAGCAGGGGTGGG - Intronic
1006999368 6:38294880-38294902 TGTCTGACATTACCAGGAGTTGG - Intronic
1007268607 6:40618261-40618283 TCTCAGGGAGGCGCAGGAGTGGG - Intergenic
1008618362 6:53247436-53247458 CCTCAGGGAGGATCAGGAGTGGG + Intergenic
1011399742 6:86947319-86947341 TCTTTGAGATAACCAAGAGTTGG - Intronic
1016015680 6:139183234-139183256 TCACTTTGAGGACTAGGAGTGGG - Intergenic
1016201049 6:141408916-141408938 TATCTGAGAGGACCGATAGTTGG - Intergenic
1017643519 6:156517079-156517101 TCTCTGTGATGGCCAGAAGTAGG - Intergenic
1017742913 6:157422707-157422729 TCTCTGTGATAACCAGGAGGAGG + Intronic
1018558564 6:165075630-165075652 TCTAGGAGAGGAGCAGGAATCGG + Intergenic
1019520462 7:1458612-1458634 TCTCTGGGAGCAGCAGGAGGTGG - Intronic
1020131846 7:5563133-5563155 TCCCGGAGAGGGCCAGGACTGGG - Intronic
1020310873 7:6867565-6867587 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1020365628 7:7377976-7377998 ACTCTGAGAGAGGCAGGAGTGGG + Intronic
1021077759 7:16326123-16326145 TCTTTCAGAGGACTTGGAGTTGG - Intronic
1022262763 7:28722355-28722377 TCTCTGAGAGGGTCACCAGTCGG + Intronic
1027231787 7:76276878-76276900 CCTGTGAAAGGACCATGAGTTGG + Intronic
1027429838 7:78100175-78100197 ACTCTGAGAGGAGCACCAGTGGG - Intronic
1028035086 7:85972200-85972222 GCTCTGAGAAGACCTGAAGTGGG + Intergenic
1028158271 7:87456925-87456947 CATCTGACAAGACCAGGAGTAGG - Intronic
1029077578 7:97947875-97947897 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1031113312 7:117638092-117638114 CCTCTGAGAGAACCAGTAGTAGG - Intronic
1031830719 7:126622128-126622150 TGTCTGACAAGACCAGGACTAGG + Intronic
1031910730 7:127514135-127514157 GCTCTGAGAGTACCAAGAGTAGG - Intergenic
1032954683 7:136957003-136957025 TCTCTGAGGGGCCTTGGAGTAGG - Intronic
1035093469 7:156333291-156333313 TCTCTAAGCGGAGCAGGACTGGG + Intergenic
1035290941 7:157838051-157838073 ACTATGAGAGGAACTGGAGTAGG - Intronic
1035290950 7:157838107-157838129 ACTATGAGAGGAACTGGAGTAGG - Intronic
1035290959 7:157838163-157838185 ACTATGAGAGGAACTGGAGTAGG - Intronic
1035290968 7:157838219-157838241 ACTATGAGAGGAACTGGAGTAGG - Intronic
1036261847 8:7247529-7247551 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1036304746 8:7592023-7592045 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1036313887 8:7706074-7706096 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1036355595 8:8040015-8040037 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1036681678 8:10878753-10878775 TTTTAGAGAGGGCCAGGAGTTGG + Intergenic
1036832746 8:12034528-12034550 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1036902921 8:12685051-12685073 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1038450476 8:27636091-27636113 TCTCAGTGAGGAGCAGGACTTGG - Intronic
1038616754 8:29102578-29102600 TCTGGCAGAGGAGCAGGAGTGGG - Intronic
1041454468 8:58042956-58042978 TCTCTCATAGCACCAGGAGCAGG + Intronic
1046889153 8:119401973-119401995 TCTATGAGAAGTCTAGGAGTGGG - Intergenic
1047927356 8:129694621-129694643 ACTCTGGCAGGACCAGGAGGTGG + Intergenic
1048007191 8:130428951-130428973 TCTCTGAGAAGAACCGGAGAGGG - Intronic
1049755249 8:144308668-144308690 TCACTGTGAGGCCCAGGACTGGG - Intronic
1049783346 8:144438996-144439018 TCTGTGGGAGGGCCAGGCGTGGG - Intronic
1050991938 9:12166845-12166867 TCTCTGAGGGGAGGATGAGTAGG - Intergenic
1053008421 9:34619901-34619923 GGTCTGAAAGGACCAGGATTAGG - Intronic
1053161044 9:35813640-35813662 TCTCTATGAGGACCAGCAGGTGG - Exonic
1054829029 9:69603008-69603030 CCTCCCAGAGGACCAGGAGAAGG - Intronic
1055443008 9:76354990-76355012 TCTCTGAGAGGCCTAGGTTTGGG - Intronic
1055983046 9:82024899-82024921 TCACTGAGTGGACACGGAGTGGG + Intergenic
1056866550 9:90232190-90232212 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1056916609 9:90752126-90752148 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1058328877 9:103733990-103734012 GCTCTGATAGGATGAGGAGTGGG + Intergenic
1059355133 9:113692874-113692896 TCTGTTAGGGGTCCAGGAGTGGG + Intergenic
1060218948 9:121754449-121754471 TCTCTGGGAGGAAGAGGAATAGG - Intronic
1060783299 9:126429841-126429863 TCTCTGTGAAGTCCAGGAGGAGG - Intronic
1060859164 9:126939685-126939707 TCTCAGAGAGGGACAGGACTTGG - Intronic
1061433060 9:130543368-130543390 TCTCTGGGAGCACTAGGACTGGG - Intergenic
1062576188 9:137209504-137209526 CCACAGAGAAGACCAGGAGTTGG + Intronic
1187820164 X:23278564-23278586 TCTCAGAGAGGAGTAGGGGTAGG + Intergenic
1188404641 X:29792299-29792321 ACTCAGTGAGGACCAGTAGTTGG - Intronic
1188695112 X:33180566-33180588 TGTCAGAGAGGAGCAGGGGTGGG - Intronic
1188770348 X:34146993-34147015 TCTGTGACAGGACCGGAAGTGGG - Intergenic
1189010779 X:37043756-37043778 TCTGTGAAGGGACCAGAAGTGGG + Intergenic
1190570949 X:51780738-51780760 TCTCCATGAGGACCAGGACTTGG - Intergenic
1191783418 X:64892635-64892657 CCTCTGTGAGGTCCAGGAGAAGG + Intergenic
1196278285 X:113794667-113794689 TCTCTAATAAGACCAGAAGTTGG - Intergenic
1197236321 X:124069025-124069047 TCTCTGAGAGTATCAGATGTTGG + Intronic