ID: 902852437

View in Genome Browser
Species Human (GRCh38)
Location 1:19170774-19170796
Sequence TATTGGCTCTAGCAGGTGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902852437_902852443 18 Left 902852437 1:19170774-19170796 CCTTGCACCTGCTAGAGCCAATA 0: 1
1: 0
2: 0
3: 7
4: 74
Right 902852443 1:19170815-19170837 CCTTGCAGTTTCTCCTTGGAAGG 0: 1
1: 0
2: 2
3: 32
4: 211
902852437_902852441 14 Left 902852437 1:19170774-19170796 CCTTGCACCTGCTAGAGCCAATA 0: 1
1: 0
2: 0
3: 7
4: 74
Right 902852441 1:19170811-19170833 AAAGCCTTGCAGTTTCTCCTTGG 0: 1
1: 0
2: 7
3: 37
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902852437 Original CRISPR TATTGGCTCTAGCAGGTGCA AGG (reversed) Exonic
901148390 1:7083915-7083937 TTGTGGCTCTAGCAGATGCTGGG + Intronic
902852437 1:19170774-19170796 TATTGGCTCTAGCAGGTGCAAGG - Exonic
904109134 1:28111623-28111645 AATTTGCTCTAGCTGGGGCATGG + Intergenic
904349830 1:29898030-29898052 TCTTGGCTCAGGCAGATGCAGGG - Intergenic
906391804 1:45423617-45423639 TATTAGCTCTAAAAGGTTCACGG - Intronic
908005967 1:59729977-59729999 TCTTGGCTCTGGCAGGGGGAGGG - Intronic
910064507 1:83137242-83137264 TATTGGATCTAGGAGTTGCTAGG + Intergenic
912684754 1:111753713-111753735 TATTGGGTCTACCAGGTGCTTGG + Intronic
913420576 1:118663542-118663564 TCCTGGTTCTAGCAGGTGAAGGG + Intergenic
915861278 1:159447253-159447275 TCTTGGCTCTGGCAGGGGGAAGG + Intergenic
916246255 1:162691169-162691191 TTTTGGCTCTAGGAAGTGCCTGG + Intronic
921174419 1:212581349-212581371 TTCTGTCTCAAGCAGGTGCAGGG - Intronic
1069753549 10:70760237-70760259 TAGTGGGTCCAGCAGGGGCAGGG + Intronic
1070581656 10:77724997-77725019 TTGTGGCTTTTGCAGGTGCAGGG - Intergenic
1076457476 10:130610586-130610608 AACAGGCTCTACCAGGTGCATGG - Intergenic
1076648841 10:131973255-131973277 GTTTGGCTCTGGCAGGTGCTGGG - Intronic
1077586067 11:3454201-3454223 TATTGGCTCAAGCAATTACAGGG - Intergenic
1083949482 11:65946116-65946138 CCTTGGCTGTAGCAGGTCCAGGG + Intronic
1088647198 11:111926818-111926840 TGTTGGCTCTCGCAGGTGCGGGG + Exonic
1101319666 12:103662600-103662622 AAATGGTTCTTGCAGGTGCAGGG - Intronic
1114601082 14:23955869-23955891 TATTTGCTTCAGCAGCTGCAAGG - Intronic
1117457172 14:55910187-55910209 TATTGGCTCTTCCAGGTACAGGG + Intergenic
1125979863 15:43990130-43990152 CAATGGCTCTGGCATGTGCAAGG - Intronic
1131857273 15:96610381-96610403 CAGTGGCTGTGGCAGGTGCAAGG - Intergenic
1137951974 16:52792183-52792205 TTTTGGCTTTTCCAGGTGCATGG - Intergenic
1139128590 16:64112938-64112960 TCTTGGCTCTGGCAAGTGGATGG - Intergenic
1140326082 16:74005067-74005089 TGTGGGCTCTAGCAGTGGCATGG + Intergenic
1141004888 16:80342955-80342977 TATTGCTCCTAGCAGCTGCAAGG - Intergenic
1151200921 17:72467623-72467645 TTTTGGCTCTGGCAGATGCCTGG + Intergenic
1153914167 18:9731352-9731374 TATTACCTCTACCAGGTGCTTGG + Intronic
1158945210 18:62442041-62442063 CAATGGCTCTGGCATGTGCAGGG + Intergenic
1160339434 18:78075235-78075257 AATGGGCTCTTGAAGGTGCATGG - Intergenic
1162303030 19:9854918-9854940 TAATGGCTGTAGCTGGTGCTGGG - Intronic
1164812288 19:31166724-31166746 TATTGGTTGTAGCAGTTGCAGGG - Intergenic
942499737 2:176576774-176576796 TATTGCCTCCACCAGCTGCACGG - Intergenic
1168836126 20:878488-878510 TTTTCCCTCTAGCAGGTGGAGGG - Intronic
1170748895 20:19126393-19126415 TAGTCATTCTAGCAGGTGCAAGG + Intergenic
1175714832 20:61248290-61248312 TGTTGGCTTTAGCTGCTGCAGGG - Intergenic
952596138 3:35020026-35020048 TGTTGGCTCTAGAAGATGCTGGG - Intergenic
955469135 3:59268055-59268077 AATTGGCTCTAGGAGCTTCAAGG + Intergenic
956348653 3:68309859-68309881 TGTTAGTTCTAGCAGCTGCAGGG + Intronic
957032284 3:75255600-75255622 TCATGGCTCTGGCAGGTGGAAGG - Intergenic
966208008 3:177424360-177424382 TATGGGCTTTAGCATGTGAAAGG + Intergenic
967592966 3:191299782-191299804 TTGTGGCTCTTCCAGGTGCAGGG - Intronic
969001256 4:3984155-3984177 TATTGGCTCAAGCAATTACAGGG - Intergenic
969752756 4:9124544-9124566 TATTGGCTCAAGCAATTACAGGG + Intergenic
969812663 4:9660707-9660729 TATTGGCTCAAGCAATTACAGGG + Intergenic
970254232 4:14150673-14150695 AATTGGCTGTGGCAGGTGCTGGG + Intergenic
970953845 4:21787601-21787623 TCTTGGCTCTGCCATGTGCAAGG - Intronic
971119108 4:23684291-23684313 TATTGCCTCTAGTGGGAGCAGGG + Intergenic
971725041 4:30300726-30300748 TGTTGGTTCTAGCAGATCCAGGG + Intergenic
973563786 4:52163198-52163220 TATTGGCTCTTGAAGTTGGAAGG - Intergenic
977354108 4:95924089-95924111 TAGTGACTCTAGCAGGAGGAAGG + Intergenic
978089933 4:104702795-104702817 TATTGGAACTAGCAGATACAGGG + Intergenic
979289930 4:118968268-118968290 GATTGGCATTAGCAAGTGCAAGG - Intronic
981611406 4:146597438-146597460 TCTTGGCTTTTCCAGGTGCATGG + Intergenic
983388499 4:167098209-167098231 TCTTGGTTCTAGCAGGTGGAGGG - Intronic
984519161 4:180780082-180780104 TATTAGCTCTAGCAGGTTTTTGG + Intergenic
985051990 4:186000271-186000293 TTCTGGCTCTATCAGTTGCAGGG + Intergenic
986190516 5:5492684-5492706 TAATGGCCCTAGGAAGTGCAAGG - Intergenic
1010724130 6:79313707-79313729 TTTTGGCTCTGGGTGGTGCATGG + Intergenic
1012683254 6:102209852-102209874 TCTTTGCTTTTGCAGGTGCACGG - Intergenic
1019331219 7:461812-461834 TCTTGGCTCAAGCAAGGGCAGGG - Intergenic
1020093536 7:5354967-5354989 GATTGGCTCTGGCCGGTTCATGG - Intronic
1021749673 7:23783390-23783412 AATTTGCTTTAGCAGATGCAAGG + Intronic
1023590693 7:41777998-41778020 CATTGGTTCTGACAGGTGCATGG + Intergenic
1026618995 7:71933845-71933867 TATTGGCCTTAGCAGGGTCAAGG + Intronic
1027279602 7:76597506-76597528 TATTGGATCTAGGAGCTGCTAGG - Intergenic
1027525843 7:79267622-79267644 AATTGGCTATATCAGGTGTAGGG + Intronic
1032220107 7:129988074-129988096 TAATGGCTCAAGCATGTGGAAGG + Intergenic
1033607590 7:142938710-142938732 AATGGGCTCTACCAGCTGCAAGG + Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1047070278 8:121335375-121335397 TATTGGATATAGCAGAAGCAGGG - Intergenic
1048435720 8:134415397-134415419 TCTTGGCAATAGCAGGTCCATGG + Intergenic
1053049408 9:34946751-34946773 TATTGACACAAGCAGGTGCAAGG + Intergenic
1054949097 9:70829709-70829731 TATTGTCTCTAGTAATTGCATGG + Intronic
1060718393 9:125955914-125955936 TATTGACTATAGCAGATGCTCGG + Intronic
1187920620 X:24197962-24197984 TATTGAATCTAGCAGATGAAAGG + Intronic
1188727541 X:33605009-33605031 TGTCAGCTCTAGCAGGTGCATGG + Intergenic
1198726802 X:139686635-139686657 TTTTGGCTTTAGCAAGTGGATGG - Intronic
1199161327 X:144615372-144615394 TATAGGAACTAGAAGGTGCATGG + Intergenic
1201947898 Y:19531518-19531540 TTGTGGCTCTTCCAGGTGCATGG - Intergenic