ID: 902856492

View in Genome Browser
Species Human (GRCh38)
Location 1:19210092-19210114
Sequence GATGAAGGAGTTGCCGCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902856492_902856496 -7 Left 902856492 1:19210092-19210114 CCAGCTGCGGCAACTCCTTCATC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 902856496 1:19210108-19210130 CTTCATCTCGAAGGCGGAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 55
902856492_902856499 8 Left 902856492 1:19210092-19210114 CCAGCTGCGGCAACTCCTTCATC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 902856499 1:19210123-19210145 GGAGTAGGACGCGGACAGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 119
902856492_902856500 9 Left 902856492 1:19210092-19210114 CCAGCTGCGGCAACTCCTTCATC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 902856500 1:19210124-19210146 GAGTAGGACGCGGACAGCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 119
902856492_902856498 7 Left 902856492 1:19210092-19210114 CCAGCTGCGGCAACTCCTTCATC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 902856498 1:19210122-19210144 CGGAGTAGGACGCGGACAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 48
902856492_902856497 -1 Left 902856492 1:19210092-19210114 CCAGCTGCGGCAACTCCTTCATC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 902856497 1:19210114-19210136 CTCGAAGGCGGAGTAGGACGCGG 0: 1
1: 0
2: 1
3: 2
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902856492 Original CRISPR GATGAAGGAGTTGCCGCAGC TGG (reversed) Exonic
901632345 1:10654017-10654039 GGTGAAGGTGAAGCCGCAGCCGG + Exonic
902181235 1:14690063-14690085 GGTGACGGTGTTGACGCAGCAGG - Intronic
902391064 1:16106802-16106824 GATGAGGGAGTGGCCTGAGCTGG + Intergenic
902856492 1:19210092-19210114 GATGAAGGAGTTGCCGCAGCTGG - Exonic
903145810 1:21371266-21371288 GAAGAAGGAGTTGGGGCAGTGGG + Intergenic
905641705 1:39594511-39594533 GATGAAGGAGTTGGGGAAGGGGG - Intergenic
911124701 1:94330285-94330307 CAGGAAGGAGTTACTGCAGCTGG - Intergenic
911725777 1:101239481-101239503 GATGAGGGAGATGACCCAGCAGG - Exonic
913233016 1:116757338-116757360 CATGAGGGAGTTGCTGCTGCAGG + Intronic
914719967 1:150281823-150281845 GATGGAGGAGCCGCCCCAGCGGG + Intergenic
914949957 1:152104567-152104589 GATCAAGGTGTTGCCTGAGCTGG + Intergenic
915457648 1:156051295-156051317 GAAGAAGCAGTGGCAGCAGCTGG + Exonic
918177149 1:182056721-182056743 GGTGAAGCACTTGCCGCAGGTGG + Exonic
920192573 1:204202947-204202969 GATGAAGAAGATGCCGAAACCGG + Exonic
920523942 1:206651727-206651749 GATGAAGGAGGTGGCACACCTGG + Intronic
922244009 1:223777221-223777243 GAGGAAGGAGAGGCCGCAGCAGG - Intergenic
1063458338 10:6200902-6200924 GATGAATGATGTGCCGCTGCTGG + Intronic
1065768764 10:29056998-29057020 CATGAAGGAGTTGAGACAGCTGG + Intergenic
1067045563 10:42983324-42983346 TAGGCAGGAGTTGCTGCAGCTGG - Intergenic
1067133438 10:43586950-43586972 GGTGAGGGAGTGGCCTCAGCCGG - Intergenic
1070618754 10:77990173-77990195 CATGAAGGAGCTGCCTGAGCAGG + Intronic
1071121865 10:82287737-82287759 GGTGAAGGAGTGGCCACAGCTGG + Intronic
1072791892 10:98324044-98324066 GATTTAGGAGTTGACACAGCAGG + Intergenic
1075556349 10:123435322-123435344 GATGCAGCAGCTGCCCCAGCAGG + Intergenic
1077073362 11:688137-688159 GTTGAAGGAGGTGGCGCTGCCGG - Intronic
1083436903 11:62648948-62648970 CTTGAAGGTGTTGCTGCAGCTGG + Exonic
1088504263 11:110513473-110513495 GATGAAGGAGATGAGGCTGCTGG + Intergenic
1094440126 12:30466019-30466041 GGTGATGGAGATGCTGCAGCAGG - Intergenic
1095427580 12:42093740-42093762 GCTGAGGGAGTTGCCTCAGCTGG + Intronic
1095742360 12:45621253-45621275 GAGGAAGGAGATGCTGCAGGGGG + Intergenic
1097193372 12:57230934-57230956 GATGTGGGAGTTGCTGCAGAGGG + Exonic
1102349281 12:112180149-112180171 TATGCTGGAGTTGCCACAGCTGG - Intronic
1102694506 12:114787661-114787683 AAGCAAGGAGTTGCCACAGCTGG + Intergenic
1104418749 12:128617528-128617550 GGTGAAGGAGATGTAGCAGCAGG + Intronic
1112748139 13:102551442-102551464 GATGAAGAAGATGGCACAGCCGG + Intergenic
1113838357 13:113344335-113344357 GAGCAAGCAGTTGCTGCAGCCGG + Intronic
1114476446 14:22998537-22998559 GATTGAGGAGCTGCGGCAGCTGG - Exonic
1114626201 14:24131805-24131827 GTTGAAGAAGTTGCCGTGGCTGG - Exonic
1118894082 14:69931340-69931362 GAAGGAGGAGTTGGGGCAGCTGG - Intronic
1121445619 14:93977050-93977072 GATGAAGGAGTTGACGTAAAAGG + Intergenic
1122501378 14:102202260-102202282 GAGGAAGGAGCTGCCACAGGAGG - Intronic
1123751774 15:23363004-23363026 AATGAACCAGTTGCAGCAGCAGG + Intronic
1124284145 15:28386928-28386950 AATGAACCAGTTGCAGCAGCAGG + Intronic
1124298552 15:28524686-28524708 AATGAACCAGTTGCAGCAGCAGG - Intronic
1124490568 15:30152440-30152462 GATGGAGGAGTTGGCAGAGCAGG - Intergenic
1124752965 15:32385889-32385911 GATGGAGGAGTTGGCAGAGCAGG + Intergenic
1124974708 15:34521589-34521611 GATGGAGGAGTTGGCAGAGCAGG + Intergenic
1125580834 15:40784263-40784285 AATGAAGGAGATGCCACTGCTGG - Intronic
1130275076 15:82472274-82472296 GATGGAGGAGTTGGCAGAGCAGG + Intergenic
1130467426 15:84199643-84199665 GATGGAGGAGTTGGCAGAGCAGG + Intergenic
1130496834 15:84473892-84473914 GATGGAGGAGTTGGCAGAGCAGG - Intergenic
1130589721 15:85204241-85204263 GATGGAGGAGTTGGCAGAGCAGG + Intergenic
1131970322 15:97885722-97885744 GATGAATGAGTTGCGGCATATGG - Intergenic
1132763608 16:1523569-1523591 GATGAAGAAGTCGGAGCAGCGGG + Exonic
1136518688 16:30782924-30782946 GATGAAGCTCTTGCCGCAGTCGG + Exonic
1136518701 16:30783008-30783030 GATGAAGCTCTTGCCGCAGTCGG + Exonic
1136518809 16:30783680-30783702 GCTGAAGCACTTGCCGCAGTCGG + Exonic
1137280452 16:46972942-46972964 GAGGGAGGAGCTCCCGCAGCCGG + Intronic
1139473934 16:67193072-67193094 GATCGAGGAGCTGCAGCAGCGGG + Exonic
1143580668 17:7823906-7823928 GATGAAGGAGGTCACGCAGAAGG - Exonic
1144364965 17:14534500-14534522 GATGAAGCAGGTGCCTCAGTTGG + Intergenic
1144826054 17:18106316-18106338 GAGGCAGGAGTTCCCGCGGCAGG - Intronic
1145061399 17:19736534-19736556 CATGAGGCAGTTGCCGCAGGGGG + Intergenic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1148330446 17:46810941-46810963 AATGAAGGAGATGCCAGAGCGGG - Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1151850239 17:76685634-76685656 GATGCGGGATTTGCTGCAGCAGG + Intronic
1153573193 18:6494467-6494489 CATGAGGGATTTGCCGCTGCCGG - Intergenic
1157548611 18:48565224-48565246 GATGAAGGCAGTGCCACAGCAGG - Intronic
1161960357 19:7519787-7519809 GCTGAAGGACTTCCCGCAGTCGG - Exonic
1165657872 19:37549688-37549710 GATGAAGGAGTGCCCGCCTCAGG - Intergenic
1166944885 19:46390551-46390573 GAGGAAGGAGGTGGAGCAGCTGG + Exonic
926370913 2:12177914-12177936 GATGAAGTGGTTGCCTCAACTGG + Intergenic
926707100 2:15844626-15844648 GATGAGGGAGTGGCCGAAGCTGG - Intergenic
927873865 2:26641368-26641390 GATCAACGAGGTGCCTCAGCTGG - Exonic
930266806 2:49209985-49210007 GATGAACCAGTTGCCTCAGTTGG - Intergenic
933820078 2:86103222-86103244 GCTGAAGGAGTTGAGGGAGCAGG + Intronic
935293048 2:101625971-101625993 GATCAAGGTGTTGGCGGAGCTGG + Intergenic
938168579 2:129055421-129055443 GAGGAAGGAGGTGCCGCTGTGGG - Intergenic
938212881 2:129483376-129483398 GATGAAGGAGTTGCCCCTCAAGG + Intergenic
940891089 2:159036109-159036131 GCTGAAGGACATGCAGCAGCTGG + Intronic
941896041 2:170630019-170630041 GATGAAGCAGGTACCTCAGCTGG - Intronic
942231850 2:173867567-173867589 GATGGAGGAGATGCAGCAGTGGG - Intergenic
944668886 2:201979168-201979190 ACTGAAGGAGTTGGAGCAGCTGG - Intergenic
946945609 2:224818718-224818740 GATGAAGCAGCTGCAGAAGCAGG - Intronic
1169287529 20:4322057-4322079 GATCAAGGATTTGGCTCAGCTGG - Intergenic
1171378034 20:24708599-24708621 GAGGAAGGAGCTGCCACAACTGG + Intergenic
1171948813 20:31402659-31402681 GATGAAGGAGTTGCTTCTGATGG + Intergenic
1172560830 20:35886880-35886902 CATGAAGCAGTTGCTGGAGCAGG + Intronic
1175502410 20:59459951-59459973 GAGGAAGGAGGTCCTGCAGCAGG - Intergenic
1176222371 20:63975746-63975768 GAGGCAGGAGGTGCTGCAGCAGG - Exonic
1177470083 21:21549049-21549071 GATGAATGAGTTGTTGCACCTGG - Intergenic
1178484965 21:33013312-33013334 GATGGAGGTGATGCAGCAGCAGG - Intergenic
1180953306 22:19730399-19730421 GATTGAGGAGTAGCCACAGCGGG - Intergenic
1182211316 22:28679702-28679724 GATGGAGCAGTCGCCGCCGCCGG - Exonic
1184331751 22:43832150-43832172 GATGAAGGTGTAGCCCAAGCAGG - Intronic
1184493127 22:44821797-44821819 GAAGACGGAGTTGCTGCACCTGG + Intronic
1185075955 22:48682350-48682372 GATGAAGGGGTTGGGGCAGAAGG + Intronic
950287899 3:11759459-11759481 GTTGAAGGAGTTCCCTCAGGAGG - Intergenic
953024525 3:39137204-39137226 GAAGAAGGAGTTGGAGCAGCAGG + Exonic
953255450 3:41286461-41286483 GATGAGGGAGTGGAAGCAGCTGG + Intronic
954231371 3:49220273-49220295 GATGAGGGAATTGCCTGAGCCGG - Intronic
955754516 3:62214315-62214337 GGTGATGGTGTTGCCGAAGCTGG + Intronic
961827317 3:129605977-129605999 GAAGAAGGAGCTGCCGTAACCGG + Exonic
963732585 3:148987374-148987396 GAAGAAGCAGTGGCAGCAGCTGG + Intergenic
964964124 3:162469250-162469272 GATTTAGGAGTTGCTGTAGCAGG - Intergenic
966130310 3:176630061-176630083 GATGACTGAGTTGCCTAAGCTGG + Intergenic
966876310 3:184323842-184323864 GATGAAGCAAGTGACGCAGCTGG + Exonic
970467023 4:16334375-16334397 GATGAAGGAGTTCTTACAGCCGG + Intergenic
971421974 4:26481818-26481840 GATGATGGGGTTGACGCAGGAGG + Exonic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
980541377 4:134201172-134201194 GATGAGGGTGTTGCCTGAGCTGG - Exonic
982073163 4:151713497-151713519 GCTGATGGAGTTGCAGCAGCTGG - Intronic
982291654 4:153788610-153788632 CATGAAGGAGGTGCTGGAGCAGG - Exonic
984593385 4:181640741-181640763 GATGCCGGCGTTGCAGCAGCAGG + Intergenic
985815550 5:2125436-2125458 GATGAAGCTGTAGCAGCAGCTGG + Intergenic
989087217 5:37688795-37688817 GATGAACCAGGTGCCTCAGCTGG - Intronic
996147359 5:119992189-119992211 GATGAACCAGTTACCTCAGCTGG + Intergenic
996400976 5:123062110-123062132 GATGAAGGAGGTGAAGCAGATGG + Intergenic
998097488 5:139404423-139404445 GATGCAGGAGTTGCCTATGCTGG - Intergenic
998269043 5:140690611-140690633 AACGAAGGAGTAGCAGCAGCAGG + Intronic
998583418 5:143403497-143403519 GTGGAAGGAGACGCCGCAGCCGG - Exonic
998707719 5:144782925-144782947 GATGAAGGGTTTGCAGCAGGAGG + Intergenic
1003202572 6:3975620-3975642 GATGAAGGAGTAGACTCTGCTGG - Intergenic
1003434456 6:6072774-6072796 GATGAACGAGTTACCTCAGTTGG + Intergenic
1004596364 6:17103356-17103378 CATGAAGTAGGTGCTGCAGCTGG - Intronic
1006311893 6:33266919-33266941 GATGCAGGAGTAGCAACAGCAGG - Intronic
1006320388 6:33316287-33316309 GCTGAAGTAGTTGCTGCTGCTGG + Exonic
1006426243 6:33964751-33964773 GATGAAGAAGTTGAAGTAGCTGG - Intergenic
1007297044 6:40832202-40832224 GCTGAAGCAGTTGCTGTAGCAGG - Intergenic
1007398112 6:41588701-41588723 GATGCAGGTGGTGCAGCAGCTGG + Exonic
1013552984 6:111227877-111227899 GAAGCAGGAGTTGACTCAGCTGG - Intronic
1014054111 6:116993377-116993399 GATGAAGGAGTAGATGTAGCTGG + Intergenic
1014202649 6:118622816-118622838 GATGAAGGAGAAGCAGCAGAAGG + Intronic
1019779893 7:2933104-2933126 AATGAATGAGATGCCACAGCAGG - Intronic
1019943346 7:4308293-4308315 GATGGAGGCGTTTCCGCAGGTGG - Intergenic
1021356921 7:19660828-19660850 CATGAATGGGTTGCCGCTGCTGG + Intergenic
1023054423 7:36280047-36280069 GAGGAAGGAGTTCGAGCAGCGGG + Intronic
1023850005 7:44145217-44145239 GATGAAGGTGATCTCGCAGCTGG + Exonic
1023876433 7:44288809-44288831 AATGAAGGAGGTGCCCGAGCAGG - Intronic
1032340978 7:131072782-131072804 GAAGGAGGAGCTGCAGCAGCAGG + Intergenic
1034224884 7:149474591-149474613 GATGAAGCTTTTGCCGCAGACGG + Exonic
1034343633 7:150372710-150372732 GCTGAAGGCTTTGCCGCAGTCGG - Exonic
1034859516 7:154583535-154583557 GATGCAGTAGTTGCCGTAGTAGG - Intronic
1036291425 8:7495899-7495921 GATGAAGGAAGTGCAGTAGCTGG - Exonic
1036330064 8:7815641-7815663 GATGAAGGAAGTGCAGTAGCTGG + Exonic
1043225702 8:77727648-77727670 GATGAAGGAGGAGCAGCAGAAGG - Intergenic
1044096478 8:88072465-88072487 GAGGAAAGAGTTGCCACAGCAGG + Intronic
1044132364 8:88540028-88540050 GAGGATGGAGTTGCCCCAGAAGG - Intergenic
1045108535 8:98917622-98917644 GATGAAGGAGCTGCCAGATCCGG - Intronic
1058700003 9:107592055-107592077 GATGAGGGAGTTTTAGCAGCAGG + Intergenic
1060880152 9:127112363-127112385 GAAGAAGGCGTTGGCCCAGCAGG - Intronic
1061060903 9:128250180-128250202 GATGGAGGAGTCGGCGGAGCAGG + Exonic
1061099922 9:128484757-128484779 GCTGAAGGAGTTGAAGCAGAAGG + Exonic
1061970120 9:134040360-134040382 GATGTCGGAGCTGCCTCAGCTGG + Intronic
1189239208 X:39512676-39512698 GATAAAGGAGTTGCCTCCCCTGG - Intergenic
1191886619 X:65894713-65894735 GATGAACCAGTTACCTCAGCTGG + Intergenic
1191895380 X:65987139-65987161 GATGAAGGAGTTGGGGGAGTGGG + Intergenic
1192727457 X:73768007-73768029 GATGAACCAGTTACCTCAGCTGG - Intergenic
1195779015 X:108440097-108440119 GCTGAAGGAGCTGCGGGAGCCGG + Exonic
1200269790 X:154671364-154671386 GATGAATGAGGTGCCTCAGTTGG + Intergenic
1202368723 Y:24183418-24183440 GATGGAGGAGTTGGCAAAGCAGG - Intergenic
1202502062 Y:25486699-25486721 GATGGAGGAGTTGGCAAAGCAGG + Intergenic