ID: 902856799

View in Genome Browser
Species Human (GRCh38)
Location 1:19212411-19212433
Sequence TAGTGATGAGGAGGCCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902856799 Original CRISPR TAGTGATGAGGAGGCCTGCT GGG Intergenic
900177339 1:1296686-1296708 TGGGGAGGAGGGGGCCTGCTGGG - Intronic
901327300 1:8374899-8374921 GAGTGATGAGGAGGACTACAGGG - Intronic
902856799 1:19212411-19212433 TAGTGATGAGGAGGCCTGCTGGG + Intergenic
907023089 1:51087466-51087488 CAGTGGTGATGAGGGCTGCTGGG + Intergenic
909109170 1:71452602-71452624 TAGTGATTTGGAAGCCTGTTTGG + Intronic
916822601 1:168414226-168414248 AACTGATGAAGATGCCTGCTGGG - Intergenic
918999043 1:191804258-191804280 TAGAGATGGGGAGGCCTGGTAGG + Intergenic
922322131 1:224498130-224498152 TTGAGATGAGGAGGCCAGATGGG - Intronic
1068809993 10:61244539-61244561 GAGTGATCAAAAGGCCTGCTAGG - Intergenic
1074381558 10:112984895-112984917 TTGTGATAAGGAGGCGTTCTGGG + Intronic
1074755047 10:116618200-116618222 TAGTGATGATGAAGCCTGAATGG - Intergenic
1075267180 10:121011287-121011309 CAGTTTTGAGGAGGCCTGGTAGG - Intergenic
1075472024 10:122698216-122698238 TAGAGAGGATGAGGCTTGCTCGG - Exonic
1077670738 11:4154843-4154865 CAGTGATGAGGGGTCCTGTTTGG + Intergenic
1077798553 11:5516115-5516137 TAGAGATCTGGAGCCCTGCTTGG + Exonic
1081585609 11:44381764-44381786 CAGAGATGGGGAGACCTGCTGGG - Intergenic
1091205662 11:133819112-133819134 GAGGGAGGAGCAGGCCTGCTGGG + Intergenic
1091769702 12:3142980-3143002 CAGTGGTGAGGAGTGCTGCTCGG + Intronic
1094295367 12:28899108-28899130 TATTGATGGGAAGGCCTGATTGG + Intergenic
1096593277 12:52676534-52676556 TTGGGATGAGGAGGCCTAGTGGG - Intronic
1101084890 12:101225913-101225935 GAATGATGAGGAGGGGTGCTGGG - Intergenic
1102168906 12:110827238-110827260 CAGTGAGGAGGAGGCTTGCTGGG + Intergenic
1103122023 12:118388522-118388544 TAGTGGTGAGGGGAGCTGCTAGG + Intronic
1107175702 13:37395504-37395526 TAGTGATGAGCAGGGGTGGTGGG - Intergenic
1111160299 13:84385059-84385081 TGGGGATGAGGAAGCCTGGTAGG - Intergenic
1112586253 13:100721443-100721465 CAATGATGAGGTGTCCTGCTTGG + Intergenic
1114572244 14:23679968-23679990 CACTGGTGAGGAGGCCTGATAGG + Intergenic
1117032617 14:51689738-51689760 GTGTGATGAGGAGGCGAGCTTGG + Exonic
1121081190 14:91109628-91109650 TAGTGATAAGGTGGCCATCTGGG - Intronic
1123063917 14:105606688-105606710 CAGAGCTGAGCAGGCCTGCTGGG - Intergenic
1123073231 14:105652331-105652353 CAGAGCTGAGCAGGCCTGCTGGG - Intergenic
1123093159 14:105751102-105751124 CAGAGCTGAGCAGGCCTGCTGGG - Intergenic
1128087366 15:64895309-64895331 TAGTGAGGAAGAGACTTGCTTGG + Intronic
1128681304 15:69653935-69653957 TGGTCATCAGGAGGCCTGGTGGG - Intergenic
1129881104 15:79006491-79006513 CAGTGATGAGCAGGCCTGGTGGG - Intronic
1131351021 15:91699736-91699758 AAGGGATGAGAAGGTCTGCTAGG + Intergenic
1133387804 16:5384595-5384617 AGGTGATGAGGAGGCATTCTAGG + Intergenic
1138600643 16:58051981-58052003 TAGTGAGGAGGAGCTCTGCTTGG + Intergenic
1140520704 16:75578778-75578800 TAGAGATGTGTAGGCTTGCTAGG + Intergenic
1142430485 16:90023569-90023591 TTGTGATGAGGTAGCCTTCTTGG + Intronic
1142508418 17:380453-380475 GAGGGATGAGGAGGGCTTCTGGG - Intronic
1142508425 17:380475-380497 GAGGGATGAGGAGGGCTTCTGGG - Intronic
1142508680 17:381177-381199 GAGGGATGAGGAGGGCTTCTGGG - Intronic
1142862389 17:2770565-2770587 CAGTGATGGGGAGGCCTTCTAGG + Intergenic
1143001004 17:3794997-3795019 GAGTGCTGAGCAGGCCTGCTGGG - Intronic
1143319776 17:6060623-6060645 TAGAGAAAAGAAGGCCTGCTGGG - Intronic
1143582428 17:7834909-7834931 TAGGGATGAGGAGGCTAGCGGGG - Intergenic
1146681758 17:34813428-34813450 TGGCGATGGGGAGGCCTGCGTGG - Intergenic
1150721519 17:67618032-67618054 TAGTCAGGAGTAGGACTGCTGGG - Intronic
1152178861 17:78805494-78805516 GAGTCATGAGGCGGCCTGCGGGG - Intronic
1152934765 17:83129759-83129781 CAGTTTTGAGGAGGCCTGTTGGG + Intergenic
1154300119 18:13185059-13185081 GATTGATGAGAGGGCCTGCTAGG + Intergenic
1157385219 18:47254533-47254555 CAGTTATGAGGAGGCCAGCTCGG - Intergenic
1159032735 18:63247759-63247781 ACGTGATGGGGAGGCCAGCTTGG - Intronic
1162874204 19:13608764-13608786 GCGTGATGAGAACGCCTGCTGGG - Intronic
1163477480 19:17534903-17534925 TAGTGATGGGCCTGCCTGCTGGG - Intronic
1164841810 19:31398405-31398427 TGGTGATGAGAAGGCCTGATTGG - Intergenic
926600888 2:14844342-14844364 TAGTCATTATGAGTCCTGCTGGG - Intergenic
927658304 2:24971101-24971123 GAGTGAAGAGGAGGCCGTCTTGG + Intronic
927849058 2:26487533-26487555 TCGTGAGGGTGAGGCCTGCTGGG + Intronic
931152365 2:59588612-59588634 TAGTGATGAGGAGAGCTGGAGGG - Intergenic
931901106 2:66789131-66789153 TAGTGATGAGGTCGCATGCTGGG - Intergenic
932494317 2:72138951-72138973 GAGGGGTGAGGAGGCCTGGTTGG - Intronic
933905680 2:86890275-86890297 TAATGAAGAGGAGGCTTCCTAGG + Intergenic
935539394 2:104331911-104331933 TAATGATGAAGAGGTGTGCTAGG - Intergenic
935766520 2:106373442-106373464 TAATGAAGAGGAGGCTTCCTAGG + Intergenic
936366482 2:111861368-111861390 TAATGAAGAGGAGGCTTCCTAGG - Intronic
938203421 2:129396635-129396657 TACTCATGAGGAGTCCTGGTAGG - Intergenic
939283241 2:140092576-140092598 TAGTTTTGAGGAGTACTGCTCGG + Intergenic
942329859 2:174811109-174811131 TGGTGATGAGGATGCCAGCGGGG + Intronic
946070665 2:217032006-217032028 TGGAGAGGAGGAGGTCTGCTGGG - Intergenic
947949310 2:234134119-234134141 TAGAGAAGAGGAGACCAGCTGGG + Intergenic
948123005 2:235544644-235544666 CAGAGGTGGGGAGGCCTGCTGGG + Intronic
948406320 2:237722755-237722777 GAGTGGTGAAGAGGCCTGCGTGG + Intronic
948464807 2:238147378-238147400 CAGTGATGGGGACGCCTCCTGGG - Intronic
948604788 2:239128036-239128058 TAGTGAAGAGCAGCCTTGCTGGG - Intronic
1170330818 20:15208785-15208807 CAGTAGTGAGGAGGCCTGCTGGG + Intronic
1172872447 20:38144152-38144174 GACTGATGAGGAGGCCTCCCGGG - Intronic
1173067800 20:39729639-39729661 TAGTGATGGTGGGGCCTGGTGGG + Intergenic
1175459942 20:59144994-59145016 CAGTGAGGAGTAGACCTGCTGGG + Intergenic
1176233576 20:64043558-64043580 TAGTTTTGAGGGGGCCTGTTTGG + Intronic
1176993260 21:15523394-15523416 TAGGGAGGAGGAGGCCTTCTAGG - Intergenic
1178183114 21:30187073-30187095 TAGTGAAAAGGAGTCATGCTTGG - Intergenic
1180200753 21:46222724-46222746 AAGTGATCAGGAGGCCTGTGTGG + Exonic
1182964496 22:34508583-34508605 TAATGCTGAGGAAACCTGCTGGG - Intergenic
1183143919 22:35971784-35971806 AAGTGCTGAGGGGGCCTTCTTGG + Intronic
1183550744 22:38482684-38482706 TATTGATGAGAAGGTCTTCTGGG - Intronic
949744051 3:7268021-7268043 TTGAGATGCGGAGGCCTGATAGG - Intronic
951588017 3:24235023-24235045 CAGTGTGGAGGAGGCCTGCTTGG + Intronic
955345651 3:58159685-58159707 AGGTGAGCAGGAGGCCTGCTGGG + Exonic
956581243 3:70816454-70816476 GAGTGAAGAGGAAGCCTGCAGGG - Intergenic
957470562 3:80653495-80653517 CTGTGATGAGGGGGGCTGCTGGG - Intergenic
959158190 3:102692755-102692777 CTGTGATGGGGAAGCCTGCTTGG - Intergenic
962419963 3:135219162-135219184 TAGTGAACAGGAGGCCTACTTGG + Intronic
962492316 3:135906570-135906592 TAGTGATTAAGACACCTGCTGGG + Intergenic
963647382 3:147932400-147932422 TATTGATTTGGAGTCCTGCTGGG - Intergenic
967196217 3:187028056-187028078 TGGAGATGGGGAGGCCTGGTTGG + Intronic
967904908 3:194491564-194491586 GAGAGATGAGGAGGCATGCCAGG - Intronic
967904937 3:194491687-194491709 GAGAGATGAGGAGGCATGCCAGG - Intronic
969076076 4:4578781-4578803 GCCTGATGAGGAGACCTGCTGGG + Intergenic
969501199 4:7554331-7554353 TATTGAGGAGGAGGCCACCTAGG + Intronic
969573058 4:8021444-8021466 TAGTGCTGAGGGGGCTTCCTGGG - Intronic
979015381 4:115425162-115425184 TTGTGAGGAGGAAACCTGCTTGG + Intergenic
982280518 4:153679800-153679822 TAGTGAGCAGGATGCCTACTGGG + Intergenic
982350370 4:154408836-154408858 AAGTGGTGATGAGGACTGCTGGG - Intronic
988972090 5:36478876-36478898 TGGTGATGAGTATGCATGCTAGG + Intergenic
993635554 5:90338750-90338772 TAATAATGAGTAGGCCTGTTCGG + Intergenic
996131941 5:119792162-119792184 TGGTGATGAGGAGGATTTCTGGG + Intergenic
1002053633 5:176585949-176585971 TGGTAATGAGGAGGCTTCCTAGG - Exonic
1003221030 6:4161124-4161146 TAGAGATGAGGAGTCCTGGGGGG + Intergenic
1004417333 6:15436774-15436796 TAGTGGTGTGGACTCCTGCTTGG + Intronic
1006047848 6:31313018-31313040 GAGTGATGAGGAGCACTGGTTGG - Intronic
1007617282 6:43187553-43187575 GAGTTAGGAGGAGTCCTGCTGGG + Intronic
1008343138 6:50391676-50391698 TTTTGATGATGAGGCCTCCTGGG + Intergenic
1008574649 6:52848647-52848669 GAGTGATGGGGAGACATGCTGGG + Intronic
1013366503 6:109441522-109441544 AAGCGGTGAGGATGCCTGCTTGG - Intronic
1017941487 6:159057164-159057186 TGGTGATGAAGGGACCTGCTTGG + Intergenic
1019290327 7:247139-247161 TTGTGATGAGGGGGCCTGGGAGG + Intronic
1022858831 7:34343864-34343886 CAGTCAAGAGGAGGCCTCCTTGG + Intergenic
1026340743 7:69431923-69431945 GAGTGGTGGGGAGGCGTGCTAGG - Intergenic
1027230936 7:76272051-76272073 TACTGATCAGGAGACCTCCTGGG + Intronic
1029189902 7:98764343-98764365 GAGTGATGGAGAGGCATGCTGGG - Intergenic
1031711448 7:125051432-125051454 TAATGATGAGGAGACATTCTGGG + Intergenic
1034339594 7:150343209-150343231 GAGGGAAGAGGAGGCCTGGTTGG - Intergenic
1034940926 7:155229721-155229743 GAGTGATCAGGAGGACTTCTTGG - Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1038256745 8:25957452-25957474 TGGTGAAGAGGTGGCCTGCGGGG - Intronic
1039052429 8:33507053-33507075 CAGGAATGTGGAGGCCTGCTTGG + Intronic
1047214512 8:122865535-122865557 TAGTGATGAGGAGGCAGCCCAGG + Intronic
1050141926 9:2525030-2525052 AAGTGAGGATGAGACCTGCTGGG + Intergenic
1052024159 9:23556458-23556480 TATAGCTGAGGAGGCCTCCTTGG - Intergenic
1052860481 9:33435029-33435051 TAGTGCTGAAGAGGTCTGTTTGG - Intergenic
1057222670 9:93266081-93266103 CTGTGAGGAGGAGGGCTGCTGGG - Intronic
1060832288 9:126723942-126723964 CACTGATGGTGAGGCCTGCTCGG - Intergenic
1061087316 9:128406733-128406755 GTGTGATGAGGGGGCCTGGTGGG - Intergenic
1186613211 X:11159117-11159139 GAGTGATGAGGAGGTCTGTGAGG + Intronic
1186630696 X:11345623-11345645 TGGGGATGGGGAGGCCAGCTGGG + Intronic
1187570741 X:20498326-20498348 AAGTTATGAGTGGGCCTGCTGGG - Intergenic
1190691338 X:52915828-52915850 GAGGGAGGAGGAGTCCTGCTGGG + Intergenic
1190694645 X:52939964-52939986 GAGGGAGGAGGAGTCCTGCTGGG - Intronic
1193047844 X:77071079-77071101 AAATGATGAGGAGGGCTGCAGGG + Intergenic
1193116934 X:77785116-77785138 TGGTTAAGAGGAGGCCTGCCAGG + Intronic
1193471341 X:81907601-81907623 CTGTGATGGGAAGGCCTGCTGGG + Intergenic
1195156950 X:102132975-102132997 TAGTGATGAGGAGGTTTAGTGGG + Intergenic
1197059451 X:122160054-122160076 TCATGATGTGGAGGCCTGCAAGG + Intergenic