ID: 902853196

View in Genome Browser
Species Human (GRCh38)
Location 1:19178023-19178045
Sequence AATGCCCACCCTGTCATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902853195_902853196 -5 Left 902853195 1:19178005-19178027 CCTTAACACAGGCGTGTTAATGC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 902853196 1:19178023-19178045 AATGCCCACCCTGTCATTTGTGG 0: 1
1: 0
2: 0
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902853196 Original CRISPR AATGCCCACCCTGTCATTTG TGG Intronic
900395577 1:2451966-2451988 AATGCCAACCCTGTGAAGTGAGG + Intronic
900900182 1:5510733-5510755 AATCCCCACCCTGCCATTGCTGG - Intergenic
902730663 1:18366687-18366709 AATGAAAACCCTGTCATCTGTGG + Intronic
902853196 1:19178023-19178045 AATGCCCACCCTGTCATTTGTGG + Intronic
904096346 1:27981113-27981135 AATGGCCATTCTGTGATTTGGGG - Intronic
905742416 1:40383743-40383765 AGTTCCCACCCTGTCAATTCTGG + Intronic
907734206 1:57095798-57095820 AATTCTCATCCTGACATTTGAGG - Intronic
915470797 1:156124630-156124652 ATTCCCCTCCCTGGCATTTGAGG - Intronic
917441261 1:175071033-175071055 GATATCCACCCTGTCATTTGGGG + Intronic
917621351 1:176799870-176799892 ACTGCCCACCCTGACAGATGTGG - Intronic
918189522 1:182160170-182160192 AATGCCCACACATTCATTTCTGG + Intergenic
922182129 1:223243545-223243567 AAAGGCCACCTTGTGATTTGGGG + Intronic
1064545883 10:16449554-16449576 AATGCCCACCTTGTCTTTGATGG + Intronic
1066517495 10:36179326-36179348 AATGCCTACCCTGACATTTTAGG + Intergenic
1073798402 10:107013920-107013942 AAGGCCCACCCAGTTATTTCTGG + Intronic
1075152550 10:119947509-119947531 AGTGACCACCCTGTTATTTCAGG - Intergenic
1076229783 10:128810625-128810647 AATGCAGACCCTTTCATCTGGGG - Intergenic
1076699043 10:132260719-132260741 AATGCCCACCCGGCCACTGGTGG - Intronic
1082812601 11:57487474-57487496 AATGCCATCCCTGTTATTAGTGG - Intronic
1088531123 11:110810786-110810808 CTTGCCAGCCCTGTCATTTGAGG + Intergenic
1091024957 11:132133879-132133901 ACTTCCCAGCCTGGCATTTGAGG + Intronic
1091163449 11:133448341-133448363 AATGCCCAACGTGTTATTTATGG - Intronic
1092988762 12:13874576-13874598 AGTGCCCACACTGTCCTTGGAGG - Intronic
1095433201 12:42156671-42156693 AATGCCCTCCCTGGCCATTGAGG - Intergenic
1101845762 12:108361912-108361934 CAAGTCCACCCTGACATTTGTGG + Intergenic
1102378000 12:112439229-112439251 GATTCTCAGCCTGTCATTTGGGG + Intronic
1104646761 12:130502944-130502966 CAAGTCCACCCTGTCTTTTGGGG - Intronic
1106624793 13:31409552-31409574 ATTGCCCAGCCTGCCATTTTAGG + Intergenic
1108824558 13:54396693-54396715 AGTGCCCTCTCTGTCAATTGTGG + Intergenic
1110014917 13:70387771-70387793 AATGGCCAAACTGTCATGTGTGG + Intergenic
1112502102 13:99950755-99950777 TATGCCCACCCTTACATTTGTGG - Intergenic
1114164375 14:20204419-20204441 AATAACCACCCTGTCAGTCGAGG + Intergenic
1115716455 14:36110434-36110456 AAAGCCAAGCCTGTCATTTCAGG - Intergenic
1116994182 14:51305127-51305149 AAAGTGCACCCTGACATTTGTGG + Intergenic
1120112354 14:80572606-80572628 AGTGGGCACCCTGTAATTTGGGG - Intronic
1122206053 14:100148558-100148580 AAGGCCCACCCTGTCCTCTCTGG + Intronic
1126805885 15:52349125-52349147 AATGACCCTCCTGTTATTTGTGG + Intronic
1128776736 15:70326239-70326261 CTTTCCTACCCTGTCATTTGAGG + Intergenic
1129001885 15:72342250-72342272 AATGCCCACCCTGTCCTTACAGG + Exonic
1130233658 15:82114878-82114900 TATGACCACCCTGTCATCTCTGG + Intergenic
1132293060 15:100716485-100716507 AGTGCCTACCCTGCCATCTGAGG - Intergenic
1132712669 16:1276471-1276493 AATGCCCACCAGGTCATTCTCGG + Intergenic
1136026151 16:27470245-27470267 AAAGGCCACCATGTCGTTTGTGG + Exonic
1138077420 16:54056467-54056489 AATGCCCTCCCTGTCAGTGTGGG + Intronic
1140191179 16:72818375-72818397 AAAGCCCAGCCTGTCCTCTGGGG - Intronic
1142196861 16:88742991-88743013 CATGGCCACCCTGGCATTTCAGG + Intronic
1145960786 17:28885502-28885524 AATGCTTACTCTGTCATGTGTGG - Intronic
1146472249 17:33133918-33133940 AATTCCCAGACTGTCTTTTGTGG - Intronic
1148661707 17:49339350-49339372 AATGCCCCCCATGTTATTTCAGG + Intronic
1149411273 17:56410047-56410069 AATGAAAACTCTGTCATTTGGGG - Intronic
1149574733 17:57703455-57703477 AATGCCCACTCTGGCAGTGGTGG - Intergenic
1149682176 17:58514337-58514359 AGTGCCCACCCTGCCTTTGGGGG - Intronic
1150617954 17:66786447-66786469 AATGCCAACACTTTCATTTGGGG - Intronic
1153885545 18:9461473-9461495 CATGCCTTCACTGTCATTTGGGG - Intergenic
1154183383 18:12157693-12157715 AATGACCACCCAGTCATTTAAGG - Intergenic
1155493993 18:26425114-26425136 AATGCTCACACTGTCCTTTAAGG - Intergenic
1156823233 18:41398361-41398383 AATGCCCACCAGGTTATTTGTGG + Intergenic
1162258458 19:9512770-9512792 AAAGTCCCCCCTGGCATTTGGGG - Intergenic
1163249093 19:16115537-16115559 AATGCCAACCCTTTCACTGGAGG - Intronic
930542620 2:52725889-52725911 GATGCCATCCCTGCCATTTGAGG + Intergenic
931624466 2:64244328-64244350 CAGGCCCACCCTAACATTTGTGG + Intergenic
933303765 2:80572043-80572065 AATCCACTCCCTGTGATTTGGGG - Intronic
941687441 2:168461549-168461571 AATGCCAACCCTCTGATTTTAGG - Intronic
945935759 2:215901341-215901363 AATGCCCTCCTTGTCACTGGGGG - Intergenic
948011465 2:234652420-234652442 ACTGACCACCCTGTCATTCCTGG + Intergenic
1170697092 20:18669026-18669048 AGTGCCCTCCCTGCCTTTTGAGG - Intronic
1177000863 21:15610819-15610841 AATGCCCTCTCTTTCATTTCTGG - Intergenic
1180818188 22:18806236-18806258 AATGCCCAGGCTGTGAATTGGGG + Intergenic
1180870752 22:19145692-19145714 GAAGCCCACTCTGGCATTTGGGG - Intergenic
1181204408 22:21240691-21240713 AATGCCCAGGCTGTGAATTGGGG + Intergenic
1181361771 22:22343262-22343284 ACTGCCCACCCTGACCTGTGAGG - Intergenic
1182390255 22:29988019-29988041 TAAGCCCACTCTGTCATTTGGGG + Intronic
1203222514 22_KI270731v1_random:54724-54746 AATGCCCAGGCTGTGAATTGGGG - Intergenic
1203268315 22_KI270734v1_random:32090-32112 AATGCCCAGGCTGTGAATTGGGG + Intergenic
952401637 3:32968799-32968821 TATGGCCTCCCTTTCATTTGTGG - Intergenic
953574950 3:44105615-44105637 AATGCCCAGCCAGGCCTTTGAGG + Intergenic
953969624 3:47336936-47336958 AATATCCACCTTGTCCTTTGGGG + Intronic
956973857 3:74557678-74557700 AATTTCCACCCTGTCACTTCAGG + Intergenic
960933383 3:122877799-122877821 AATGCCCAGTGTGTCATTTCAGG + Intronic
960971763 3:123144937-123144959 AATTCCCATCATGTCATATGGGG + Intronic
964191219 3:154003226-154003248 AAAGCCCACCCTATGATTTGTGG + Intergenic
964977429 3:162637556-162637578 TATGCCCACCTTGCCATTGGTGG + Intergenic
966199910 3:177351460-177351482 AATGGCCACCCTGTAGATTGTGG + Intergenic
966932582 3:184685436-184685458 CTTGCCCACCCTGGCATTTTAGG + Intergenic
968044820 3:195618106-195618128 ACTGCCCACCCTGTCTCTGGAGG + Intergenic
968060603 3:195724158-195724180 ACTGCCCACCCTGTCTCTGGAGG + Intronic
968285705 3:197507612-197507634 AATGCACCCCCTGTCACTGGAGG + Intergenic
982635862 4:157896127-157896149 AATGCCCACCACGTCCTCTGAGG + Intergenic
983121700 4:163893428-163893450 AATGCCCTACCTGTCTTTTAGGG + Intronic
985648357 5:1095672-1095694 AATGCCCACCCTCCCAGCTGGGG - Intronic
986105024 5:4651210-4651232 AATACCCACCCTATAAGTTGAGG + Intergenic
986882419 5:12190862-12190884 AATGAACATACTGTCATTTGGGG - Intergenic
988889404 5:35598758-35598780 TCTGCCCACACTGTCATTGGTGG - Intergenic
990091231 5:52052114-52052136 AATGCCTACTCTGCTATTTGAGG - Intronic
991377242 5:65978673-65978695 AAAGCCCACACTGTCATTCAAGG - Intronic
992212219 5:74492210-74492232 AATACCCACCCTGTGGTTTTAGG - Intergenic
992830010 5:80584868-80584890 GATGCCCCCCCTGACATATGGGG - Intergenic
998381934 5:141731896-141731918 CATACCCACCCTGTCATTGGGGG + Intergenic
1001616173 5:173045304-173045326 AATTCCAACCCTGTCTTGTGGGG - Intergenic
1002447895 5:179301277-179301299 AATCCCCACTCTGTCACTTGTGG + Intronic
1002706130 5:181161683-181161705 AATGCCCACAGTGTCTTCTGGGG - Intergenic
1004155058 6:13159953-13159975 AATGCCTACCCTGTCATAGGTGG + Intronic
1019336095 7:483563-483585 AATGCGCACCATCTGATTTGAGG + Intergenic
1019584083 7:1787222-1787244 AATTCTCACCTTGTCATTTTGGG + Intergenic
1020400298 7:7769484-7769506 AACGCCCATCCTGTCAGTGGGGG - Intronic
1021522489 7:21551637-21551659 AATGGCCATGCTGTCATTTATGG - Intronic
1024579623 7:50791702-50791724 AATTCCCTCCCTGTAATCTGGGG + Intronic
1024865316 7:53899460-53899482 AATGGCCACCCTGTAAATTTTGG - Intergenic
1025159028 7:56636902-56636924 AAGCCCCACCCTGGCCTTTGTGG + Intergenic
1025727561 7:64081329-64081351 AAGCCCCACCCTGGCCTTTGTGG - Intronic
1030564114 7:111130650-111130672 AATAACCTCCCTGTCATTTGTGG + Intronic
1031533485 7:122905569-122905591 AATGTCCACCCTTTCACTTAAGG - Intergenic
1031925672 7:127636073-127636095 AATGCCCTCCCTCTCTTTGGAGG + Intergenic
1034608715 7:152344694-152344716 CATGCCCAGCCTGCCTTTTGTGG - Intronic
1035482150 7:159195827-159195849 AATGCCCTACTTTTCATTTGGGG + Intergenic
1035520643 8:273423-273445 AATCCCGGCCCTGTCATTTGGGG - Intergenic
1038259922 8:25983994-25984016 ATTGGCCACCCTGCCATGTGCGG + Intronic
1039888476 8:41668960-41668982 AATGACCACCTTGTCAGATGAGG - Intronic
1042962242 8:74315770-74315792 AATCCCCGCCCTGTAATTTTGGG + Intronic
1043495310 8:80793883-80793905 AATGGCCACCTTCTCATTAGTGG + Intronic
1047900877 8:129421230-129421252 AATGCCCAACATTTCCTTTGTGG + Intergenic
1051595690 9:18822534-18822556 AATCCCCACCCTGGCACTGGTGG + Intronic
1053556947 9:39146950-39146972 AATTCCCACCGTGTCATGGGAGG + Intronic
1054089928 9:60835359-60835381 AATTCCCACCGTGTCATGGGAGG + Intergenic
1054111339 9:61110917-61110939 AATTCCCACCGTGTCATGGGAGG + Intergenic
1054609518 9:67220208-67220230 AATTCCCACCGTGTCATGGGAGG - Intergenic
1060515169 9:124261038-124261060 AATCCCGACTCTGCCATTTGTGG - Intronic
1061500129 9:130997298-130997320 ACCTCCCACCATGTCATTTGAGG - Intergenic
1186326634 X:8484786-8484808 AGTGCTCACCCTTGCATTTGAGG + Intergenic
1187146777 X:16644427-16644449 CATGCCCAGCCTGTAAATTGAGG + Intronic
1187466478 X:19532254-19532276 AATGAGCACCCCGTCATTTGTGG + Intergenic
1188660891 X:32757492-32757514 AATTCCCACCATGTCATGGGAGG + Intronic
1189688238 X:43588133-43588155 AATAACCACCTTGTCCTTTGGGG - Intergenic
1191046030 X:56138002-56138024 AATGGCCACTTTGTCATTTCCGG - Intergenic
1192197042 X:69035319-69035341 AAGGCAGACCCTGTAATTTGTGG - Intergenic
1192291728 X:69803972-69803994 AATGAAAATCCTGTCATTTGTGG - Intronic