ID: 902853195

View in Genome Browser
Species Human (GRCh38)
Location 1:19178005-19178027
Sequence GCATTAACACGCCTGTGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 36}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902853195_902853196 -5 Left 902853195 1:19178005-19178027 CCTTAACACAGGCGTGTTAATGC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 902853196 1:19178023-19178045 AATGCCCACCCTGTCATTTGTGG 0: 1
1: 0
2: 0
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902853195 Original CRISPR GCATTAACACGCCTGTGTTA AGG (reversed) Intronic