ID: 902867561

View in Genome Browser
Species Human (GRCh38)
Location 1:19289196-19289218
Sequence GGCTCAAGACAGCGTCCCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902867552_902867561 28 Left 902867552 1:19289145-19289167 CCTAGGGCTGTCGCGCCTGCCGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 902867561 1:19289196-19289218 GGCTCAAGACAGCGTCCCCATGG 0: 1
1: 0
2: 2
3: 9
4: 112
902867555_902867561 13 Left 902867555 1:19289160-19289182 CCTGCCGTGTGGTCCTGGAGAAT 0: 1
1: 1
2: 2
3: 16
4: 136
Right 902867561 1:19289196-19289218 GGCTCAAGACAGCGTCCCCATGG 0: 1
1: 0
2: 2
3: 9
4: 112
902867556_902867561 9 Left 902867556 1:19289164-19289186 CCGTGTGGTCCTGGAGAATGAGG 0: 1
1: 1
2: 2
3: 28
4: 226
Right 902867561 1:19289196-19289218 GGCTCAAGACAGCGTCCCCATGG 0: 1
1: 0
2: 2
3: 9
4: 112
902867558_902867561 0 Left 902867558 1:19289173-19289195 CCTGGAGAATGAGGCTTACCAAA 0: 1
1: 1
2: 0
3: 12
4: 140
Right 902867561 1:19289196-19289218 GGCTCAAGACAGCGTCCCCATGG 0: 1
1: 0
2: 2
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902867561 Original CRISPR GGCTCAAGACAGCGTCCCCA TGG Exonic
901511597 1:9720577-9720599 GGCTGCACTCAGCGTCCCCAGGG - Intronic
902865443 1:19274563-19274585 GGCTCAAAACAGCGTCCCCGTGG + Intergenic
902867561 1:19289196-19289218 GGCTCAAGACAGCGTCCCCATGG + Exonic
904277634 1:29394757-29394779 TGCTCAATACAGGGTTCCCACGG - Intergenic
905206128 1:36343814-36343836 GGCACAAGGCTGCGTCCTCAGGG - Intronic
905869498 1:41395011-41395033 GGCTCAAGGCATCTTCCCCAGGG + Intergenic
911062768 1:93762152-93762174 GGCTGAAGACAGCAGCACCAGGG + Intronic
920718853 1:208367892-208367914 GGGTCAAGACAGGGCCTCCAAGG - Intergenic
922771182 1:228184027-228184049 GGCTGAAGCCATCATCCCCAGGG + Intergenic
1064031875 10:11887728-11887750 GGGGGAAGGCAGCGTCCCCAGGG + Intergenic
1065933813 10:30502795-30502817 GGGAAAAGACAGTGTCCCCAGGG - Intergenic
1066202374 10:33154261-33154283 ATCTCAAGCCAGTGTCCCCACGG - Intergenic
1067683976 10:48456496-48456518 GGCTCAAGCCTGGGTACCCAGGG - Intronic
1067705493 10:48604075-48604097 GGCTAGAGACAGCATCTCCATGG - Intronic
1070988954 10:80714741-80714763 GGGTCAAGACAGCCTTCCCCTGG + Intergenic
1072803791 10:98411231-98411253 GGCTCATGAGAGCATCGCCAGGG + Intronic
1072963809 10:99954414-99954436 GGCTCAAGACAGCCTATCTAGGG + Intronic
1081800101 11:45852582-45852604 GGCTCAGGACAGCCACCACACGG - Intronic
1084381955 11:68818246-68818268 GGCTCAAGACAGGAGCCCGAGGG - Intronic
1089686188 11:120148191-120148213 GGCTCAGGACAGACACCCCAAGG - Intronic
1091170458 11:133515790-133515812 GGGTCAAGGCAGGGTCTCCAAGG + Intronic
1102027399 12:109721287-109721309 GGCCCAGAACAGCGTCCCCTCGG - Intronic
1102977682 12:117218287-117218309 GGCTGAAGCCAGTGTCCCCGAGG + Intronic
1104635796 12:130437267-130437289 GGCTGAAGTCATCTTCCCCACGG - Exonic
1107560207 13:41551382-41551404 GGCTCCAGACTGGGTCCCTATGG - Intergenic
1119536415 14:75406422-75406444 GGGCTAAGACAGAGTCCCCAGGG - Intergenic
1122055147 14:99092876-99092898 AGCCCATGACAGCCTCCCCAGGG - Intergenic
1122859636 14:104576778-104576800 GGCTCAAGACAGCCTCAGCTGGG + Intronic
1122921381 14:104881789-104881811 GGGTCAAGAGGGAGTCCCCAGGG + Intronic
1129114586 15:73358157-73358179 GGCTCAAGATAGAGGACCCAGGG + Intronic
1130977828 15:88790757-88790779 GGCTGAAGACAGTGCCCCAAGGG - Intergenic
1135636845 16:24084932-24084954 TGCTCTAGACAGTGTCCCCAGGG - Intronic
1141760787 16:86027124-86027146 GGCTCTGGTCAGCGTCACCAAGG - Intergenic
1144264203 17:13552471-13552493 TGATCAATACAGCTTCCCCAAGG + Intronic
1145785746 17:27592759-27592781 GGCTCAAGATATGATCCCCAAGG - Intronic
1146176124 17:30667626-30667648 GGCCGCAGACAGCGGCCCCAGGG + Intergenic
1153512413 18:5869994-5870016 GTCTCAGGGCAGCATCCCCAAGG + Intergenic
1156600716 18:38602679-38602701 GGCTGAAGCCAGCTTCCCCATGG + Intergenic
1160868847 19:1267950-1267972 GGCTCAAGACCCCCTCCCCCAGG - Intronic
1161171248 19:2813446-2813468 GGCTAGAGACGGCGTCCTCAAGG + Exonic
1161619593 19:5291139-5291161 GGCTCAGGGCACTGTCCCCAGGG + Intronic
1162819198 19:13212497-13212519 GGCTCACGAAAGCGGCCTCAAGG - Exonic
1164811504 19:31160461-31160483 GCCTCAAGACAGAGTATCCAGGG - Intergenic
1166041345 19:40204766-40204788 GACTCTAAACAGCCTCCCCATGG + Intronic
1167037703 19:47003859-47003881 GGGTCAAGCCAGCATCCCCTTGG + Exonic
1167117923 19:47498857-47498879 TGCTCAACACCACGTCCCCAGGG + Intronic
1167896406 19:52585646-52585668 GGCCCAAGCGAGCGTCTCCAGGG + Exonic
1168290657 19:55355433-55355455 GGCTTAGGAGAGCGTCCCCCAGG + Intronic
925111435 2:1341618-1341640 GTCTTAAGACTGCCTCCCCAGGG - Intronic
926425897 2:12738441-12738463 GGATTAAGACAGCATCCACAAGG - Intronic
927642110 2:24852101-24852123 GGCTCTGGACACCCTCCCCAGGG + Intronic
931547376 2:63404213-63404235 GGCTGAAGACCGCTTACCCAGGG - Exonic
934939832 2:98492685-98492707 GGCTCTAGAAAGGGTGCCCATGG + Intronic
939289817 2:140179814-140179836 GGCTCACCTCAGAGTCCCCAAGG + Intergenic
945028822 2:205644480-205644502 GGCTCTAGACTGCCTCCCTAGGG - Intergenic
1169139542 20:3219375-3219397 GGCTCAAGAAAGCCTCCCGCTGG - Intronic
1170666804 20:18393669-18393691 GGCTGAAGACAACATCCACAAGG + Intronic
1170837625 20:19898073-19898095 GACTCAAGTCAGCGCCCCCAAGG + Intronic
1170938575 20:20830219-20830241 GCCCCAACACAGAGTCCCCACGG + Intergenic
1171447423 20:25214515-25214537 GGCTTAGGACAGGGTCTCCAGGG + Intronic
1172408326 20:34705003-34705025 GGCTCCAGACTCCGCCCCCAGGG + Intronic
1183085292 22:35483379-35483401 GGGACAAGACAGCATGCCCAGGG - Intergenic
1184538592 22:45104444-45104466 GGCTCAGGCCAGTGTCCACATGG - Intergenic
1184649634 22:45913608-45913630 GGCTCTGGACAGGGACCCCAGGG - Intergenic
1185289995 22:50018853-50018875 TGCTCAAGACAGTGTCCCTTAGG - Intronic
950788616 3:15455236-15455258 GGCTCAAGGCAGAGGCCACATGG - Intronic
953407753 3:42667882-42667904 TGCTCATCACAGCATCCCCAGGG - Intergenic
954593237 3:51802077-51802099 GTCTCATGACAGCCTCCCAAGGG - Intergenic
958712373 3:97732899-97732921 GGCTCAAGACAGATTTCGCAAGG + Intronic
959358366 3:105360124-105360146 GGCTCAAGAGAGCCTCCCAAAGG + Intergenic
961198243 3:125021970-125021992 GGCTCTTGACAGTTTCCCCATGG - Intronic
961807839 3:129502061-129502083 GGCTCACCACTGCTTCCCCATGG - Intronic
970155573 4:13138267-13138289 GGCTCATGACACCTTCCTCATGG + Intergenic
970990630 4:22209378-22209400 GACTCAAAACATGGTCCCCAGGG - Intergenic
974652961 4:64778639-64778661 AGTTCAAGACAGAGACCCCAGGG + Intergenic
977245256 4:94623442-94623464 GGCTCAAGAAAGCTTCACAAAGG - Intronic
979228107 4:118313527-118313549 AGCTCTAAACTGCGTCCCCAAGG - Intronic
981898681 4:149835597-149835619 GGCTCAAGACAGCGCCCTCAAGG + Intergenic
985538685 5:478009-478031 GGCTGGAGTCAGGGTCCCCAGGG + Intronic
997197174 5:131987941-131987963 GGCCCAAAACAGCCACCCCAGGG + Intronic
1002049527 5:176562276-176562298 GGCTGAGGACAGTGTCCCCAGGG + Intronic
1003116041 6:3284529-3284551 GGCTCAGCTCAGCTTCCCCAAGG + Intronic
1004617119 6:17301152-17301174 GGCTCAAGACAGAGAACCAATGG - Intergenic
1004923214 6:20395896-20395918 GGCACAAGAAAGGGTCCTCAGGG + Intergenic
1016901669 6:149108844-149108866 GGCCCAAGGCAGTGTCCTCATGG + Intergenic
1020010840 7:4805199-4805221 GGCTCAGGGATGCGTCCCCACGG + Intronic
1021763811 7:23927278-23927300 GGCTCAGGACAGCAGCCCCATGG - Intergenic
1022531326 7:31068701-31068723 TTCTCAGGACAGCCTCCCCAGGG - Intronic
1022602567 7:31775711-31775733 GGCACAAAACAGCGTTCTCACGG - Exonic
1025940944 7:66075918-66075940 CGCTCACGTCCGCGTCCCCAAGG + Intronic
1027968135 7:85040209-85040231 GGCTCAAGCCATCCTCCCCTTGG + Intronic
1028283723 7:88967618-88967640 TGCTCTAGACTGCCTCCCCACGG - Intronic
1032480349 7:132241036-132241058 GGCACGAGGCAGCCTCCCCATGG + Intronic
1032856022 7:135834213-135834235 GGCTCAAAAAAGCAGCCCCAAGG - Intergenic
1038183152 8:25247669-25247691 TCCTCAAGACAGCATCCCTATGG + Intronic
1048528361 8:135225190-135225212 GGGACAAGAGAGCGTCCCCAAGG - Intergenic
1048746087 8:137616122-137616144 GTCTGGAGACATCGTCCCCACGG + Intergenic
1049545820 8:143230047-143230069 GTCTCAGGAAAGCGTCCCTAGGG - Intergenic
1054350883 9:64016170-64016192 GGCTCAAACCAGGGTCGCCAGGG + Intergenic
1056486277 9:87061419-87061441 GGCTCCTGACACCGTCCCCGGGG + Intergenic
1057581889 9:96294474-96294496 GGCTAAGGACAGCTTCCACATGG + Intronic
1060509538 9:124222098-124222120 GTGTCAAGACAGCTGCCCCAGGG + Intergenic
1060524760 9:124314191-124314213 GGCTGTAGGCAGCGACCCCAAGG - Intronic
1060529653 9:124340749-124340771 TGCTCAGGACAGCGTGTCCAGGG + Intronic
1061412267 9:130428106-130428128 GGCTGCAGACAACGTCCCCTTGG - Intronic
1062561614 9:137144707-137144729 GGGTCTAGAAAGTGTCCCCAGGG + Intronic
1062561633 9:137144764-137144786 GGGTCCAGAAAGTGTCCCCAGGG + Intronic
1062561655 9:137144824-137144846 GGGTCTAGAAAGTGTCCCCAGGG + Intronic
1062561780 9:137145168-137145190 GGGTCTAGAAAGTGTCCCCAGGG + Intronic
1062561842 9:137145339-137145361 GGGTCCAGAAAGTGTCCCCAGGG + Intronic
1062561864 9:137145399-137145421 GGGTCTAGAAAGTGTCCCCAGGG + Intronic
1062561904 9:137145518-137145540 GGGTCTAGAAAGTGTCCCCAGGG + Intronic
1062607510 9:137354803-137354825 GGCTCAGGGCAGCCTCACCACGG + Intronic
1189378109 X:40481451-40481473 GACACAAGACAAAGTCCCCAAGG - Intergenic
1192360389 X:70435175-70435197 GGCTCAAGGCTGCGTACCCAAGG - Intergenic
1198346710 X:135767133-135767155 GGGTCGAGACAGAGTTCCCAAGG + Intronic
1198348617 X:135784421-135784443 GGGTCGAGACAGAGTTCCCAAGG + Intergenic
1198350521 X:135801691-135801713 GGGTCGAGACAGAGTTCCCAAGG + Intronic
1198352429 X:135818958-135818980 GGGTCGAGACAGAGTTCCCAAGG + Intronic
1198354338 X:135836226-135836248 GGGTCGAGACAGAGTTCCCAAGG + Intronic
1198356247 X:135853480-135853502 GGGTCGAGACAGAGTTCCCAAGG + Intronic
1198358161 X:135870754-135870776 GGGTCGAGACAGAGTTCCCAAGG + Intergenic
1198360075 X:135888032-135888054 GGGTCGAGACAGAGTTCCCAAGG + Intronic
1200778029 Y:7187228-7187250 GGCTACAGTCAGTGTCCCCAAGG + Intergenic