ID: 902866916

View in Genome Browser
Species Human (GRCh38)
Location 1:19285788-19285810
Sequence GCTGCTATGCAGAGGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 3, 3: 34, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902866905_902866916 23 Left 902866905 1:19285742-19285764 CCTGAGGGTACCTGGGAGCCATC 0: 2
1: 1
2: 1
3: 20
4: 181
Right 902866916 1:19285788-19285810 GCTGCTATGCAGAGGGCACAGGG 0: 1
1: 1
2: 3
3: 34
4: 218
902866909_902866916 5 Left 902866909 1:19285760-19285782 CCATCTGCAGGCTTTCAGCAGGG 0: 3
1: 0
2: 0
3: 25
4: 282
Right 902866916 1:19285788-19285810 GCTGCTATGCAGAGGGCACAGGG 0: 1
1: 1
2: 3
3: 34
4: 218
902866907_902866916 13 Left 902866907 1:19285752-19285774 CCTGGGAGCCATCTGCAGGCTTT 0: 2
1: 0
2: 0
3: 24
4: 204
Right 902866916 1:19285788-19285810 GCTGCTATGCAGAGGGCACAGGG 0: 1
1: 1
2: 3
3: 34
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902866916 Original CRISPR GCTGCTATGCAGAGGGCACA GGG Intronic
900104153 1:975233-975255 GCTGCTGAGCAGAGAACACATGG - Exonic
901084837 1:6603957-6603979 GCTGCTTTGCAGAGAACACTTGG + Intronic
901752172 1:11417002-11417024 GCTGCAAAGCAGTGGGCCCAGGG - Intergenic
902082402 1:13829928-13829950 GCTGCAATGAAGAGGGCAATGGG - Intergenic
902864694 1:19270352-19270374 GCTGCTATGCAGAGGGCATGGGG + Intergenic
902866916 1:19285788-19285810 GCTGCTATGCAGAGGGCACAGGG + Intronic
902869960 1:19308058-19308080 GCTGCTATGCAGACGGCACAGGG + Intronic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
904602731 1:31682859-31682881 TCTGCTGGGAAGAGGGCACAGGG - Intronic
904863428 1:33557759-33557781 GCTGCCAGGGAGATGGCACATGG - Exonic
906152335 1:43594810-43594832 ACTGCCATGTAGATGGCACACGG - Intronic
907391272 1:54160076-54160098 GGCCCTATGCAGAGGCCACAAGG + Intronic
909345540 1:74581637-74581659 GCTGCTATAAAAAAGGCACATGG + Intronic
912698276 1:111857336-111857358 GCTTCTGTGCAGAGGGCACGGGG + Intronic
913584984 1:120266089-120266111 CCTCCTATGCAGAGGCCATAAGG - Intergenic
913623198 1:120632273-120632295 CCTCCTATGCAGAGGCCATAAGG + Intergenic
914566987 1:148877946-148877968 CCTCCTATGCAGAGGCCATAAGG - Intronic
914605837 1:149252296-149252318 CCTCCTATGCAGAGGCCATAAGG + Intergenic
916423561 1:164659664-164659686 GCTGCCAGGGAGAGGGAACAAGG - Intronic
917552216 1:176044127-176044149 GATACTATCCAGAGGGCTCAAGG + Intronic
919989344 1:202698325-202698347 TCTGCTCTTCAGCGGGCACAGGG - Intronic
920444031 1:206002168-206002190 GAGGCTATGTAGAGAGCACAAGG + Intronic
922703924 1:227779032-227779054 GCCCCTCTGCAGATGGCACAGGG - Intronic
923281922 1:232451424-232451446 GCTGCTGTGGATGGGGCACATGG + Intronic
1062947034 10:1469226-1469248 GGTGCTTTGCAGGGGGCACTGGG - Intronic
1063238261 10:4141730-4141752 GCTGCCATGAAGAGGTCAGAGGG - Intergenic
1064531554 10:16315485-16315507 GCTGCTCTGCAAAGGGCTAAAGG - Intergenic
1065305597 10:24365405-24365427 GCTGCTATGGACAGGGAAAAGGG - Intronic
1067071013 10:43132080-43132102 GCTGCCATGGAGAAGGGACAGGG - Intergenic
1068683401 10:59843984-59844006 GCTTTTATTCAGAGGGCACTTGG - Intronic
1069178988 10:65332514-65332536 GTAGCTATACAGAGGGGACATGG - Intergenic
1069520079 10:69111949-69111971 GCTGCTACACAGTGGGGACAGGG + Intergenic
1070592575 10:77811350-77811372 TCTGCTCTGCTCAGGGCACAGGG - Intronic
1071002247 10:80843069-80843091 GCTGGTGTGCAGAGATCACATGG - Intergenic
1072693124 10:97584491-97584513 GCTGCTACCCAGAAGGAACAGGG + Exonic
1072765959 10:98095444-98095466 GCTGCAATGAAGAGGGCACCAGG + Intergenic
1074759785 10:116658486-116658508 GCTGCCAAGGAGAGGGCAGATGG + Intergenic
1074942485 10:118248741-118248763 GCTGCTTTGCAGAGAGCACGTGG + Intergenic
1075093655 10:119457234-119457256 GCTGCTATGAACTGGGCAAAAGG - Intronic
1075311668 10:121419578-121419600 GCTGCTCTACAGAGGGGTCAAGG + Intergenic
1076504076 10:130960435-130960457 GCTGCTATGGAGAGGGAATCTGG + Intergenic
1076754655 10:132562966-132562988 GCTGCTCTGCAGAGGGCTTCAGG + Intronic
1077573514 11:3358238-3358260 GTAGCTGTGCAGAGAGCACAAGG + Intronic
1078118778 11:8483617-8483639 TCTGCAATGGAGGGGGCACAGGG + Intronic
1080634539 11:34112125-34112147 GCTGCTATGAAGAGTTCAAAGGG - Exonic
1080986809 11:37477510-37477532 GCTGACAGGCAGAGGGCATAGGG - Intergenic
1081744170 11:45461516-45461538 GCTGCCATGGAGGGGGCAAATGG - Intergenic
1083991669 11:66249947-66249969 GCCTCTATTCAGAGGGCACTGGG - Intergenic
1084116276 11:67044771-67044793 GCTGCTGTGCTGTGGGCACCCGG + Intronic
1084734824 11:71097797-71097819 GCTGCTACCCAGCGGGCACAGGG + Intronic
1085348889 11:75785590-75785612 CCTGCTATGCTGAGAGCACAGGG - Intronic
1086897354 11:92328725-92328747 GCTGCAAACCTGAGGGCACATGG - Intergenic
1086983239 11:93221664-93221686 GCTGCTGTGCACAGAGCACGAGG - Intergenic
1089270293 11:117297176-117297198 GCAGACCTGCAGAGGGCACAGGG - Intronic
1089482974 11:118821946-118821968 GCCACTATGCGGAGGGCCCAGGG + Intergenic
1090252175 11:125259513-125259535 GCTGATATGCAGGGGGGCCAGGG - Intronic
1091641708 12:2242059-2242081 GGGGCTATGCAGAGGGCACAAGG - Intronic
1095858391 12:46887206-46887228 GCTGAAGTGCAGAGGGCACAAGG + Intergenic
1096592458 12:52670035-52670057 GCTGCTATGGGGGAGGCACATGG + Intergenic
1101586701 12:106091421-106091443 CCTACTATGCAGATGGCACTGGG + Intronic
1101939605 12:109090204-109090226 GCTCCTGTGCAGAGGAAACATGG + Exonic
1102027176 12:109720204-109720226 GCTATTGTGCAGAGGGCACAGGG + Intronic
1103009764 12:117449149-117449171 CCTTCTATGCAGTGGGCACAGGG - Intronic
1103239788 12:119403608-119403630 GATTTTATGCAGAGGGCACAGGG - Intronic
1103515055 12:121502278-121502300 GCTGGTTTACAGATGGCACAGGG + Intronic
1103973250 12:124685654-124685676 CCTGCTCTACGGAGGGCACAAGG - Intergenic
1106044876 13:26129632-26129654 ACTGCTGTGTAGAGGGCAGAAGG - Intergenic
1106105620 13:26730426-26730448 GTTGCTATGCATAGGGCAGAGGG - Intergenic
1106174737 13:27320573-27320595 GCTGGTAAGCAGAGGGAAAAGGG + Intergenic
1106557098 13:30819072-30819094 CATGCTATGCAAAGGGGACAAGG - Intergenic
1106584189 13:31043170-31043192 GCAGCTATGCAGTTGGCCCAAGG + Intergenic
1107964796 13:45588848-45588870 GTTGCAATGGAGAGGACACAGGG + Intronic
1111340738 13:86882417-86882439 TCTGCTTTGCATAGGGCTCAGGG - Intergenic
1111682514 13:91461015-91461037 GCTTTTATGCAGAAGGCAAAGGG + Intronic
1111754796 13:92379653-92379675 ACTAATATGCAGGGGGCACAGGG - Intronic
1111843098 13:93473783-93473805 GCTGCTGTGGGGAGGACACAGGG - Intronic
1112238031 13:97653658-97653680 GCTCCTCTGCAAAGGGCTCAGGG + Intergenic
1112304779 13:98264046-98264068 TGTGTTAGGCAGAGGGCACAAGG + Intronic
1113291897 13:108916290-108916312 GCAGCTAAGCAGAGGGTGCAAGG + Intronic
1115492751 14:33973893-33973915 GTTGCAATACAGAGGGTACAAGG + Intronic
1117439295 14:55745076-55745098 GCAGCTATGGAGAGGTCCCAGGG + Intergenic
1118113665 14:62750685-62750707 GCTGCTATCTAGAAGGAACAGGG - Intronic
1119121825 14:72086570-72086592 ATTGCTCTGCAGAGGGCTCAGGG - Intronic
1119947545 14:78710800-78710822 GGTTCTTTGCAGAGGGCAGATGG + Intronic
1122008903 14:98729595-98729617 GCTGGTCTGCAGAGGGCCCTGGG - Intergenic
1122614025 14:103004436-103004458 GCTGCTGTGCAGCTGGCAGAAGG + Intronic
1124227899 15:27911546-27911568 GCTGGTGTGCAGAGATCACATGG + Intronic
1124343635 15:28906159-28906181 GCTGCTATGCACAACGGACAAGG - Intronic
1124675962 15:31686142-31686164 GCTGCTATGCAGAAGGGAACAGG + Intronic
1124882945 15:33659108-33659130 GCTGATGTGCAGTGGGCAGAGGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126280505 15:46942204-46942226 GATGCTATGCAGCAGACACAAGG + Intergenic
1129257500 15:74342431-74342453 GCTGCTATGGAAAGAGCACTGGG + Intronic
1129709268 15:77812222-77812244 GCTGCTCTGCAGAGGGCATGGGG - Intronic
1130412994 15:83662915-83662937 TCTGCTACCCAGAGGGCAGAGGG - Intronic
1130815378 15:87426579-87426601 GCTGATATGCAGATGGCAGAAGG - Intergenic
1132864254 16:2085807-2085829 GCTTCTGAGCAGAGGGCACATGG + Intronic
1134389803 16:13808865-13808887 GTTGGAAGGCAGAGGGCACATGG - Intergenic
1134748209 16:16604298-16604320 GATGCTATGCAGAAGGCAGGAGG - Intergenic
1134997254 16:18749325-18749347 GATGCTATGCAGAAGGCAGGAGG + Intergenic
1135122622 16:19779551-19779573 GCTGCTATCCAGATGGCAGATGG - Intronic
1135905164 16:26505369-26505391 GCTGTTTTGCAGATGGCAGAAGG - Intergenic
1138277586 16:55747238-55747260 GTTTCTGTGCAGAGGGTACATGG - Intergenic
1138542878 16:57699065-57699087 GCTGGAGAGCAGAGGGCACAGGG + Intronic
1141410253 16:83828312-83828334 GCTGCTGTGAAGAGGCCACGCGG + Intergenic
1143314595 17:6022717-6022739 TCTGCTATGCAGTAGGCTCAGGG - Intronic
1143778931 17:9219329-9219351 GCTGCTATCCAGATGGCAGGAGG + Intronic
1143879813 17:10021469-10021491 GCAGCTACGCAGAGGGCAGAAGG - Intronic
1145414422 17:22703361-22703383 GGTCCTATGCGGAGGGCACCAGG + Intergenic
1146520525 17:33522169-33522191 GGTACTGAGCAGAGGGCACAAGG - Intronic
1148097398 17:45062091-45062113 GCTGCTCTGCAAAGGTAACAAGG - Intronic
1149723580 17:58869513-58869535 GCTGGTGTGCAGAGATCACATGG - Intronic
1149991091 17:61384037-61384059 CCGGCTATGAAGAGGGGACAGGG - Intronic
1149991686 17:61387144-61387166 GGTGAAATGCGGAGGGCACAGGG - Intronic
1151400508 17:73852842-73852864 GGTGCGATGCTGAGGACACATGG - Intergenic
1151498202 17:74472403-74472425 GCTGCCAAGCAGAGGACACATGG - Intronic
1152389347 17:79993427-79993449 CCTGCAAGGCAGAGGACACAGGG - Intronic
1155368888 18:25077478-25077500 GCTGCTATGTGGGGGGCACGCGG - Intronic
1155485356 18:26335778-26335800 GTTGCTATGCAGAGGCCTCTGGG - Intronic
1158569357 18:58583848-58583870 GTTTCTCTGCAGAGGGCTCATGG - Intronic
1161453541 19:4359497-4359519 GCTCCCCTGCAGAGGGCCCAGGG + Intronic
1163106024 19:15123515-15123537 GCCGCTGTGCTGAGGGCCCATGG - Exonic
1163192574 19:15688187-15688209 GCTCCCATGCAGTTGGCACAAGG - Intronic
1163302649 19:16457597-16457619 GCAGCCATGCAGAGGGCAGAAGG + Intronic
1163572500 19:18090745-18090767 GCTGCCAGGCAGAGGCCACTGGG - Intronic
1166964116 19:46517581-46517603 GGTGATCTGCACAGGGCACAGGG - Intronic
1168050219 19:53824219-53824241 GCTCCTATGCACGGGACACAGGG + Exonic
1168153911 19:54462923-54462945 GCCGCTCTGCACAGGGCACCAGG - Exonic
925258992 2:2513160-2513182 ACTGCTATGCTGAGGGAGCACGG - Intergenic
925720000 2:6817798-6817820 TCTGCTCTGCAGAGGTCACTTGG - Intergenic
926797051 2:16627791-16627813 GCTGCTACCCAGAGGGCACTAGG - Intronic
927197383 2:20557963-20557985 TCTGCAAAGCAGAGGGCACCAGG + Intergenic
927213901 2:20655332-20655354 GCTCCTTTGCATAGCGCACAAGG - Intergenic
927254883 2:21032430-21032452 GCTGCTGTGCTGAGGGCTCGGGG + Exonic
929063607 2:37949405-37949427 GGGGCAATGCAGAGGGCCCAAGG - Intronic
930725103 2:54674706-54674728 GGTGCTTTGCAGAGGGGATAAGG - Intergenic
932493397 2:72135032-72135054 GCACCTAGGCACAGGGCACATGG - Intronic
932831204 2:74991833-74991855 GCTGCTCCATAGAGGGCACAGGG + Intergenic
932916541 2:75865276-75865298 GCTCCTTTGCCCAGGGCACAGGG + Intergenic
938152120 2:128896168-128896190 GCTGGTGTGCAGAGATCACATGG - Intergenic
938314743 2:130317791-130317813 GCTCCTATGCAAAGGGCCAAGGG + Intergenic
938566072 2:132520321-132520343 GGTGTTATGCAGATGGCAGATGG - Intronic
941288910 2:163650038-163650060 GAGACTATGCAGAGGGCAGAAGG + Intronic
942662769 2:178283788-178283810 GCTGTTATGCAGAGATCACATGG + Intronic
946046653 2:216827015-216827037 GCTGCTCTGCAGAGGCCCTATGG - Intergenic
947863601 2:233380421-233380443 GCAGCCATGCTGAGGCCACAAGG - Intronic
947927988 2:233938171-233938193 GCGGCCATGCTGAGGCCACAGGG - Intronic
948384632 2:237573907-237573929 GCTGGCGTGCAGAGGTCACACGG - Intergenic
1168993677 20:2116334-2116356 GCTGCTGGGCAGATGGGACAAGG - Intronic
1169432078 20:5545541-5545563 GCTCCCAGGCAGAGGACACACGG + Exonic
1170119260 20:12894135-12894157 GCTGATATGCAGAGTGCTGAGGG - Intergenic
1170574178 20:17650037-17650059 GCTGCTCCTCAGAGGACACAGGG + Intronic
1173560817 20:44004164-44004186 GCTGAGATGTAGAGGACACAGGG + Intronic
1173723955 20:45283939-45283961 GCTGCTTTCCAGAGGGCAAGAGG - Intergenic
1174916293 20:54657647-54657669 ACTGCCCTGCAGAGGGCATACGG - Intergenic
1175244284 20:57572286-57572308 GCTGCTAGGGAGAGGGGAGAAGG - Intergenic
1176254434 20:64143601-64143623 CCAGCTCTGCAGAGGGAACATGG - Intergenic
1176943355 21:14950698-14950720 GATGCTATGGAGAGGGAAGAGGG - Intergenic
1179875921 21:44267362-44267384 GCTGGAGGGCAGAGGGCACACGG - Intergenic
1180129969 21:45821024-45821046 GGTGCTTTGCAGAAGCCACATGG - Intronic
1181000982 22:19987573-19987595 GCTGCGATGCACAGAGCACAAGG + Intronic
1184627021 22:45743093-45743115 GCTGCTGTGCAGAGGTCACTGGG + Intronic
1185233316 22:49695600-49695622 GCTGCTATGAAGAGAACCCACGG + Intergenic
949944466 3:9179001-9179023 GCTGGTATGAACAGGGGACATGG - Intronic
950724400 3:14907137-14907159 GGTGCTGTGCAGAGGAGACAGGG + Intronic
954176916 3:48852096-48852118 GCAAGTATGCAGAGGGCATAAGG - Intergenic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
955493100 3:59502717-59502739 GCTGCTGTGCAGTGGGAATATGG + Intergenic
956868029 3:73388369-73388391 AATGCTCTGCAGAGGGAACATGG + Intronic
958716404 3:97787766-97787788 GCTCCTAACCAGAGGGCAGATGG + Intronic
959175525 3:102904701-102904723 CCTGCTTTGCATAGGGCTCAGGG + Intergenic
960621679 3:119643004-119643026 GCTGTTATCCAGAGGGCAGGTGG + Intronic
961440855 3:126952440-126952462 GCTGGTGTGCTGAGGGGACAAGG + Intronic
961682567 3:128608683-128608705 GCTGCTGGGCAGCTGGCACATGG + Intergenic
961736756 3:129006717-129006739 GATGCTATGTGAAGGGCACACGG + Intronic
962492202 3:135905301-135905323 GCAGCTTTACAGAGGGCACAAGG + Intergenic
963553790 3:146759730-146759752 GCATCTATGCAGAGGACATATGG - Intergenic
965928287 3:174009906-174009928 GCTGCCATGCATAGGGGACAGGG + Intronic
967237421 3:187399446-187399468 GCTGTTAAGTTGAGGGCACAAGG + Intergenic
967750981 3:193116026-193116048 GCTGCTATACAAAGGGCATATGG + Intergenic
969124152 4:4933831-4933853 GCTGGTATGCAGAGATCACATGG - Intergenic
971837235 4:31783491-31783513 GCTGACATGCAGAGATCACATGG + Intergenic
975769816 4:77708851-77708873 GCTGTTATACAGTGGGGACAGGG - Intergenic
976994051 4:91407677-91407699 GCTTCTATACAGAGATCACATGG + Intronic
977281519 4:95045695-95045717 CCTGCTATGCTGAGGAAACATGG - Intronic
978522959 4:109635563-109635585 TCTGATTTGCATAGGGCACAGGG - Intronic
983085734 4:163442119-163442141 GATGTTATGCAGAGGGCACTGGG - Intergenic
984089135 4:175348669-175348691 GCTGCTCTGCCGAGGGCACCTGG - Intergenic
985044299 4:185924696-185924718 TCTGATTTGCATAGGGCACAGGG - Intronic
986331290 5:6717748-6717770 GCTGGGATGCAAAGGGCCCAGGG - Intronic
986895672 5:12363943-12363965 CCTGTTATGTAGTGGGCACATGG - Intergenic
987342234 5:16949264-16949286 GCTGCTGTGCTCTGGGCACAGGG - Intergenic
988523334 5:31965306-31965328 TCTGATTTGCATAGGGCACAGGG + Intronic
988602547 5:32653428-32653450 GTTGGTAAGCAGAGGGCAGAGGG + Intergenic
990168819 5:53024613-53024635 GCTGCTACACAGAGGGCCAAGGG + Intronic
997820596 5:137062350-137062372 GCTGCTATGCTCAGGCCAGAAGG + Intronic
1000893349 5:166825889-166825911 GCTAATATTCAGAAGGCACAGGG - Intergenic
1002437250 5:179239135-179239157 GCTGCTGTGTTGAGGACACATGG + Intronic
1002851504 6:1000871-1000893 GCTGCAGTGCAGAGAGCAAATGG - Intergenic
1003446739 6:6191759-6191781 GCTGCTTCTCAGAGGGCATATGG + Intronic
1003759174 6:9155879-9155901 GCAGCAATGCAGAGGGAACCTGG + Intergenic
1004582770 6:16970421-16970443 GCTGCTAAGCAGTGAGCACTTGG - Intergenic
1005118501 6:22364616-22364638 GCTGCTTTGCAGGGGGATCAAGG - Intergenic
1006501577 6:34462678-34462700 GGTGTAATGCAGAGGGCACAGGG - Intergenic
1006784615 6:36657615-36657637 GATGCTAGGCAGAGGGGCCAGGG - Intergenic
1007352046 6:41281056-41281078 GCTGGTATAGAGTGGGCACAAGG + Exonic
1007359514 6:41345054-41345076 GATGCTCTGCTCAGGGCACAGGG - Intronic
1008061416 6:47001120-47001142 GCTGCCAAGCAGTGGGCACGCGG - Intronic
1008662428 6:53681940-53681962 GGGGTTATGCAAAGGGCACATGG - Intergenic
1009845742 6:69132504-69132526 GCTGATATCCAGAAGCCACAAGG - Intronic
1009880988 6:69565747-69565769 GCTAATATCCAGAGGCCACAAGG + Intergenic
1015064472 6:129007105-129007127 GTAGCTATGCAGAGGGCGTAGGG + Intronic
1016555227 6:145328780-145328802 ACTGCTGTGCAGAGAGCACATGG + Intergenic
1017691528 6:156970770-156970792 GCTGTCATTCAGAGGGCAAAAGG - Intronic
1017861117 6:158398188-158398210 GCTGGTATGCTGGGGGCACCAGG - Intronic
1018785461 6:167104557-167104579 GCTGCTCTGCAAAGGCCCCATGG - Intergenic
1019954103 7:4399392-4399414 GCTACAAAGTAGAGGGCACAGGG + Intergenic
1023797678 7:43807381-43807403 GGGGCTATGCAGTGGGGACAAGG + Intergenic
1024461100 7:49660355-49660377 GCTGCAATGATGAGAGCACAGGG - Intergenic
1024512510 7:50214711-50214733 GGTGCTTTCCAGAGAGCACAGGG + Intergenic
1029269263 7:99366972-99366994 GCTGCCATGCTGTGGGCACCGGG - Intronic
1029664328 7:101985254-101985276 GCTGCTCTGCAGACGGGAGAGGG + Intronic
1033030701 7:137823440-137823462 GCTTCTTTGCAGAGGGTACATGG - Intronic
1033311860 7:140267585-140267607 GGTGCTATGCAGAGCCCTCAGGG - Intergenic
1034355751 7:150449690-150449712 CCTGCTGTGCAGAGCGCAGAGGG + Intergenic
1034972780 7:155429539-155429561 GCTGCTCTGCAGAGGTCCCTGGG - Intergenic
1036751873 8:11448775-11448797 TCTGCCATGCAGAGAGCACAGGG - Intronic
1039870878 8:41544112-41544134 GCTGCAGTGCAGAGGTCAAAAGG + Exonic
1042004748 8:64168725-64168747 GCTGCTGTAGGGAGGGCACAGGG + Intergenic
1042167422 8:65959127-65959149 GCAGCTTTGCAGAGGGCCCAGGG + Intergenic
1042420207 8:68579616-68579638 GCTGATCTGCAGAGCGCACTTGG - Intronic
1044404190 8:91808722-91808744 CTGGCTATGCAGAGGACACAAGG + Intergenic
1044819865 8:96148691-96148713 GCTGCAAAGCACAGGGCTCAGGG + Intronic
1044943983 8:97373759-97373781 TCTACTTTGCACAGGGCACAGGG + Intergenic
1045594846 8:103641782-103641804 GGTGCCATGCAGAGATCACATGG - Intronic
1048457083 8:134587893-134587915 CCTGCTATGCACAGGGCACAGGG + Intronic
1049248909 8:141577775-141577797 GCTGCTTGGAGGAGGGCACATGG + Intergenic
1049376040 8:142289666-142289688 GCTCCTATGCAGAGGGCTTGGGG - Intronic
1049421683 8:142519415-142519437 GCTGGAGAGCAGAGGGCACAGGG - Intronic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1049871435 8:144980944-144980966 GTTGCTATTCAGTGGGTACAGGG + Intergenic
1052548345 9:29910572-29910594 GGTGCTATGCAGAGTGCAAGGGG + Intergenic
1057865185 9:98674763-98674785 CCTGCTATGAACAGGGCTCAAGG + Intronic
1060884261 9:127139533-127139555 GCTGCTATGCACAGAGCCCAAGG - Intronic
1061119953 9:128636211-128636233 CCCGCCCTGCAGAGGGCACAAGG - Intronic
1061712469 9:132497731-132497753 GCAGCTATGCAGACGGCATGAGG + Intronic
1061927591 9:133813540-133813562 GCTGCAATGCACAAGCCACACGG + Intronic
1062059603 9:134487934-134487956 GCGCCCATGCAGAGGGCACGTGG - Intergenic
1062523229 9:136968245-136968267 GCTGGTGTGCAGGGGGCTCAGGG - Intergenic
1186193246 X:7086698-7086720 GCTGCTAGGGAGAGGGCCCTTGG + Intronic
1188986209 X:36770625-36770647 GATGCTCAGCAGAGGGTACATGG - Intergenic
1189196579 X:39158787-39158809 GCCCCTCTGCAGAGAGCACACGG - Intergenic
1192436928 X:71148737-71148759 GCTGCTCTGCAGGCGGCACATGG - Intronic
1193203068 X:78715091-78715113 GCTGCTTTGCACAGGTCACCAGG - Intergenic
1195382592 X:104284833-104284855 GCTGCTCTGCAAAGGGGAGATGG + Intergenic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1200139355 X:153891022-153891044 TCTGCCATGCAGAGCCCACAAGG + Intronic