ID: 902871432

View in Genome Browser
Species Human (GRCh38)
Location 1:19315853-19315875
Sequence GACTCTGTAGTTTCCTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902871432 Original CRISPR GACTCTGTAGTTTCCTGGCT GGG Intronic
900515659 1:3081068-3081090 GGCTCTCTGGTTTCATGGCTGGG + Intronic
900661757 1:3788203-3788225 CACTCTGCTCTTTCCTGGCTTGG + Intronic
902871432 1:19315853-19315875 GACTCTGTAGTTTCCTGGCTGGG + Intronic
903494150 1:23753210-23753232 GACTCTGAAGTTTGATGGCTTGG + Intronic
904713494 1:32449178-32449200 GACTCTGTAGGGTCCAGCCTGGG - Intergenic
904817818 1:33219152-33219174 AACTCTGTCATCTCCTGGCTGGG + Intergenic
906881541 1:49596620-49596642 AACTCTGAAGTATCCTTGCTGGG + Intronic
906903223 1:49860946-49860968 CACTCTGTAGCTGCCTGGGTTGG - Intronic
908116231 1:60943104-60943126 GCCTCTGCAGCTTCCTGGATCGG - Intronic
908393754 1:63706517-63706539 GGCTCAGTACTTTCCTGGCAAGG - Intergenic
908399378 1:63756071-63756093 GACTCAGGAGTTTCCTGGGAGGG - Intergenic
908829880 1:68168313-68168335 CACTTTGTACTATCCTGGCTGGG - Intronic
910678167 1:89835618-89835640 AGCTCTGTAGTTTACTGCCTGGG + Intronic
912311471 1:108625519-108625541 GACTCTGAAATTTCCTGTTTTGG + Intronic
912396854 1:109352036-109352058 GTCACTCTAGTTTCCTGGTTGGG + Intronic
912968747 1:114260555-114260577 GGCTCAGTGGTTTCCTGGTTGGG + Intergenic
913352804 1:117880648-117880670 CACTCTGTAGTTTACAGTCTGGG + Intronic
917443462 1:175087025-175087047 AGCTCTGTCCTTTCCTGGCTGGG - Intronic
917690515 1:177463499-177463521 GCCTGTGTAATCTCCTGGCTTGG - Intergenic
918352488 1:183671593-183671615 GACTCTGTAGTTTCTTCATTTGG + Intronic
919537942 1:198811558-198811580 GACTGTGTTTTTTCCTGTCTGGG - Intergenic
919639219 1:200033136-200033158 TACTCTGGAGTTTCCTGGAAAGG + Intronic
919760804 1:201097032-201097054 GACCCTGGAGGTTTCTGGCTTGG - Intronic
924812496 1:247415776-247415798 GACTCTGGAGTTTGAAGGCTGGG + Intergenic
1062830593 10:602837-602859 CACCCTGTAGTTTCCTGCCATGG - Intronic
1065757060 10:28940362-28940384 GCCTCTCTCGTTTCCTGTCTAGG - Intergenic
1067896577 10:50187414-50187436 TATTCTGTAGATTCCAGGCTGGG + Exonic
1067952395 10:50754619-50754641 TATTCTGTAGATTCCAGGCTGGG - Exonic
1068590996 10:58852980-58853002 AGCTCTGTGGTCTCCTGGCTGGG + Intergenic
1069744852 10:70708669-70708691 GATGCTGTAGCTGCCTGGCTTGG - Exonic
1069840901 10:71338779-71338801 AACTCTGTCATTTGCTGGCTTGG + Intronic
1071817058 10:89243010-89243032 GATTCTGCAGATTCCAGGCTAGG + Intronic
1072284506 10:93900045-93900067 CTCTGTGTAGGTTCCTGGCTAGG - Intronic
1075636364 10:124033615-124033637 GACGCTCTAGCTTGCTGGCTTGG + Intronic
1076228679 10:128801982-128802004 GACACTATGGTTTCCTCGCTCGG + Intergenic
1079582533 11:22083928-22083950 TACTCTCGTGTTTCCTGGCTAGG + Intergenic
1079936224 11:26619760-26619782 GAATCTGTAGTTTTTTGGCCGGG - Intronic
1080689539 11:34544981-34545003 GATTCTGGAGGTTCCTGGTTTGG + Intergenic
1083235490 11:61348171-61348193 AGCTCTGTCATTTCCTGGCTGGG + Exonic
1085193623 11:74651419-74651441 GACTGTGTAGTTTTAGGGCTTGG - Intronic
1085279145 11:75319076-75319098 GTCTCCGTAATTTCCTGGCTGGG - Intronic
1085399765 11:76228850-76228872 CAGTCTCTAGATTCCTGGCTGGG + Intergenic
1085796295 11:79543048-79543070 GAGACTGCAGTTTCTTGGCTTGG + Intergenic
1088598808 11:111458057-111458079 GACTCTGGACTCTCCTGGCACGG - Intronic
1090003656 11:122981989-122982011 GGCTCTGTTGTTCCCAGGCTCGG - Intergenic
1091168198 11:133499013-133499035 GGCCCTGTAGCTTCCAGGCTTGG - Intronic
1091321026 11:134651603-134651625 GACTCTGATGTTTCTTGGCATGG + Intergenic
1093029884 12:14278641-14278663 GACTGTGTAGGCTCCTGCCTGGG - Intergenic
1093338650 12:17942808-17942830 GACTTTGTAGTTCCTAGGCTAGG - Intergenic
1093795928 12:23310518-23310540 GAGTCTGAGGTTTCATGGCTGGG - Intergenic
1094224167 12:28026855-28026877 CATTCTGTGGTTTTCTGGCTAGG - Intergenic
1094348657 12:29498946-29498968 GACTCCTTAGTTTCATGCCTGGG + Intergenic
1099343168 12:81464686-81464708 CACTCTTTAATTTCCTGTCTAGG - Intronic
1101142218 12:101808261-101808283 GACTCTAAAGTTACATGGCTGGG + Intronic
1102330636 12:112026171-112026193 GGCTCAGCAGTTTCCTGCCTTGG + Intergenic
1103558369 12:121779337-121779359 AACTCTCTCCTTTCCTGGCTGGG - Exonic
1107636568 13:42398249-42398271 GGCTCTGCCATTTCCTGGCTTGG - Intergenic
1107836882 13:44419207-44419229 GATTGAGTAGGTTCCTGGCTTGG - Intergenic
1108416361 13:50201683-50201705 GCCTGTGTAGTTGCCTGCCTGGG + Intronic
1112660429 13:101501587-101501609 AACACTGTGGTTTCCTTGCTGGG - Intronic
1115889405 14:38010453-38010475 GACTCTCGAGCTGCCTGGCTGGG + Intronic
1120840171 14:89078569-89078591 GTCTTTGAAGCTTCCTGGCTTGG - Intergenic
1121986764 14:98514333-98514355 GACTCTGTAGCTTACTAGCTTGG + Intergenic
1122916790 14:104863152-104863174 TCCTCTGTGGGTTCCTGGCTTGG + Intergenic
1126963616 15:54026826-54026848 AAATCTTTAATTTCCTGGCTGGG + Intronic
1128744538 15:70104124-70104146 TTCTCTGTAGTGCCCTGGCTGGG - Intergenic
1130213964 15:81951357-81951379 GACTCTCAAGTTTACTGGCTTGG - Intergenic
1132303706 15:100793011-100793033 GACTCTGATGTGCCCTGGCTTGG - Intergenic
1132622593 16:874840-874862 AACATTGTAGTGTCCTGGCTGGG - Intronic
1133172064 16:3987730-3987752 AACTCCGTGGTGTCCTGGCTTGG - Intronic
1133866463 16:9648371-9648393 GTCTCTGTCATTTCCTAGCTAGG + Intergenic
1136497229 16:30651728-30651750 GGCTCTGTAGTTTCCCGGCACGG - Intronic
1138373856 16:56548988-56549010 GACTCCCTATTTTCCTTGCTGGG + Intergenic
1143111614 17:4556040-4556062 GTCTCTGTAGTTGCAAGGCTTGG - Intergenic
1143661510 17:8327219-8327241 GACTCTGGGGTCTCCTGGCCTGG + Intergenic
1146796288 17:35783707-35783729 GCGTCTCTTGTTTCCTGGCTGGG + Intronic
1149655260 17:58306471-58306493 GACTCTGGAGTTTCCTCTCAGGG + Intronic
1151132749 17:71915157-71915179 GACTGGGTGGTTTCCTGTCTGGG - Intergenic
1152482788 17:80566523-80566545 GAATGTATATTTTCCTGGCTGGG + Intronic
1203190671 17_KI270729v1_random:184340-184362 GACTAGTTAGTTTCTTGGCTTGG - Intergenic
1158702957 18:59765749-59765771 GCCTCTAAAGTTTCCTGCCTAGG + Intergenic
1160156317 18:76436520-76436542 GACTCAGCGGTGTCCTGGCTTGG - Intronic
1160197422 18:76767500-76767522 GGCTCTCTCCTTTCCTGGCTTGG + Intergenic
1160215452 18:76925156-76925178 GCCTCTGTTGATTCTTGGCTGGG + Intronic
1161041828 19:2114532-2114554 GACTCTGAAGTCTCCAGGCCTGG - Intronic
1162867255 19:13557557-13557579 GACTGTCTAGTTGGCTGGCTTGG + Intronic
1163316943 19:16547121-16547143 GAGACTCTAGTCTCCTGGCTTGG + Intronic
1165023812 19:32944963-32944985 GACTCTGTCGTTTCTAGGCATGG - Intronic
1165613358 19:37176532-37176554 GACTCTGTAGTTATCTGTCCTGG + Intronic
1167661609 19:50798924-50798946 CACTCTGCTGTTTCCTGCCTAGG - Exonic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
1168546597 19:57256854-57256876 GACTCAGTGGTTTCCTGACGTGG + Intergenic
925381006 2:3426304-3426326 GACTCTGTGGCTACCTAGCTTGG - Intronic
925470270 2:4153572-4153594 GACTCTGTGGTTTCAAGCCTGGG - Intergenic
925976915 2:9148166-9148188 GACTCTGTAGTGTGCTGGTGGGG - Intergenic
926638947 2:15214544-15214566 GAATCTGTGATTTCATGGCTAGG + Intronic
927691175 2:25209345-25209367 GAGACTGTGGTTGCCTGGCTTGG - Intergenic
928627284 2:33153298-33153320 GACTCTGTATTTTCCTTGCTTGG + Intronic
932546699 2:72719089-72719111 GACTCTGTAGCTTTCTTGCCTGG + Intronic
935428988 2:102952933-102952955 GACTCTATAATTTCCTAGGTTGG + Intergenic
937282560 2:120730305-120730327 TACCCTGTAGTCCCCTGGCTGGG - Intergenic
937710810 2:124978275-124978297 GAGTCTGAAGTGTCCTGGGTGGG - Intergenic
939883533 2:147656757-147656779 GACTGTGTTGTTGGCTGGCTGGG - Intergenic
944996275 2:205297741-205297763 GACTCTGGAGTTTTCAGGATTGG - Intronic
946654805 2:221935359-221935381 GACTATGTAATTTACAGGCTTGG - Intergenic
947706042 2:232276453-232276475 GGCTGCCTAGTTTCCTGGCTGGG + Intronic
948659001 2:239495259-239495281 GAGTATGTAGATTCTTGGCTGGG + Intergenic
1168860999 20:1046048-1046070 GGCTGTGTGGTTTACTGGCTAGG + Intergenic
1169564507 20:6838950-6838972 GGATCTTTATTTTCCTGGCTTGG + Intergenic
1169609961 20:7367542-7367564 GTATCTGTAGCTTTCTGGCTGGG + Intergenic
1170653328 20:18262952-18262974 GTTTTAGTAGTTTCCTGGCTTGG - Intergenic
1172739686 20:37156164-37156186 TACTTTGTACTTTCCTGCCTTGG - Intronic
1172966721 20:38840699-38840721 GACAGTGTAGTGTCATGGCTAGG + Intronic
1175739572 20:61411274-61411296 AACTGTGTAGTTTCCTGACAAGG + Intronic
1178464992 21:32839919-32839941 GCCTCTGCAGTTTCCTATCTGGG + Intergenic
1182668073 22:31973453-31973475 GACTCTGTTGCTTTCTGGCTTGG + Intergenic
1184361007 22:44018657-44018679 GGCTCTGGGGTTTCCTCGCTTGG + Intronic
949771301 3:7581617-7581639 GATTCTGTAGGTTGCTGGCTTGG - Intronic
953714959 3:45309341-45309363 AATTCTTTAGTTTCCTGGTTAGG + Intergenic
956540141 3:70327583-70327605 GACTCTGAAGTTTCCTCACTTGG - Intergenic
956741990 3:72282353-72282375 GACTCTGTAGAGTCCTGGGATGG - Intergenic
958032908 3:88134966-88134988 GATTCTATAGTGCCCTGGCTGGG - Intronic
958188362 3:90152589-90152611 GGATCTGCATTTTCCTGGCTTGG + Intergenic
959196774 3:103193197-103193219 GAATGTGTAGTTTCAGGGCTAGG + Intergenic
959860415 3:111209159-111209181 CACTGTGTAGTTTCCTGGCCGGG - Intronic
961635515 3:128330426-128330448 CGCTCTGTTGTTTCCTGGATCGG - Intronic
961647063 3:128398245-128398267 GGCTCTGTAGCATCTTGGCTTGG - Intronic
963056706 3:141192154-141192176 GTCTCTGCAACTTCCTGGCTTGG - Intergenic
965400871 3:168210768-168210790 GAGACTGTATTTTTCTGGCTTGG + Intergenic
967092419 3:186146440-186146462 GACTGTGAAGTTTCCTTCCTTGG + Intronic
967757559 3:193187223-193187245 GGCTCTGAAGTTTTCTGGTTGGG - Intergenic
967983715 3:195080418-195080440 GGCTCTGTGGTTTCCTGGTTGGG - Intronic
968548647 4:1211223-1211245 GACGCTGTAGGGTCCTGGCTTGG - Intergenic
970081392 4:12291187-12291209 GGCTCTGTAGTTTCCTTCATGGG + Intergenic
970353528 4:15229770-15229792 AACTCTGCAGTTTCCTTTCTAGG - Intergenic
970586113 4:17515949-17515971 GGCTCTACTGTTTCCTGGCTGGG - Intronic
970913791 4:21309177-21309199 GTCTCTCTAGATTCCAGGCTGGG + Intronic
975101275 4:70516050-70516072 GACTGCTCAGTTTCCTGGCTAGG + Intergenic
975697496 4:77028006-77028028 GTCTCTTTAGTTTACTTGCTGGG + Intronic
976794322 4:88915381-88915403 AACTCTGTAATTTTCTGGCTTGG + Intronic
981487340 4:145301292-145301314 TACTCTGCAGATTCCTGCCTGGG - Intergenic
984206993 4:176797311-176797333 GCCTCTTGAGCTTCCTGGCTTGG + Intergenic
985608498 5:872421-872443 GGCTCTGTGGTTTCCTCTCTGGG - Intronic
987284701 5:16444071-16444093 GACTATGTAGTTTCCAGGGTTGG + Intergenic
987926260 5:24345906-24345928 GAATCTGTAGTTTTCTGAGTGGG - Intergenic
988459368 5:31418842-31418864 GAATTTGTAGTCTCCTGCCTGGG - Intronic
989447285 5:41545017-41545039 GACTCTTTTCTTTTCTGGCTGGG + Intergenic
990695313 5:58409753-58409775 GACTTTCTAGTTTCCAGGGTAGG - Intergenic
992184354 5:74229415-74229437 GACTGTGTGGTTTCCCGACTTGG + Intergenic
993832730 5:92779568-92779590 CACTCTGTAGCCTCATGGCTAGG + Intergenic
994113579 5:96036556-96036578 GACTCTCTAGTGGCCTTGCTTGG + Intergenic
994979028 5:106848582-106848604 AATTTTGTACTTTCCTGGCTTGG + Intergenic
995871552 5:116748758-116748780 GGCCCTGGAGTTTCCTGTCTTGG + Intergenic
999503598 5:152171583-152171605 GACTCAGCAGTTTCTTTGCTCGG - Intergenic
1000255789 5:159537028-159537050 GACTGTGTATATTCCTGGTTTGG + Intergenic
1001126321 5:169022818-169022840 CACTCTCTTGTTTCTTGGCTTGG - Intronic
1003553174 6:7117077-7117099 TACCCTGTAGATTTCTGGCTTGG - Intronic
1005314139 6:24587957-24587979 GATTCTGCACTTTCCTGGATGGG - Intronic
1005695562 6:28349862-28349884 GACTCTGTCGTTTGCTAGCTCGG - Intronic
1005757703 6:28940156-28940178 GACTCTGCAGTCTACAGGCTTGG - Intergenic
1006989251 6:38199306-38199328 GACTCTCCAGTCTCCTGCCTGGG - Intronic
1007576792 6:42930130-42930152 GCCTCTGTAGTTTCCTGAGTGGG - Intronic
1008725203 6:54409091-54409113 GACAATGTACTTTGCTGGCTTGG + Intergenic
1014465207 6:121748609-121748631 GACTTGGTATTTTCCAGGCTTGG + Intergenic
1015772531 6:136783779-136783801 GGTTCTCTACTTTCCTGGCTTGG + Intronic
1016619730 6:146094284-146094306 GACTGTCTCTTTTCCTGGCTGGG + Intronic
1016809070 6:148242396-148242418 GACTCTGTATTTTGGTAGCTTGG + Intergenic
1021408126 7:20297793-20297815 GCCACTGTAGATGCCTGGCTGGG + Intergenic
1022334864 7:29412617-29412639 GACTCTTTAGTGTCCTGGCGCGG - Intronic
1028717069 7:93983081-93983103 GACTCTCTTATTTCCTGGCCTGG - Intronic
1028961917 7:96758598-96758620 CAGTCTGTAGTTTCCTTGATTGG + Intergenic
1030317166 7:108127644-108127666 GAATCAGTAGGTCCCTGGCTGGG - Intronic
1031826920 7:126576876-126576898 GACTCTGTTGTATCCTTTCTAGG + Intronic
1033871367 7:145758010-145758032 GACTCTGTAATTTCTTTACTGGG + Intergenic
1035891401 8:3347422-3347444 GATTCTGTCTTGTCCTGGCTTGG + Intronic
1038062474 8:23928377-23928399 AGCTCTTTAGTTTCCAGGCTGGG + Intergenic
1038409930 8:27350378-27350400 GACCCTATAATTGCCTGGCTGGG - Intronic
1038645832 8:29361404-29361426 GACTTTGAGGTTTCCTGCCTGGG + Intergenic
1038679563 8:29654113-29654135 GACTCCCAAGTATCCTGGCTGGG - Intergenic
1041773559 8:61498828-61498850 GACTCTGTCCCTTACTGGCTGGG - Intronic
1042036292 8:64538075-64538097 GTCCCTGTAGTTGCCTGCCTGGG - Intergenic
1042521236 8:69713350-69713372 GATTCTGCTGTTGCCTGGCTGGG + Intronic
1043183099 8:77109677-77109699 GACTCTGGAGCTACCTGACTAGG + Intergenic
1043973420 8:86558383-86558405 GCTTCTGTTGTTTCGTGGCTGGG - Exonic
1045430903 8:102114373-102114395 GCCTCTTTAGTTTTCTGGTTGGG - Intronic
1046664544 8:116986366-116986388 GCCTCTGTAGTCTCCTGGTTGGG + Intronic
1047840926 8:128751043-128751065 GATTCTGTTGTCTTCTGGCTTGG - Intergenic
1049007462 8:139864560-139864582 CACTCTGTGACTTCCTGGCTAGG + Intronic
1053480857 9:38415276-38415298 GACTCTGCAGTTTGATGGCCTGG - Intronic
1054970203 9:71077142-71077164 GAATCTGTATTTTCCTGTTTAGG - Intronic
1056667394 9:88591596-88591618 GACTCTGTGGCTTCCTGGCAAGG + Intergenic
1059391211 9:114000841-114000863 AACTCTGTCATTTACTGGCTGGG - Intronic
1059403903 9:114088068-114088090 GGCTCTGCAGGTTCCTGCCTGGG - Intronic
1059657304 9:116368488-116368510 GCCTCTGTAGTCATCTGGCTGGG - Intronic
1186633171 X:11373014-11373036 GAATCTTTAGTTTCATGGTTAGG - Intronic
1193197213 X:78646819-78646841 GGTTATGTAGTTTCCTGGTTTGG - Intergenic
1196141950 X:112273144-112273166 GACTCTGTCACTTCCTAGCTGGG + Intergenic
1198685612 X:139225288-139225310 GGCCCTGCAGCTTCCTGGCTGGG + Intergenic