ID: 902853195

View in Genome Browser
Species Human (GRCh38)
Location 1:19178005-19178027
Sequence GCATTAACACGCCTGTGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 36}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902853195_902853196 -5 Left 902853195 1:19178005-19178027 CCTTAACACAGGCGTGTTAATGC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 902853196 1:19178023-19178045 AATGCCCACCCTGTCATTTGTGG 0: 1
1: 0
2: 0
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902853195 Original CRISPR GCATTAACACGCCTGTGTTA AGG (reversed) Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
904633346 1:31860190-31860212 GCATCAACCCGACTGGGTTAAGG - Intergenic
904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG + Intronic
905598743 1:39232057-39232079 GTCTTAACATGCCTCTGTTATGG - Intronic
908741690 1:67335362-67335384 TCATTAACAGTGCTGTGTTAGGG + Intronic
910337326 1:86149269-86149291 GTTTTAAAATGCCTGTGTTATGG - Intronic
918426165 1:184412209-184412231 GCATTACCACCCCACTGTTAAGG + Intronic
1065753024 10:28905759-28905781 GCATTAACATGCCTTTGATGAGG - Intergenic
1071521615 10:86334843-86334865 GATTTAACAGGCCTGTGTTCTGG - Intronic
1078443538 11:11387098-11387120 GCATTTACATCCTTGTGTTATGG - Intronic
1108824318 13:54393138-54393160 ACATTAACACAATTGTGTTAAGG + Intergenic
1110621522 13:77601009-77601031 TTATTAACAAGCCTGTGTGATGG - Intronic
1111304435 13:86388838-86388860 GCATTAACTTGACTGTGTCAAGG + Intergenic
1143951210 17:10633903-10633925 GCATTAACACACATGTGTGCAGG + Intronic
1165592645 19:36983423-36983445 ACATTAACACGACTGCCTTATGG - Intronic
1166242708 19:41505076-41505098 GCATATACACCCCTGTGATATGG - Intergenic
928032457 2:27793272-27793294 GCATTAACACTGCTGGGTAAAGG + Intronic
932053958 2:68425904-68425926 ACTTTCACACCCCTGTGTTACGG - Intergenic
937354834 2:121191806-121191828 GCATTAATAAGTCTTTGTTACGG + Intergenic
946864035 2:224026763-224026785 GAATACACAAGCCTGTGTTAAGG - Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1182554635 22:31122666-31122688 GCATTAACACACCTGCCTTAAGG - Intergenic
975428031 4:74253685-74253707 GCATGAGCAAGCCTGGGTTATGG - Intronic
979403317 4:120277954-120277976 GCATTAACAGGGCTTTGTTAGGG - Intergenic
981549448 4:145928639-145928661 GCAGTAACTCGCTTGTGTCACGG + Intronic
993369040 5:87069647-87069669 GCATTAACACCCTGATGTTAAGG - Intergenic
997682445 5:135765882-135765904 GCATACACCCTCCTGTGTTATGG + Intergenic
1009226987 6:61029205-61029227 GCATACACCCGCCTGTGATATGG - Intergenic
1009367719 6:62868719-62868741 GCATAAGCCCCCCTGTGTTATGG - Intergenic
1017564691 6:155670754-155670776 ACATTCACATGCCTGTGTTCTGG - Intergenic
1018516718 6:164588561-164588583 GCCTTAACTCGCCTGTGTGAGGG - Intergenic
1024810218 7:53202306-53202328 GCAATAGCACTCCTTTGTTATGG + Intergenic
1029520203 7:101056003-101056025 GCCTTAATATGCCTGTATTAGGG + Intronic
1051472989 9:17470699-17470721 ACATTAACAAGCCTGTATCAGGG - Intronic
1052265168 9:26563596-26563618 GCATATACACGCCTGAGTTCTGG - Intergenic
1053623835 9:39848041-39848063 TCATTAACAGGACAGTGTTAAGG - Intergenic
1053881033 9:42595188-42595210 TCATTAACAGGACAGTGTTAAGG + Intergenic
1054220062 9:62402659-62402681 TCATTAACAGGACAGTGTTAAGG + Intergenic
1054230653 9:62506513-62506535 TCATTAACAGGACAGTGTTAAGG - Intergenic
1060233598 9:121843619-121843641 GCATTAGCAGGCCTTTGTTATGG - Intronic
1060917370 9:127399028-127399050 GCAGAAACACACCTGTGTTAGGG + Intronic
1196964138 X:121037304-121037326 GAATTATCAGGCCTGTGTCAAGG - Intergenic