ID: 902856492

View in Genome Browser
Species Human (GRCh38)
Location 1:19210092-19210114
Sequence GATGAAGGAGTTGCCGCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902856492_902856500 9 Left 902856492 1:19210092-19210114 CCAGCTGCGGCAACTCCTTCATC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 902856500 1:19210124-19210146 GAGTAGGACGCGGACAGCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 119
902856492_902856497 -1 Left 902856492 1:19210092-19210114 CCAGCTGCGGCAACTCCTTCATC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 902856497 1:19210114-19210136 CTCGAAGGCGGAGTAGGACGCGG 0: 1
1: 0
2: 1
3: 2
4: 78
902856492_902856496 -7 Left 902856492 1:19210092-19210114 CCAGCTGCGGCAACTCCTTCATC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 902856496 1:19210108-19210130 CTTCATCTCGAAGGCGGAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 55
902856492_902856498 7 Left 902856492 1:19210092-19210114 CCAGCTGCGGCAACTCCTTCATC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 902856498 1:19210122-19210144 CGGAGTAGGACGCGGACAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 48
902856492_902856499 8 Left 902856492 1:19210092-19210114 CCAGCTGCGGCAACTCCTTCATC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 902856499 1:19210123-19210145 GGAGTAGGACGCGGACAGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902856492 Original CRISPR GATGAAGGAGTTGCCGCAGC TGG (reversed) Exonic