ID: 902872342

View in Genome Browser
Species Human (GRCh38)
Location 1:19322145-19322167
Sequence CAGCAAGCATCAGTGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902872335_902872342 -1 Left 902872335 1:19322123-19322145 CCTTGGAGGCTGTGGAAGCCTTC 0: 1
1: 0
2: 3
3: 29
4: 262
Right 902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG 0: 1
1: 0
2: 7
3: 56
4: 350
902872334_902872342 2 Left 902872334 1:19322120-19322142 CCACCTTGGAGGCTGTGGAAGCC 0: 1
1: 0
2: 0
3: 37
4: 268
Right 902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG 0: 1
1: 0
2: 7
3: 56
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902872342 Original CRISPR CAGCAAGCATCAGTGGTGGG GGG Intronic
900465991 1:2825721-2825743 CAGAAAGCAGCAGTGGAGTGGGG + Intergenic
900623952 1:3599744-3599766 GAGCAAGCATGAGTGCTGGCCGG - Intronic
901921390 1:12540188-12540210 CTCCAGGCATCCGTGGTGGGGGG + Intergenic
902694057 1:18128514-18128536 GAGCTTGCATCACTGGTGGGAGG - Intronic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
904339729 1:29826987-29827009 CACCCGGCATCAGTGCTGGGAGG + Intergenic
904936043 1:34130463-34130485 AAGCATGCAGGAGTGGTGGGAGG + Intronic
906684268 1:47752836-47752858 CAGCCAGAGTTAGTGGTGGGCGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
910861566 1:91747376-91747398 CTGCAAGCAGCAGTGAAGGGTGG - Intronic
910931401 1:92445963-92445985 CAGCAAGCATCAGTGAGGCTAGG + Intergenic
915231738 1:154450851-154450873 CAGCCAGCATCAGTGCAGGCAGG - Intronic
915919466 1:159963407-159963429 CAGCAAGCATTGCTGTTGGGAGG + Intergenic
916781634 1:168037171-168037193 CAGCGGGGCTCAGTGGTGGGAGG - Intronic
917111799 1:171556358-171556380 CAGGAAGCACAAGGGGTGGGGGG - Intronic
919833982 1:201561109-201561131 CAGCTTGCCTCTGTGGTGGGTGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921088823 1:211823447-211823469 GATCTAGCATCAGTGGTAGGTGG - Intronic
922532964 1:226358310-226358332 CAGAATGCCACAGTGGTGGGTGG + Intergenic
922597055 1:226822194-226822216 CTGCACTCAGCAGTGGTGGGAGG - Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
922899132 1:229122822-229122844 AAGGCAGCATCAGTGCTGGGAGG + Intergenic
1065551003 10:26868499-26868521 AAGCTAGCATCAGTTGAGGGTGG + Intergenic
1065921445 10:30396854-30396876 CAGCAGGGTGCAGTGGTGGGAGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069624389 10:69858766-69858788 CAACAAGACTTAGTGGTGGGGGG - Intronic
1070407932 10:76113080-76113102 CAGAAGGCATCAGTGGGGAGAGG + Intronic
1070829751 10:79411093-79411115 CAGCAGGCAACAGTGATGGATGG + Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1073230774 10:101967720-101967742 GAGCAAGACTCAGTCGTGGGGGG + Intronic
1073765021 10:106672812-106672834 CAGGAAGCATGAGTGGTGTTGGG - Intronic
1074280674 10:112048665-112048687 AGGCAAGCATCAGTAGTGAGTGG + Intergenic
1074766313 10:116702471-116702493 CAGCAAATATCAGTGGAGGCCGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075130604 10:119735628-119735650 CAGGGAGCAACTGTGGTGGGTGG + Intronic
1075907091 10:126090990-126091012 AAGCCTCCATCAGTGGTGGGAGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076724343 10:132406504-132406526 CAACAAGCACCAGCGGTGGCTGG - Intronic
1077154119 11:1083902-1083924 CAGGAAGCATGGGTGGTGAGGGG + Intergenic
1077159364 11:1105699-1105721 CAACAGGGATCAGAGGTGGGGGG - Intergenic
1077280990 11:1745372-1745394 CAGAAAGCTCCAGTGTTGGGGGG - Intronic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081780736 11:45710114-45710136 CAACAAGCATGGGAGGTGGGAGG + Intergenic
1083854012 11:65383260-65383282 GAGAAAGCAGCAGGGGTGGGTGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085348778 11:75784940-75784962 CAGCAAGATTCAGTGGGAGGTGG + Intronic
1085393484 11:76194479-76194501 CAGCTTGCCCCAGTGGTGGGGGG - Intronic
1087686675 11:101273149-101273171 CAGCAAGCAGAAGAGGTGGGGGG - Intergenic
1087915289 11:103803028-103803050 CAGCCAGCATCACTTCTGGGAGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088715070 11:112541969-112541991 CAACAAGAGTCAGTGGTAGGGGG + Intergenic
1089082615 11:115789583-115789605 CAGCAACCCTCAGTGGAGAGGGG - Intergenic
1089642870 11:119859231-119859253 CAGGCAGCCTCAGAGGTGGGGGG + Intergenic
1089933140 11:122334632-122334654 CAGCTAGAAGCAGTGGTAGGAGG - Intergenic
1090416072 11:126541347-126541369 CATCAAGCATTAGGGTTGGGAGG - Intronic
1091641361 12:2239808-2239830 CAGCGAGCATCTGCGGGGGGCGG + Intronic
1092097096 12:5851753-5851775 GAGGAGGCATCAGAGGTGGGGGG + Intronic
1093660742 12:21753719-21753741 AAGCAAGCATCCCTGTTGGGAGG + Intronic
1095443929 12:42266718-42266740 CAGGAAGCCTCTGTGGCGGGTGG + Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096460305 12:51818526-51818548 CAGAAAGCAACGGGGGTGGGGGG + Intergenic
1096489268 12:52004965-52004987 CAGACAGCATCTGTGGGGGGTGG - Intergenic
1096997537 12:55848179-55848201 GTGCAAGCTGCAGTGGTGGGTGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1098092187 12:66915522-66915544 CAGCAGGCATCAGACGTGGGTGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099317447 12:81102443-81102465 CAGGAAGCATAAGTGGGGGAGGG + Intronic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1101747027 12:107550258-107550280 TGGCCAGCATCAGTGGTGTGAGG - Intronic
1102467102 12:113136110-113136132 GAGCAAGTATTAGTGGTGGGTGG + Exonic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105323237 13:19347055-19347077 CAGTGAGCATCAGAGCTGGGTGG - Intergenic
1105830285 13:24158122-24158144 CAGAAAGCATCAGTGTTGTTAGG + Intronic
1106619290 13:31358000-31358022 TAGCTAGCAGCAGTGGTGGGAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111647239 13:91046609-91046631 CAGGAAGCATCAGGGGTAAGGGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1114056771 14:18976054-18976076 CACCAAGTAACAGTGGTGTGAGG - Exonic
1114105780 14:19425685-19425707 CACCAAGTAACAGTGGTGTGAGG + Exonic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114648743 14:24270032-24270054 CAGCCAGCATCGGTGGTGCCAGG + Exonic
1114929454 14:27449455-27449477 GAGCCAGTGTCAGTGGTGGGGGG + Intergenic
1115961556 14:38839150-38839172 CAGCAAGCAGCAGGGAAGGGAGG - Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120244018 14:81984434-81984456 CAGCAAGTATCAGTGGCAGGTGG + Intergenic
1122764065 14:104053097-104053119 CACCAAGCAGCTGTGGTGGCTGG + Intergenic
1123144292 14:106112986-106113008 TAGGATGCATCAGGGGTGGGAGG + Intergenic
1123795168 15:23763662-23763684 CAGCCTGGAGCAGTGGTGGGAGG + Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126999135 15:54481696-54481718 ATGCAAGCACCAGTGGTGGTGGG + Intronic
1127570587 15:60237354-60237376 CAGGAAGCACAAGTGGTTGGGGG + Intergenic
1128997470 15:72307325-72307347 CAGCATGCCTGGGTGGTGGGAGG - Intronic
1129173340 15:73821454-73821476 CAGGAAGCATAAGCGGTGGCTGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129799742 15:78405346-78405368 CAGCAGGCTGCAGTGGTGGTGGG - Intergenic
1130376950 15:83337778-83337800 TAGTATGCATCATTGGTGGGAGG - Intergenic
1130841190 15:87702699-87702721 CAGCAGGCATCAGTATTGAGTGG - Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131978417 15:97970182-97970204 CAGAAAGCATTAGTCCTGGGAGG + Intronic
1132145952 15:99430051-99430073 CAGTAAGCATCCGTCGTGGTTGG - Intergenic
1133254603 16:4508972-4508994 CAGCAAGCAGCACTGGTGGGCGG - Intronic
1134518205 16:14904032-14904054 CAGTAAGCATGTGAGGTGGGTGG - Intronic
1134690325 16:16187029-16187051 AAGCCAGCATCAGTACTGGGGGG - Intronic
1134705876 16:16302690-16302712 CAGTAAGCATGTGAGGTGGGTGG - Intergenic
1134961664 16:18409420-18409442 CAGTAAGCATGTGAGGTGGGTGG + Intergenic
1134965964 16:18492023-18492045 CAGTAAGCATGTGAGGTGGGTGG + Intronic
1135017211 16:18933849-18933871 CAGCAAACATCAGGGATGGAAGG + Intergenic
1135805134 16:25535845-25535867 GAGCAAGAATGAGAGGTGGGAGG - Intergenic
1137685863 16:50386409-50386431 GAGCAGGCATCTGTGATGGGAGG - Intergenic
1140331660 16:74063312-74063334 CAGCAGGCATCAATGGTTGGAGG + Intergenic
1140507473 16:75482823-75482845 CAGGAGGCAACAGGGGTGGGTGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1143507956 17:7379957-7379979 CAGCAAGGATCTGTGCTTGGGGG - Intergenic
1143950467 17:10628731-10628753 CAGCCGGCAGAAGTGGTGGGTGG - Intronic
1144677704 17:17172584-17172606 AAGCAAGCATCAGCAGTGGCAGG + Intronic
1144852755 17:18252271-18252293 CAGCCAGCCCCAGAGGTGGGTGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150582010 17:66482646-66482668 CAGCAAGCATCACTTGTATGTGG + Intronic
1152123976 17:78435351-78435373 CAGGAAGAAGCGGTGGTGGGTGG - Intronic
1152134977 17:78498486-78498508 TAACAAGCATCAGTGGGGGTGGG + Intronic
1152918707 17:83054983-83055005 CAGCAGCCTTCAGTGCTGGGTGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1156617826 18:38808998-38809020 CATCCAGCATCTGTGGTTGGAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157331340 18:46705817-46705839 CTGCAAGAATCAGAGGTGAGAGG + Intronic
1157584933 18:48794865-48794887 CCACAAGCATCTGTGGAGGGAGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158669376 18:59461251-59461273 CAGCAAGGGCCAGTGGTGGCGGG - Intronic
1160271517 18:77389276-77389298 CTGCAATCATCAGGGGTGTGTGG - Intergenic
1160322682 18:77911242-77911264 CAGCAAGCAGCATTGCTGTGTGG - Intergenic
1160429324 18:78800607-78800629 CAGCAAGGATGAGTGCAGGGAGG - Intergenic
1161648225 19:5467518-5467540 CAGGAAGCATCTGAGGAGGGTGG - Intergenic
1163031233 19:14545495-14545517 CAGCAAGCCTAGGGGGTGGGGGG + Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG + Intronic
1167066528 19:47190474-47190496 CAGTTAGCAGCAGTGGAGGGGGG - Intronic
1167237681 19:48325141-48325163 GGGCAAGCGTCAGGGGTGGGAGG - Intronic
1167569340 19:50277046-50277068 CAGCAAGCATTAATGGGGTGTGG + Intronic
1168038584 19:53740006-53740028 CAGAAAGAGTCAGAGGTGGGCGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
928194592 2:29206085-29206107 CAGCAAGCTTCAGGGGTGAGGGG + Intronic
928331583 2:30361702-30361724 CAGGAAGCATTGGGGGTGGGGGG - Intergenic
928405084 2:31008656-31008678 CAGCCAGCATGAGTGGTGGGAGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928450026 2:31370479-31370501 CTGCAAGAATGAGTGGTGTGAGG + Intronic
928526396 2:32145795-32145817 CAGCCAGCATCGGTAGTGGATGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931190722 2:59997610-59997632 CAGCAAGGAGAAGTGGTGGGAGG + Intergenic
931651862 2:64475859-64475881 TAGCAAGCAGCAGTGGGGTGTGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933616338 2:84485826-84485848 GAGCAGGAATCAGTGGTTGGGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935934365 2:108165920-108165942 CAGCATGCACCAGCTGTGGGTGG - Intergenic
936065578 2:109329564-109329586 CAGCAAGTTTCAGAGGTGGAAGG + Intronic
936277773 2:111115562-111115584 CAGCCAGGAACAGAGGTGGGTGG + Intronic
936573548 2:113635462-113635484 CAGCAGGCAACAGTGGAGGGAGG - Intronic
938285532 2:130112074-130112096 CACCAAGTAACAGTGGTGTGAGG + Exonic
938336175 2:130500615-130500637 CACCAAGTAGCAGTGGTGTGAGG + Exonic
938353647 2:130620050-130620072 CACCAAGTAGCAGTGGTGTGAGG - Exonic
938364112 2:130720386-130720408 CAGGAGGCTTCAGTGGGGGGTGG + Intergenic
938430072 2:131226828-131226850 CACCAAGTAACAGTGGTGTGAGG - Exonic
938542964 2:132301183-132301205 GATCAAGCAGCTGTGGTGGGAGG - Intergenic
938592625 2:132753917-132753939 CAGGAATAATCAGTGATGGGAGG + Intronic
939008896 2:136821808-136821830 CAGCACGCATCATTGGTAGAAGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
941285797 2:163610954-163610976 TAGCCAGGAACAGTGGTGGGGGG + Exonic
942265306 2:174218750-174218772 CAGCAAACCCCAGGGGTGGGAGG + Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
944496786 2:200315342-200315364 CAGCCATCATCAGAAGTGGGAGG + Intronic
947483548 2:230525620-230525642 CAGGAAGCACAAGGGGTGGGGGG + Intronic
947581655 2:231323384-231323406 CAGCAAGCTTCATTGCTGGGAGG + Intronic
947693027 2:232157386-232157408 CAGGAGGCATCAGTTGTGAGGGG - Intronic
948217254 2:236240828-236240850 CAGCCAGCATCAGTAGAGGCAGG - Intronic
948581066 2:238987349-238987371 CCGCAAGCATCCCTGGTGAGGGG + Intergenic
1170306240 20:14941361-14941383 CAGGAAGCATCAGTAGTGCCTGG - Intronic
1170575909 20:17661338-17661360 CAGGAAGAATCAGTCTTGGGAGG + Intronic
1170927953 20:20742911-20742933 GAGCAAGAATCAGTGTTGAGAGG + Intergenic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171871842 20:30534012-30534034 GATCAAGCAGCTGTGGTGGGAGG - Intergenic
1172441144 20:34967562-34967584 GACCAAGCAGCAGTGGAGGGCGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1172972121 20:38881268-38881290 CAGGGAGGAGCAGTGGTGGGTGG + Intronic
1175968768 20:62673387-62673409 CAGGAGTCATCAGAGGTGGGTGG + Intronic
1176294349 21:5063180-5063202 CTACAAGCATCAGCGGCGGGGGG - Intergenic
1176421658 21:6520949-6520971 CAGAAAGCATCAGTGATGTTGGG + Intergenic
1176848740 21:13896814-13896836 CAGCAAGAATTGGGGGTGGGTGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177336086 21:19729564-19729586 CAGCCAGGCTCAGTGGTGGGCGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178664842 21:34537592-34537614 CAGCAGCCATCATTGGTGGAGGG - Intronic
1179378171 21:40870814-40870836 CAACAAGCCTCAGGGGAGGGAGG + Intergenic
1179481255 21:41680065-41680087 AAGCAAGCAGCTGAGGTGGGTGG - Intergenic
1179697148 21:43129265-43129287 CAGAAAGCATCAGTGATGTTGGG + Intergenic
1179862704 21:44198946-44198968 CTACAAGCATCAGCGGCGGGGGG + Intergenic
1180475256 22:15698667-15698689 CACCAAGTAACAGTGGTGTGAGG - Exonic
1180839421 22:18952217-18952239 CAGCAACCTGCAGGGGTGGGTGG + Intergenic
1181062479 22:20288267-20288289 CAGCAACCTGCAGGGGTGGGTGG - Intergenic
1182619555 22:31611409-31611431 CAGCCGGTATGAGTGGTGGGTGG + Intronic
1184072506 22:42154769-42154791 CAGCAAACATGGGTGGTGGGTGG - Intergenic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
1184665879 22:45988832-45988854 CAGCAGTCATCAGTGCAGGGTGG - Intergenic
1185322332 22:50207537-50207559 CAGGCAGCCTCAGGGGTGGGCGG - Intronic
1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG + Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950127704 3:10520296-10520318 GAGCAAGCAGCAGGGGAGGGGGG + Intronic
950610355 3:14123025-14123047 CATAAAGGATCAGTGGGGGGCGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
952808694 3:37381870-37381892 TAGGAAGCATCCCTGGTGGGAGG - Intergenic
954685512 3:52368050-52368072 GAGGAAACATCAGTGGTGAGGGG + Intronic
956100130 3:65759568-65759590 CAGCCAGCAGCAGTGGGTGGGGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
959137177 3:102437824-102437846 CACCAAGGAGCAGTTGTGGGAGG + Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961369668 3:126421804-126421826 CAGCATGCCCCAGTGGTGGCTGG - Intronic
962154754 3:132934494-132934516 GTGCAAGCAGCAGTGGTAGGTGG - Intergenic
962398460 3:135037617-135037639 CAGAAAGCATCACTGATGGGCGG - Intronic
963027129 3:140931092-140931114 CAGCAGGAATAGGTGGTGGGAGG + Intergenic
965310799 3:167125787-167125809 CAGAAAGCAGCAGTGCTGGTAGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
967558621 3:190891740-190891762 CAGAAAGCATAAGTGGTTGAGGG + Intronic
968552824 4:1232791-1232813 CAGCGAGCATCTGTGGTGGGGGG + Intronic
968971039 4:3794019-3794041 CAGCAAGCAACAGAGGTGTTGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969244815 4:5925261-5925283 CAGCAAGGAGGTGTGGTGGGGGG + Intronic
969285822 4:6201074-6201096 CAGCAAGCGGCAGAGCTGGGCGG + Intergenic
969449889 4:7266956-7266978 CTGGAAGAATCAGTGGGGGGTGG + Intronic
969480265 4:7443220-7443242 CAGAATCCATCAGTGGAGGGTGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970929150 4:21488693-21488715 CAAAAAGCATCAGTGTTGGCAGG + Intronic
971170469 4:24228098-24228120 CAGCAAGCACCAGTGGGATGGGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976643987 4:87368365-87368387 CAGAAAGCATCAGTGTGGCGAGG - Intronic
977202424 4:94132722-94132744 GAGCAAGAGACAGTGGTGGGGGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977590213 4:98818049-98818071 CAGAAAGCATCAGTGTGGTGAGG - Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979469621 4:121079264-121079286 AAGCTAGCAGCAGTGTTGGGAGG + Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984540011 4:181025577-181025599 CAGCAAGCATCAGTGTCATGAGG + Intergenic
985023566 4:185716826-185716848 GAGGAAACATCAGTGGAGGGAGG + Intronic
987165879 5:15197280-15197302 CAGAAAGCATCAGTATGGGGAGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989382347 5:40821902-40821924 GAGCAAGCGAGAGTGGTGGGAGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
991257790 5:64634161-64634183 GAGGAAGCATCAGGGGTAGGAGG + Intergenic
992142769 5:73816101-73816123 CAACAAACATCTGGGGTGGGGGG + Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
995908028 5:117149820-117149842 CAGAAATCATCAGGGGTGGGAGG - Intergenic
997028151 5:130090521-130090543 AAGCAAGCAACAGTGGTGAGAGG - Intronic
997214287 5:132097435-132097457 CAGCAAATCTCAGTGGTGTGGGG + Intergenic
997238558 5:132290257-132290279 GAGCTGGCATCAGTGCTGGGGGG + Intronic
997853527 5:137353890-137353912 CAGCAAGTATCTGTAGAGGGAGG - Intronic
998055041 5:139067487-139067509 CATCAAGCAGAAGTGGTTGGTGG + Intronic
1000511582 5:162190026-162190048 CAGAGAGCATCAGTAGTGTGTGG + Intergenic
1000623758 5:163515129-163515151 CACGAAGCAACAGTGCTGGGAGG - Intronic
1002049981 5:176565230-176565252 TACTAAGCAGCAGTGGTGGGTGG + Intronic
1002307506 5:178292490-178292512 CAGCAAGAAACAGTGGGAGGTGG + Intronic
1003991382 6:11490062-11490084 CAGTAATCATCAGTGGAGGAGGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004270702 6:14192723-14192745 CAGAAAGGAACACTGGTGGGGGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006506036 6:34489419-34489441 CATCCAGCAGCAGTGCTGGGTGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009595367 6:65728800-65728822 GTGCCAGCATCAGTGGTAGGAGG - Intergenic
1010171848 6:72984646-72984668 CAGGAAGCACAAGGGGTGGGGGG - Intronic
1010251624 6:73713342-73713364 CAGCAAGAAATAGGGGTGGGTGG + Intronic
1010364212 6:75031032-75031054 CAGGAAGCATAAGGGGTTGGGGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1011649691 6:89494342-89494364 GATCAAGTATCAGGGGTGGGAGG + Intronic
1012077561 6:94710858-94710880 GAGCAATTATCAGTGGTGGTTGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013131585 6:107238253-107238275 CAGGAAGGATCAGGAGTGGGTGG + Intronic
1013233012 6:108174350-108174372 CAGAAAGAATCGTTGGTGGGAGG + Intronic
1013706196 6:112837365-112837387 CAACAAGCATATGTGGTGAGAGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015206182 6:130642359-130642381 CAGAAAGAAGCAGTGTTGGGGGG - Intergenic
1015629774 6:135220226-135220248 CAGCAAGCATCACTGGACTGTGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1017715354 6:157207162-157207184 CAGCAAAGATGAGTGGTGGTGGG + Exonic
1018708999 6:166484396-166484418 GAACAAGCATCTGTGGTTGGAGG - Intronic
1019121520 6:169808555-169808577 CTGGGGGCATCAGTGGTGGGGGG - Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022388667 7:29924889-29924911 CTGCATGAAGCAGTGGTGGGCGG - Intronic
1023218041 7:37886454-37886476 AAGCAACCGTAAGTGGTGGGTGG - Intronic
1023767474 7:43524834-43524856 AAGCAAGCATTAGTGGGAGGTGG + Intronic
1023786508 7:43713674-43713696 CATCCAGCATCAAAGGTGGGTGG - Intronic
1023860695 7:44216262-44216284 CAGGCAGCATAGGTGGTGGGTGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024339739 7:48245084-48245106 CACCAAGAAGCATTGGTGGGAGG - Intronic
1026777290 7:73238654-73238676 AAGAAAGCAACAGTGCTGGGAGG + Intergenic
1027018138 7:74792023-74792045 AAGAAAGCAACAGTGCTGGGAGG + Intergenic
1027069889 7:75153889-75153911 AAGAAAGCAACAGTGCTGGGAGG - Intergenic
1027788976 7:82615560-82615582 CAGGAAGCATGGCTGGTGGGGGG + Intergenic
1027888061 7:83935093-83935115 CAGCAGTCATCAGATGTGGGTGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028413041 7:90551466-90551488 CAGGAAGCATGAGGGGTTGGGGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031468543 7:122143564-122143586 CAGCAAGGATCGGAGATGGGTGG - Intronic
1031859251 7:126958704-126958726 CCGGAAGCCTCAGTGGTGGGTGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035330660 7:158095013-158095035 GGGCCAGCATCCGTGGTGGGAGG + Intronic
1039180185 8:34858307-34858329 CAGAAAGCATCGGTGGGGGCGGG - Intergenic
1039424386 8:37473874-37473896 GAGCCAACATCAGGGGTGGGGGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040082399 8:43300523-43300545 CAGCAAGCAAAAGTGGTGTGAGG - Intergenic
1040434871 8:47380483-47380505 CACCAAGCAGGAGTGGAGGGTGG - Intronic
1041172739 8:55161541-55161563 CAGACAGCAGCAGTAGTGGGAGG - Exonic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1042269721 8:66942675-66942697 CAGTATGGTTCAGTGGTGGGAGG - Intergenic
1042361280 8:67885861-67885883 CAGCAAGCAGCAGTGGAGTTTGG - Intergenic
1044449210 8:92314101-92314123 CAGGAAGCATAAGGGGTTGGGGG - Intergenic
1044732293 8:95238962-95238984 CAGGAGGCAACAGTGGGGGGTGG - Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048567290 8:135614971-135614993 GAGGAAACATCAGTGGTAGGGGG + Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049749242 8:144275675-144275697 CAGCCACCACCAGGGGTGGGGGG + Intronic
1050203673 9:3175811-3175833 CAGGAAGCAAGAGTGGAGGGGGG - Intergenic
1050413110 9:5386720-5386742 CAGCAGGTAGCAGTGATGGGAGG - Intronic
1050536087 9:6631957-6631979 CAGGAAGCTGCAGTAGTGGGAGG + Intronic
1050599707 9:7238118-7238140 CAGCATCCATCAATGGTGGCAGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053346377 9:37381509-37381531 CAGCAGGCCCCAGTGGTGGGAGG - Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057506443 9:95637465-95637487 CAGGGACCATCAGTGGTGAGAGG - Intergenic
1059440841 9:114306048-114306070 CAGCAGGCACAAGTGCTGGGAGG - Intronic
1061181871 9:129029259-129029281 CAGCAGGCCTGGGTGGTGGGAGG - Intergenic
1061500925 9:131001423-131001445 GAGGAAGCATCAGAGCTGGGGGG + Intergenic
1061723378 9:132567557-132567579 CAGCATGCAGCGATGGTGGGTGG - Intronic
1062459397 9:136656614-136656636 CCGCAAGGCACAGTGGTGGGGGG - Intergenic
1186194256 X:7095700-7095722 CAGCAGGCCTCAGTGTTGAGGGG - Intronic
1188681339 X:33011135-33011157 CATGAAGCATTAGTGGTGGTGGG + Intronic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191873775 X:65773075-65773097 CACCAGGCATCCGTGGTGGTAGG + Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193211200 X:78809126-78809148 CTGCAAGCAGAAGTGGTGGTGGG - Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193894779 X:87099888-87099910 CAGCCAGCACCAGTGCAGGGAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195729297 X:107949487-107949509 CAGAAAGCACAAGGGGTGGGGGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196326095 X:114404947-114404969 CCCCAAGCAACAGTGTTGGGAGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198236389 X:134739496-134739518 CAGGAAGCCTCAGTGCAGGGAGG + Intronic
1199577946 X:149332896-149332918 CAGCCAGTATGAGTGATGGGGGG + Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic