ID: 902853806

View in Genome Browser
Species Human (GRCh38)
Location 1:19184357-19184379
Sequence TTGTGTAAGTAGAATTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902853806 Original CRISPR TTGTGTAAGTAGAATTAGGT GGG (reversed) Intronic
902853806 1:19184357-19184379 TTGTGTAAGTAGAATTAGGTGGG - Intronic
904413660 1:30341733-30341755 TTTTTTAAGTGGAAGTAGGTAGG - Intergenic
909181709 1:72432521-72432543 TAGCCTAAGTAGAATTAGGATGG - Intergenic
911301791 1:96183581-96183603 TTATTTAAAAAGAATTAGGTTGG + Intergenic
914433335 1:147639487-147639509 TTGGGTAAGTAGAACTTGATGGG - Intronic
916616571 1:166447620-166447642 TTTTGTAAGTAGTATAAGGAAGG + Intergenic
918557039 1:185814991-185815013 TTGTATAAGTAGAATAATTTAGG + Intronic
920249916 1:204616768-204616790 TTGTTTAATTAGAAATAGGCTGG + Intergenic
921063709 1:211608003-211608025 TTTTGAAAGAAGAAGTAGGTCGG - Intergenic
921642844 1:217576832-217576854 TTGTTAAAGTGGAATTAGATGGG + Intronic
1063051899 10:2458876-2458898 TTGTGTATGTAGTGTGAGGTAGG + Intergenic
1063819868 10:9821347-9821369 TTGTTTAGGTATAATGAGGTAGG + Intergenic
1064548005 10:16470114-16470136 TTCTCTAAGCAGACTTAGGTTGG + Intronic
1069306332 10:66975443-66975465 TGGTGTAAGTAAAAATAAGTTGG + Intronic
1073616904 10:105005228-105005250 TTGGGTGAGTAGAATTAGCCAGG + Intronic
1073991987 10:109271896-109271918 TTTTGTATGTAGTGTTAGGTAGG + Intergenic
1080952174 11:37047208-37047230 TTGTGTATGTGGCATGAGGTAGG + Intergenic
1081673868 11:44957097-44957119 TTATGTATGTAGATTTGGGTTGG - Intergenic
1084622935 11:70286022-70286044 TTGTGTAGGCAGAACTAGGGAGG + Intronic
1084691077 11:70727019-70727041 TTCTGTAAGTCAAATTAGGGTGG - Intronic
1085766340 11:79286353-79286375 TTCTATAAGTAGAAATAGGATGG + Intronic
1085769599 11:79312971-79312993 TAATGAATGTAGAATTAGGTGGG - Intronic
1085833646 11:79929705-79929727 TTGTGGAAGGATAATTGGGTTGG + Intergenic
1087455045 11:98374185-98374207 TTAGGTAAGTAGAATTGGTTGGG - Intergenic
1088069968 11:105770422-105770444 TTGTGTAAGTTAAATAAGTTTGG + Intronic
1089814565 11:121160853-121160875 TTGTGTAGGCAGAAGTTGGTGGG + Intronic
1097109103 12:56645152-56645174 TTGGGTAAGTAGAGTTTGTTAGG - Exonic
1098280030 12:68853501-68853523 TTGTGCATGTAGAATAAGCTTGG + Exonic
1099364766 12:81754510-81754532 TTATGTAAATTGAATTAGGTGGG - Intronic
1100729226 12:97445571-97445593 TTCTGTAAAGAGTATTAGGTTGG - Intergenic
1101279528 12:103238190-103238212 TTTTGTAAGTAAAATTATATTGG + Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107554110 13:41502454-41502476 TTGTGTAACTAGGATTAAGGGGG - Intergenic
1110375263 13:74786323-74786345 TTGTGTAAGTGAAATTACCTGGG + Intergenic
1114709908 14:24767765-24767787 TTGTGTAAGTTGAAATAAATTGG + Intergenic
1116526238 14:45909277-45909299 TTGTGTAAGTACAATTATTCTGG + Intergenic
1117112464 14:52473001-52473023 TTGTATAAGAAGATTAAGGTGGG + Intronic
1121941100 14:98071777-98071799 TTCTGCAAGAAGAATTAGGCTGG - Intergenic
1124492417 15:30166231-30166253 TTTTGTAAGTAAAATTTTGTTGG + Intergenic
1124751118 15:32372086-32372108 TTTTGTAAGTAAAATTTTGTTGG - Intergenic
1127651317 15:61010857-61010879 TGATGTAAGTAGAAATAGGAGGG - Intronic
1128037757 15:64541542-64541564 TTGTTTAAGTAGAATTCCGCCGG + Intronic
1128722396 15:69959974-69959996 TTGTGAAGTTAGTATTAGGTTGG + Intergenic
1129494412 15:75964347-75964369 TTTTTTAAATAGAATTAAGTAGG + Intronic
1129638091 15:77343926-77343948 TTCTGTATGTGGAATAAGGTAGG + Intronic
1136555323 16:31004218-31004240 TTGCATAAGTATAATTATGTTGG - Intronic
1139013751 16:62664780-62664802 TTGAGTAAACAAAATTAGGTTGG - Intergenic
1139105578 16:63823139-63823161 TTGTTCAAGAAGAATTTGGTGGG - Intergenic
1139115218 16:63943337-63943359 TTGTCTCATTAGAATCAGGTGGG + Intergenic
1139844140 16:69907260-69907282 TTGTGTAACTAGGTTTAGCTGGG + Intronic
1140572331 16:76122401-76122423 TTGAATGAGTAGAATTAAGTTGG + Intergenic
1145352924 17:22104093-22104115 TTGTGGAAGTAGAACTAAGGAGG - Intergenic
1146557959 17:33842849-33842871 TTGTGAAAGAGGAATTAGATGGG + Intronic
1149010610 17:51852881-51852903 TTATGTAAGTAGCATGATGTAGG - Intronic
1149243804 17:54681976-54681998 TTTTGTAAATAGAATTAGGGAGG - Intergenic
1152897977 17:82924339-82924361 TTATGAAAGTAGCATTAGGCTGG + Intronic
1153266521 18:3275901-3275923 TTGAGTAAGTGTAATCAGGTAGG + Intronic
1155408609 18:25517139-25517161 TTGTGTAAGTGAAAACAGGTGGG + Intergenic
1155938455 18:31778455-31778477 GTTTGTAAGTATAATTTGGTGGG - Intergenic
1156596273 18:38551554-38551576 TAGTGTAGGTAATATTAGGTAGG - Intergenic
1159347456 18:67225478-67225500 TTCTGTAAGGAGAATTAAGTAGG + Intergenic
1165172265 19:33902281-33902303 GTGTGTAAGTAGTTTTAGATGGG - Intergenic
1168154937 19:54468179-54468201 TTGTGGAACAAAAATTAGGTTGG + Intronic
925612185 2:5710991-5711013 TTGTGTCAGTGGAATTTGATTGG - Intergenic
929662612 2:43803593-43803615 TTGTGCTAGTGGAATTAAGTTGG + Intronic
931072727 2:58672014-58672036 TTGTGTAATTAGAATATGGTTGG + Intergenic
931708910 2:64970553-64970575 TTGTGTAAGTCGAATAAGCCAGG - Intergenic
932307207 2:70712622-70712644 ATGTGGAAGAAGAATTAGGCTGG + Intronic
933226011 2:79750554-79750576 TTGTTTACTTAGAAGTAGGTAGG + Intronic
935020214 2:99223065-99223087 CTGTGTAAGTAAAAATAGGATGG - Intronic
935260172 2:101348239-101348261 TTGTAAAAGCAGAATAAGGTAGG - Exonic
935422581 2:102885389-102885411 TTTTGTAAATAAAATCAGGTGGG + Intergenic
935929415 2:108107180-108107202 TTGGGGAAGTAGAATTTGTTTGG - Intergenic
936003755 2:108863271-108863293 ATATGTATGTAGGATTAGGTTGG - Intronic
936974167 2:118202791-118202813 TTGTGTAGGCAGAACTAGCTGGG - Intergenic
939352364 2:141056220-141056242 TTGTATAAGTGGAGTCAGGTTGG - Intronic
940276869 2:151948780-151948802 GAGTGTAAGTGGAATAAGGTGGG + Intronic
940433841 2:153627655-153627677 TTGTCTGAGTATTATTAGGTGGG - Intergenic
943516960 2:188900557-188900579 TTGTGTGAGTAGAATTGGGTTGG - Intergenic
945609953 2:211987637-211987659 ATGTGTAAATAAAATTAGGTAGG - Intronic
1169833008 20:9845871-9845893 TTGTTCAAGAAGAATAAGGTGGG + Intergenic
1170775028 20:19367663-19367685 TTGGGAAGGTAGAATAAGGTGGG + Intronic
1171060921 20:21958644-21958666 TTTTGTATGTGGTATTAGGTAGG + Intergenic
1173049700 20:39547306-39547328 TTGTGTAAGTAAAAGAAGGGGGG - Intergenic
1174964008 20:55190333-55190355 ATGTTGAAGTAGAATTAGTTTGG + Intergenic
1178145477 21:29734964-29734986 TTGAGAAAGTAACATTAGGTTGG - Intronic
1179765901 21:43572889-43572911 TTGTGAAAGTAGAATTGATTTGG - Intronic
953039971 3:39247480-39247502 TTGTCTATGAAGAGTTAGGTAGG - Intergenic
955975178 3:64473256-64473278 TTGTTAAAGCAAAATTAGGTGGG + Intergenic
957705638 3:83778579-83778601 TTGTGTAATTTTAATTTGGTGGG + Intergenic
958729313 3:97944272-97944294 TTAAGTAAGTAAAATCAGGTAGG + Exonic
959541125 3:107539962-107539984 ATGAGTATGTAGAATTAGGCTGG + Intronic
962885370 3:139620661-139620683 TTGTGTAAATAGAAATAGAATGG + Intronic
967598003 3:191350594-191350616 TAGTTTATGTAGAATTAGTTGGG + Intronic
967672835 3:192259604-192259626 GTTTGTAAGTAGAAATAGGGTGG + Intronic
968801987 4:2749085-2749107 TTGTGAAAATAGAATTTGGCAGG - Intronic
970076063 4:12222387-12222409 TTGTTTAACTAGTATTAGATAGG + Intergenic
970636751 4:18019799-18019821 TCATTTAGGTAGAATTAGGTAGG - Intronic
971819574 4:31533711-31533733 ATGTGTAAGTGGCATTAGGCTGG + Intergenic
971988282 4:33856563-33856585 TTGTGAAAGTAGAATTAAGGAGG + Intergenic
974359789 4:60862559-60862581 TTTTGTATATAGTATTAGGTAGG - Intergenic
975077858 4:70235364-70235386 TTGTGCAAGTAGAATCTTGTTGG - Intergenic
975320140 4:73000759-73000781 TTGTGTAAATATAATTATGTAGG - Intergenic
975420599 4:74159301-74159323 TTGTGTAAGCTGTAGTAGGTTGG + Intronic
977440582 4:97061776-97061798 TTTTGTGAGAAGAATTTGGTAGG + Intergenic
979341601 4:119531232-119531254 TAGCTTAAGTTGAATTAGGTAGG - Intronic
979560523 4:122096543-122096565 TTCTGGAAGCAGGATTAGGTAGG + Intergenic
980967009 4:139531699-139531721 ATGTGTAAGTGGATTTAGCTGGG + Intronic
982706499 4:158715927-158715949 CTATGTAAGTGGCATTAGGTGGG + Intronic
983306423 4:165995175-165995197 GTGGGTAAGTAGAACTAGGTAGG + Exonic
984069092 4:175089800-175089822 TTGTTTATGCAGTATTAGGTAGG + Intergenic
985254394 4:188055451-188055473 TTTTGTAAGAAGAATAATGTAGG - Intergenic
986018585 5:3780016-3780038 TTATGTAATTAGAATTGGATAGG + Intergenic
987764483 5:22207472-22207494 TTTTGTAAATAGAGTTTGGTTGG - Intronic
987787153 5:22515725-22515747 TTTTGTATGTAGAGTGAGGTAGG - Intronic
988272526 5:29034891-29034913 TTGTGTTAGAAGAATCAGGGTGG - Intergenic
990958312 5:61365758-61365780 GTGTGCAAATAGCATTAGGTTGG + Intronic
991899225 5:71440626-71440648 TTTTGTAAATAGAGTTTGGTTGG - Intergenic
993304020 5:86252643-86252665 TTTGGTAAGTATACTTAGGTAGG + Intergenic
994638785 5:102378595-102378617 TTATGTAAGTGGAATTATATAGG + Intronic
997510918 5:134453438-134453460 TTTTGTAGGTAGTATAAGGTAGG - Intergenic
1000182227 5:158822551-158822573 GTCTGTAAGTAGACTTTGGTAGG - Intronic
1000594084 5:163194053-163194075 TGGTCTAAGTAGAGTTACGTAGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1008193412 6:48487981-48488003 CTCTGTAAGTTGAATTTGGTTGG - Intergenic
1009286485 6:61825452-61825474 TGGTGTAAGTACACATAGGTTGG - Intronic
1011908224 6:92400804-92400826 TTTGGTAAGTAGAATAATGTAGG - Intergenic
1012396148 6:98799937-98799959 TTGTGTTAGAAGAATTACATTGG - Intergenic
1015627533 6:135195999-135196021 TTCTGTAAGTAGAATTGTGAAGG + Exonic
1015957078 6:138610055-138610077 TTGTGGAAGTTGAAACAGGTGGG - Intronic
1021044626 7:15907145-15907167 TTGTGTAAACAGAATTATTTGGG - Intergenic
1021415827 7:20383384-20383406 ATGACTAAGTAGAAGTAGGTGGG - Intronic
1025274560 7:57566110-57566132 TTGTGGAAGTAGAACTAAGGAGG + Intergenic
1028670185 7:93393122-93393144 TTATGTAAATAGATTTAGTTTGG - Intergenic
1029043415 7:97601244-97601266 TGGTTTAAGTAGAATTAAATGGG - Intergenic
1031348010 7:120692989-120693011 TTGTTTTAGTAGGATTTGGTAGG - Intronic
1031513779 7:122678486-122678508 TTTTGTAAGGATAATTTGGTGGG + Intronic
1032700109 7:134371858-134371880 ACATGAAAGTAGAATTAGGTAGG + Intergenic
1033091543 7:138390698-138390720 TTCTGAAAGTAGAAATAGGCTGG + Intergenic
1033574261 7:142664933-142664955 TTGTAAAAGTAGAATTAGATTGG - Intergenic
1038263092 8:26014949-26014971 TTATATCAGTATAATTAGGTAGG - Intronic
1039179088 8:34843814-34843836 TTGTGTAAGGAGAATGAGAAGGG + Intergenic
1041170439 8:55136481-55136503 TTGAGTAAGTAGTAGTATGTGGG + Intronic
1044296296 8:90531256-90531278 TTAAGTAAGAAGTATTAGGTTGG + Intergenic
1044358701 8:91256699-91256721 TTGTTTATGTAGATTTAAGTTGG + Intronic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1050698839 9:8313398-8313420 CTGTGAAAGTAGAATCAGGCTGG + Intergenic
1051417749 9:16860506-16860528 TTCTGTAAATAGTATGAGGTAGG - Intronic
1052886722 9:33656372-33656394 TTGTAAAAGTAGAATTACATTGG - Intergenic
1054824138 9:69554378-69554400 TAGTGTAAGGAGAATTGGGTGGG - Intronic
1057254608 9:93534768-93534790 TTGTATTAGTAGACTTAGGTGGG + Intronic
1059661392 9:116405430-116405452 TTGTGGAAGTATGAGTAGGTAGG + Intergenic
1059666646 9:116452702-116452724 TTGAGTAAGTAGACCTATGTTGG - Intronic
1203625824 Un_KI270750v1:19931-19953 TTGTGGAAGTAGAACTAAGGAGG + Intergenic
1186883793 X:13892438-13892460 TTGTGTGTGTTGTATTAGGTTGG - Intronic
1189758980 X:44301330-44301352 TTTTTTAAGTATAATTTGGTCGG - Intronic
1193902209 X:87194962-87194984 TTGTGTAAATAGCATAGGGTTGG - Intergenic
1194527403 X:94994317-94994339 TTGTGAAAGAAGAATAAAGTTGG - Intergenic
1194620554 X:96165533-96165555 ATGTGTAAGTTGATGTAGGTAGG - Intergenic
1196872036 X:120121386-120121408 TTGTATAAATAGAATTTGATTGG + Intergenic
1200826558 Y:7650954-7650976 TTGTGTTAGCTCAATTAGGTAGG + Intergenic
1200832025 Y:7695318-7695340 TTGGGGAAGTAGAAAAAGGTTGG + Intergenic
1201421937 Y:13809027-13809049 TTGTGTAAGTTGAACCAGGCAGG + Intergenic