ID: 902873474

View in Genome Browser
Species Human (GRCh38)
Location 1:19327548-19327570
Sequence CTGGGTGAACAGATGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 1, 2: 5, 3: 55, 4: 497}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902873474_902873485 20 Left 902873474 1:19327548-19327570 CCTCCCTCCATCTGTTCACCCAG 0: 1
1: 1
2: 5
3: 55
4: 497
Right 902873485 1:19327591-19327613 CCAGGCACCCAGCTGGACCCTGG 0: 1
1: 8
2: 4
3: 53
4: 520
902873474_902873483 13 Left 902873474 1:19327548-19327570 CCTCCCTCCATCTGTTCACCCAG 0: 1
1: 1
2: 5
3: 55
4: 497
Right 902873483 1:19327584-19327606 CTGTGTGCCAGGCACCCAGCTGG 0: 1
1: 3
2: 25
3: 196
4: 957
902873474_902873480 2 Left 902873474 1:19327548-19327570 CCTCCCTCCATCTGTTCACCCAG 0: 1
1: 1
2: 5
3: 55
4: 497
Right 902873480 1:19327573-19327595 GTGCACACCTCCTGTGTGCCAGG 0: 1
1: 2
2: 20
3: 162
4: 1048

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902873474 Original CRISPR CTGGGTGAACAGATGGAGGG AGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900485667 1:2921482-2921504 CTGGATGGACAGATGGACAGAGG - Intergenic
900485707 1:2921692-2921714 CTGGATGGACAGATGGACGGAGG - Intergenic
900485716 1:2921734-2921756 CTGGATGGACAGATGGACGGAGG - Intergenic
900485725 1:2921776-2921798 CTGGATGGACAGATGGACGGAGG - Intergenic
900485735 1:2921818-2921840 CTGGATGGACAGATGGACGGAGG - Intergenic
900485744 1:2921860-2921882 CTGGATGGACAGATGGACGGAGG - Intergenic
900485753 1:2921902-2921924 CTGGATGGACAGATGGACAGAGG - Intergenic
900485761 1:2921944-2921966 CTGGATGGACAGATGGACAGAGG - Intergenic
900498218 1:2986368-2986390 ATGGGTGAATAGATGGAAAGAGG - Intergenic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900672967 1:3867313-3867335 CGGAGTGAACAGACGGAGCGTGG - Intronic
900889900 1:5442073-5442095 CTGGAAGACCTGATGGAGGGAGG + Intergenic
900927799 1:5717127-5717149 CTGGGAGAGCAGATGCAGGCTGG + Intergenic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
902176122 1:14652538-14652560 ATGGGTGAATAGGTGGATGGGGG - Intronic
902386528 1:16079100-16079122 CTGGGTCAGCAGACGGCGGGAGG - Intergenic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903221632 1:21872761-21872783 CTGGGTAGACGGATGGAAGGAGG + Intronic
903800269 1:25961992-25962014 CAGGCTGGACAGATGGTGGGGGG + Exonic
904375828 1:30081903-30081925 GTGGGGGAGCAGAGGGAGGGAGG - Intergenic
905401419 1:37706402-37706424 GTTGATGAACAGATGGAGGCCGG - Intronic
905697968 1:39989809-39989831 CTGGGAGAAGAGAAGGATGGGGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906152929 1:43598449-43598471 ATGGGGGAACAGGTGGAGGTGGG - Intronic
906482773 1:46210724-46210746 GTAGCTGAACAGATGGAGGGTGG - Intronic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
907336713 1:53704517-53704539 CTGGGTGAGCAGATGAACAGTGG + Intronic
908692540 1:66798799-66798821 CTAGGTGAACAGATGCTGGTTGG + Intronic
908973273 1:69864345-69864367 TTGGATGAATAGATGGATGGAGG + Intronic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
910918318 1:92315243-92315265 ATGGGTGAACAGCTGGTTGGTGG + Intronic
912432984 1:109639285-109639307 CTGGGTGGACAGATGCAAGATGG + Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912692975 1:111818591-111818613 CCAGGGGAACAGATGGAGTGCGG + Intronic
912848907 1:113104252-113104274 GTGGGTGGACAGATGGATGGAGG - Intronic
912859000 1:113196337-113196359 ATAGCTGAACACATGGAGGGTGG + Intergenic
915042434 1:152980485-152980507 GTGGGTGCAGAGGTGGAGGGAGG - Intergenic
915218038 1:154352932-154352954 CTGGGAGCACAGATGGAAGCGGG - Intergenic
917006978 1:170426318-170426340 ATGGGTGAGCAGAAGCAGGGTGG + Intergenic
919794336 1:201312119-201312141 CTGCGTGCACACATGGAGGCAGG - Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
921681597 1:218039488-218039510 CTGAGGGATCAGATGGAGGTTGG + Intergenic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063655192 10:7981258-7981280 GTGGGTGAATAGATGGAAGAGGG - Intronic
1063877603 10:10496549-10496571 ATGGATGAAAAGATGGAGGGTGG + Intergenic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1069303021 10:66932106-66932128 CTGGCTGAAAAGGGGGAGGGAGG - Intronic
1069813773 10:71180651-71180673 CTGGCTGGACAGATGGATGTAGG - Intergenic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1071515284 10:86292916-86292938 CTGTGTGAAGAGATGGATGGGGG + Intronic
1071598979 10:86947103-86947125 CTGGGTGCAGAGATGATGGGAGG + Intronic
1072609791 10:97010617-97010639 GTGGGTGGCCAGAGGGAGGGTGG + Intronic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1072725762 10:97812636-97812658 CTGGTTGAAGACCTGGAGGGTGG - Intergenic
1073560903 10:104496037-104496059 CTGGGGCCACATATGGAGGGAGG - Intergenic
1074140586 10:110668579-110668601 TTGGGACAACAGGTGGAGGGAGG + Intronic
1074872285 10:117586733-117586755 ATGGGTGAATAGGTGGATGGGGG - Intergenic
1074896342 10:117780711-117780733 ATGGGTGGATAGATGGATGGAGG - Intergenic
1074983992 10:118641477-118641499 CTGGGAGACCAGAGGAAGGGAGG + Intergenic
1075233924 10:120709602-120709624 CTGCGGGATCAGCTGGAGGGAGG + Intergenic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1075962843 10:126584362-126584384 ATGGATGGACAGATGGAAGGTGG - Intronic
1075962854 10:126584417-126584439 ATGGATGGACAGATGGAAGGTGG - Intronic
1076825110 10:132963309-132963331 TTTGATGGACAGATGGAGGGAGG - Intergenic
1076825122 10:132963369-132963391 GTTGATGGACAGATGGAGGGAGG - Intergenic
1076845003 10:133065650-133065672 ATGGATGGATAGATGGAGGGTGG + Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077353159 11:2102245-2102267 GTGGGTGAATGGATGGAGGTTGG + Intergenic
1077353214 11:2102547-2102569 GTGGATGAACAGTTGGATGGAGG + Intergenic
1078843659 11:15102274-15102296 ATGGCAGAAGAGATGGAGGGGGG + Intergenic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079136541 11:17778858-17778880 CTGAGTGATTAGATGGGGGGTGG + Intronic
1080060211 11:27948975-27948997 CTGCGAGAAAGGATGGAGGGAGG - Intergenic
1080443789 11:32318599-32318621 CTGAGTCAACAGCTGGAGGTAGG + Intergenic
1081772893 11:45660721-45660743 CTAGGGGAGGAGATGGAGGGGGG - Intronic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1082670624 11:56032970-56032992 GTGGGTGAGCAGAAGCAGGGTGG + Intergenic
1083404482 11:62447136-62447158 CTGGGTTAATTGATGCAGGGAGG - Intronic
1084596472 11:70119693-70119715 GTGGGTGAATAGATGGATGCCGG + Intronic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1086228806 11:84544099-84544121 TTCAGTTAACAGATGGAGGGTGG - Intronic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086461289 11:87008330-87008352 CTAGTTGAACAGCTGGATGGTGG - Intergenic
1087723082 11:101688695-101688717 CTGGGAGAACAGTTTGAGGCTGG - Intronic
1088094497 11:106082647-106082669 TTGGGAGAACAGGTAGAGGGAGG - Intronic
1088720697 11:112589526-112589548 CTGGGTGGGCAGATGGAAAGGGG + Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089191820 11:116659322-116659344 CTGGGTGACGAGGTGGAGGGTGG - Intergenic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089603706 11:119629570-119629592 ATGGGTGGACAGAGGCAGGGTGG + Intronic
1090541152 11:127707621-127707643 CTTGGTGGATAGATGGATGGAGG + Intergenic
1091993033 12:4972340-4972362 ATGGGTGAATGGATGGATGGAGG - Intergenic
1091998611 12:5015320-5015342 CTAGGTGAAAGGATGGAGGGAGG + Intergenic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092526428 12:9312716-9312738 CTGGGTGGACAGATGGGGGCTGG + Intergenic
1092540847 12:9419069-9419091 CTGGGTGGACAGATGGGAGCTGG - Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1094050127 12:26210664-26210686 CTGTCTCAACAGATGCAGGGGGG - Intronic
1094512199 12:31103416-31103438 CTGGGTGGACAGATGGGGGCTGG + Intronic
1095095678 12:38147194-38147216 GTGGGAGAACAGATGGACAGAGG - Intergenic
1096504769 12:52085825-52085847 TGGGGTGAACAGATGCTGGGTGG + Intergenic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1097670701 12:62534038-62534060 CTGTGTGACCAGTTGGAGTGAGG - Intronic
1100868956 12:98890128-98890150 CTGGGTGGGTAAATGGAGGGAGG + Intronic
1101059303 12:100954453-100954475 ATGGGTGCTCAGATGGAAGGTGG - Intronic
1101967508 12:109291529-109291551 CTGGCCAAGCAGATGGAGGGAGG - Intronic
1102783541 12:115585520-115585542 CTGGGAGGACAGATGCAGGGAGG + Intergenic
1103596767 12:122029018-122029040 CTGGGTGAAAAGGTGCAAGGAGG + Intronic
1103905447 12:124325258-124325280 CTGGACGGACAGATGGATGGAGG + Exonic
1104211416 12:126692218-126692240 CTGGGTCTTCAGATGGTGGGGGG - Intergenic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1104588846 12:130068477-130068499 CTGGTTGTACAGATGCAGGCAGG - Intergenic
1104960288 12:132485311-132485333 CTGGGTGAACAGGGAGGGGGCGG + Intergenic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1107351547 13:39520062-39520084 CTGGGCTCCCAGATGGAGGGTGG - Intronic
1107890573 13:44910678-44910700 TTGGGAGAAAAGATGGAGAGAGG + Intergenic
1107989025 13:45801075-45801097 CTGGGTGAAGTGATGGGTGGCGG + Intronic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1110546598 13:76763021-76763043 CTGGATGAACCGGTGGAGGTTGG - Intergenic
1110882023 13:80583723-80583745 TTGGGGGAAGAGTTGGAGGGGGG + Intergenic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224851 13:108147991-108148013 TTGGCTGAATAGATGGAGGTTGG - Intergenic
1113434301 13:110277776-110277798 GTGGGTCAAAAGATAGAGGGAGG - Intronic
1113780265 13:112972745-112972767 GTGGGTGGATGGATGGAGGGAGG + Intronic
1113959676 13:114119690-114119712 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113959689 13:114119727-114119749 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1115859854 14:37672215-37672237 CTGGGTCAAGGGATGGAGGGAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117785337 14:59278181-59278203 CTGTGTGATCAGATGAAGTGAGG + Intronic
1118477186 14:66128508-66128530 CTGGGTCCACAGATGGGTGGGGG - Intergenic
1118839072 14:69497550-69497572 CTGGCTGAAGAGAAAGAGGGAGG + Intronic
1119114224 14:72003713-72003735 ATGGGGGAAGGGATGGAGGGAGG + Intronic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1121537205 14:94699127-94699149 CTGGGTTAGGAGTTGGAGGGTGG + Intergenic
1121733534 14:96202742-96202764 GTGGGTGGATGGATGGAGGGAGG + Intergenic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1122867509 14:104614053-104614075 AGGGGTGAATGGATGGAGGGTGG + Intergenic
1123072259 14:105647595-105647617 CTGAGTGCACAGATGGGAGGAGG - Intergenic
1123130871 14:105984302-105984324 CTTGGTGAACAGAGGATGGGAGG - Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123581098 15:21715523-21715545 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1123617747 15:22158146-22158168 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1124658050 15:31524554-31524576 TTGGGGGAACGGAAGGAGGGAGG - Intronic
1124682083 15:31740415-31740437 CTCAGTGAGCAGATGGTGGGGGG + Intronic
1124918714 15:34002407-34002429 CTGGGTGTACAGATGGCTGCAGG - Intronic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1127448253 15:59088205-59088227 CAGGGTGAACAGGTGAAGGGAGG + Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128454551 15:67825366-67825388 GGGGGTGAAGAGAAGGAGGGGGG - Intronic
1128552754 15:68608883-68608905 CTTGTTGAACGGATGGATGGAGG - Intronic
1128681841 15:69658089-69658111 GTGGGTCAAGAGATGGAGGCAGG - Intergenic
1128793413 15:70449151-70449173 ATGGATGGAGAGATGGAGGGAGG + Intergenic
1128890075 15:71323515-71323537 CTGGTTGAAGAGCTGCAGGGGGG + Intronic
1129247266 15:74287151-74287173 CTTGGGGAAGAAATGGAGGGAGG - Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1131753789 15:95538570-95538592 TTGGGTGATTAGATGGGGGGTGG + Intergenic
1132936749 16:2485059-2485081 CTGGGAGAGTAGGTGGAGGGAGG - Intronic
1134052531 16:11146708-11146730 CTGGGTGGATAGATGGATAGAGG + Intronic
1134071851 16:11265169-11265191 CAGGGTGAACAGGTGAAGGGAGG - Intronic
1134316891 16:13127109-13127131 CTGAGGGAACAGAGAGAGGGAGG + Intronic
1134782415 16:16910184-16910206 GTGGGTGAGTGGATGGAGGGAGG + Intergenic
1135548993 16:23384070-23384092 CTGAGTGAATCTATGGAGGGCGG + Intergenic
1135899758 16:26446183-26446205 CTTGGTGGACAGACTGAGGGAGG - Intergenic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1138695551 16:58809607-58809629 CCTGGAGAACAGATGGAAGGAGG - Intergenic
1141319501 16:82994080-82994102 ATGGGTAATTAGATGGAGGGTGG - Intronic
1141797668 16:86286061-86286083 CTGGGTCACCAGGTTGAGGGTGG - Intergenic
1141854827 16:86673844-86673866 ATGGATGAAGGGATGGAGGGAGG - Intergenic
1141854847 16:86673943-86673965 AGGGATGAACAGATGGATGGGGG - Intergenic
1141854853 16:86673963-86673985 ATGGATGAAGGGATGGAGGGAGG - Intergenic
1141854867 16:86674014-86674036 ATGGATGAAGGGATGGAGGGGGG - Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1142140849 16:88472098-88472120 CTGGGTCCACAGATGGGGTGGGG - Intronic
1142152351 16:88518250-88518272 GTGGGTGAGTAGATGGATGGTGG + Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142676820 17:1518574-1518596 CTGGGGCAACAGGTGGAGGTGGG + Exonic
1143634989 17:8159453-8159475 TTGGGTGAACTGATTGAGGAAGG - Exonic
1144088132 17:11828973-11828995 ATAGGTGAATAGATGAAGGGTGG + Intronic
1144836946 17:18161499-18161521 CTGGGTGGACAGCTGGTGGGAGG + Intronic
1145203217 17:20966041-20966063 CTGAGTTAACATATGGAAGGGGG - Intergenic
1145262283 17:21361511-21361533 GTGGCTGAACAGAGGGAGCGGGG - Intergenic
1145710081 17:26963364-26963386 ATGGGAGAAAAGAAGGAGGGCGG + Intergenic
1146285487 17:31571652-31571674 TGGGGTGGACAGAAGGAGGGCGG + Intronic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1146655872 17:34634888-34634910 CTGGGTGAAGACCTGCAGGGTGG - Exonic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1146939193 17:36832296-36832318 ATGGATGGACAGATGGATGGTGG - Intergenic
1147445726 17:40474286-40474308 GTGGGAGAAGAGAGGGAGGGAGG + Intergenic
1147776754 17:42907375-42907397 GGGGGTGAACGGATGGATGGGGG + Intronic
1148479300 17:47949666-47949688 CTGGGTGGCCAGATGGATGTGGG - Intergenic
1149393624 17:56217155-56217177 CTGGCTGGAAGGATGGAGGGAGG - Intronic
1149686546 17:58538817-58538839 CTGGGTGAACAGCTGGGGATGGG - Intronic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1151116000 17:71736045-71736067 GTGGGTGAACAGATGGTTAGTGG - Intergenic
1151339564 17:73461659-73461681 ATGGGTGAATAGGTGGATGGAGG + Intronic
1151358196 17:73572490-73572512 CTGGGTGATAAGAGGGAGGCTGG - Intronic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1151951688 17:77357805-77357827 CTGGGTGAATACAAGGAGTGAGG - Intronic
1151956047 17:77380742-77380764 CCAGGTGTACAGTTGGAGGGGGG + Intronic
1152103481 17:78316009-78316031 GTGGGTGCACAGATCGAGGCTGG - Intergenic
1152331159 17:79674130-79674152 CTGGGGGAACAGATTCAGAGAGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155519259 18:26652719-26652741 ATTGTTGAACAAATGGAGGGAGG + Intronic
1156284657 18:35679957-35679979 CATGGTGAACAGATGGGAGGGGG - Intronic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1159917386 18:74199029-74199051 CCGGGTGAACTGCTGGAGGGAGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160322052 18:77905501-77905523 CTGGATGGACAGGTGGAAGGTGG + Intergenic
1160559676 18:79748380-79748402 CTGGGGGGACCCATGGAGGGAGG + Intronic
1160687110 19:442247-442269 GTGGGTGAACGGATGGATGATGG + Intronic
1160687131 19:442332-442354 GTGGGTGGATGGATGGAGGGTGG + Intronic
1160687367 19:443071-443093 GTGGGTGGATGGATGGAGGGTGG + Intronic
1160687642 19:444069-444091 ATGGGTGGATGGATGGAGGGTGG + Intronic
1160789536 19:917212-917234 CTGGGTGAATAGAGGGCGCGTGG + Intergenic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160926664 19:1549877-1549899 GTGGGTGAATTGATGGATGGAGG - Intergenic
1161157281 19:2739218-2739240 CTGGCTGAACACATGGACGAGGG + Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161302822 19:3551249-3551271 CAGGGTGAGGACATGGAGGGAGG + Intronic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1161873279 19:6887092-6887114 GTTGGTGAATAGAGGGAGGGAGG + Intergenic
1161982882 19:7638988-7639010 ATGGATGGACAGATGGATGGAGG - Intronic
1162085816 19:8248562-8248584 ATGGGTGGACAGATGGATGATGG + Intronic
1162085923 19:8249094-8249116 ATGGGCGAACAGATGGATGATGG + Intronic
1162565902 19:11445820-11445842 CTGGGTTACCTGGTGGAGGGTGG + Intronic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1162854789 19:13460050-13460072 GCGGGTGAGCAGAGGGAGGGGGG - Intronic
1163019451 19:14474662-14474684 CTGGGTGTAAAAATGGAAGGTGG - Intronic
1163238454 19:16043500-16043522 ATGGATGAATGGATGGAGGGAGG + Intergenic
1163382706 19:16979295-16979317 ATGGATGAATAGATGGATGGAGG - Intronic
1163466693 19:17471935-17471957 CCAGGTGAACATATGGATGGGGG - Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1163826414 19:19527171-19527193 CTGGGGGAAGAGGCGGAGGGGGG - Intronic
1164703849 19:30304822-30304844 CTGGGGGAAATGATGGACGGTGG + Intronic
1164707314 19:30329675-30329697 CTGGGTGCAGAGAGGGAGAGGGG - Intronic
1165257565 19:34588950-34588972 TGGGGTGTACAGAGGGAGGGTGG + Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165924687 19:39320067-39320089 GGAGGTGGACAGATGGAGGGGGG - Intergenic
1165978351 19:39697263-39697285 CTGGGTGAACATCTGGGGGCTGG + Intergenic
1166201473 19:41240228-41240250 GTGGGTGGATATATGGAGGGTGG + Intronic
1166230183 19:41421995-41422017 CTGGGTGGGCAGATGCTGGGGGG + Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1167144247 19:47672441-47672463 GTGGATGGAAAGATGGAGGGAGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1167607627 19:50489841-50489863 ATGGGAGAACAGAAAGAGGGAGG + Exonic
1168135655 19:54349492-54349514 GAGGGTGGACGGATGGAGGGAGG + Intergenic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
1168508273 19:56954608-56954630 ATGGGTGGATAGATGGAGGATGG - Intergenic
927195366 2:20542844-20542866 CTGGGGGCACAGATGGGAGGTGG + Intergenic
927573723 2:24182863-24182885 ATGGCTGAACTGAGGGAGGGAGG - Intronic
929596664 2:43180309-43180331 AGGGGTGAAATGATGGAGGGAGG + Intergenic
929848240 2:45555445-45555467 CTGAGTGAAGAGATGGGAGGAGG - Intronic
931700017 2:64901917-64901939 CTGGGTGCACAGATGAGGGGAGG - Intergenic
932582982 2:73004628-73004650 CTGGGAGACCAGAGGGAGTGTGG + Intronic
933398379 2:81760761-81760783 TTGGGTGTATAGTTGGAGGGAGG + Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
933709583 2:85315573-85315595 CTGGGTGAGGGGGTGGAGGGAGG + Intergenic
934662492 2:96150498-96150520 CTGGGTGCACTGTTGGGGGGGGG + Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936018240 2:108975506-108975528 CTTGGTGACCAGATGGATGCCGG + Intronic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
937970744 2:127546889-127546911 GTGGGTGGATAGATGGATGGTGG - Intronic
938651893 2:133391570-133391592 TTGGGTGACCAGATGGACTGTGG - Intronic
939036874 2:137142927-137142949 CTGCATGAATAGATTGAGGGAGG - Intronic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
940572408 2:155455147-155455169 CTGGGTGATAAGATTGAGGGTGG + Intergenic
941964990 2:171292187-171292209 CTGGGTGGAGAGCTGGAGGGTGG - Intergenic
942797872 2:179842696-179842718 TTTGCTGAACAGCTGGAGGGAGG - Intronic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
945187390 2:207153319-207153341 CTGGGGGAAGAAATAGAGGGAGG + Intronic
945768300 2:214007964-214007986 AGGGGTGAAGAGAAGGAGGGAGG - Intronic
946074593 2:217063555-217063577 TTGGGAGAGCAGATGGTGGGAGG + Intergenic
946311442 2:218884329-218884351 CTGGGGGGACGGGTGGAGGGGGG + Intronic
946413754 2:219529006-219529028 CTGGTAGAACAGATGTGGGGAGG - Intronic
947812842 2:233015155-233015177 ATGGGTGAAGGGATGGATGGTGG - Intronic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
1170118227 20:12884433-12884455 CTGGGTGGAGAGATGATGGGAGG + Intergenic
1170361182 20:15548107-15548129 ATAGGTGGACAGATGGATGGTGG - Intronic
1170415370 20:16133615-16133637 CTGGGGGAACTGCTGGGGGGAGG + Intergenic
1170850045 20:19996491-19996513 CTGTGTGAAGGGATGGATGGAGG + Intronic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1170943203 20:20866315-20866337 CTGGGAAAACACTTGGAGGGAGG - Intergenic
1171399178 20:24860730-24860752 ATGGGTGGATAGATGGAGGGAGG + Intergenic
1171882313 20:30627607-30627629 CTGGGTGAACACCCGCAGGGAGG - Intergenic
1172006018 20:31819641-31819663 CTGGGGCAGGAGATGGAGGGAGG + Intronic
1172301308 20:33852461-33852483 CTGGGCCGAGAGATGGAGGGTGG + Intronic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173355398 20:42282888-42282910 ATGAGTGAGCAGATGGAAGGAGG + Intronic
1173419321 20:42886934-42886956 CAGGGTGCACAAATGCAGGGAGG + Intronic
1174288253 20:49487484-49487506 CTGGGTGACCACATAGCGGGTGG - Intergenic
1174410253 20:50330549-50330571 GTGGGTGGATAGATGGTGGGCGG + Intergenic
1175131302 20:56791744-56791766 ATGGGTGGACAGATGGATAGAGG - Intergenic
1175154539 20:56961198-56961220 CTGGGTGTACAGGAGCAGGGAGG - Intergenic
1175199784 20:57268891-57268913 CAGGGTGAGGTGATGGAGGGTGG + Intergenic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175817896 20:61893148-61893170 GTGGGTGAATAGAGGGATGGTGG + Intronic
1175817959 20:61893385-61893407 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818037 20:61893706-61893728 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818051 20:61893757-61893779 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818064 20:61893804-61893826 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175857926 20:62132766-62132788 CTGGGTGCACAGTTGGATGTGGG + Intronic
1175990291 20:62785324-62785346 CCGGGTGGGGAGATGGAGGGTGG + Intergenic
1176057911 20:63158475-63158497 ATGGGTGAATAGATGGTGGGTGG + Intergenic
1176234769 20:64049140-64049162 CTGGGTGAGCGGCGGGAGGGCGG - Exonic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1176887203 21:14270881-14270903 CTGGGTCAGCATATGTAGGGAGG + Intergenic
1177042787 21:16133485-16133507 GTGGGTGAGCAGAAGCAGGGTGG - Intergenic
1177608036 21:23407767-23407789 GTGGGTGAACGGGTGGAGGAAGG - Intergenic
1178046749 21:28703363-28703385 CTGGCTGGACAGATGGGGAGGGG + Intergenic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1179343407 21:40533630-40533652 ATGGATGGACAGATGGATGGAGG - Intronic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1180167306 21:46036767-46036789 CTGGGTGAGCAGCTGGAGCGAGG + Intergenic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181595239 22:23910194-23910216 TTGGATGAAGAGTTGGAGGGTGG - Intergenic
1181595247 22:23910244-23910266 TTGGGTGAAGAGTTGGAGGGTGG - Intergenic
1181595254 22:23910278-23910300 TTGGGTGAAGAGTTGGAGGGTGG - Intergenic
1181595262 22:23910315-23910337 TTGGGTGAAGAGTTGGAGGAGGG - Intergenic
1182003595 22:26940889-26940911 GTGGGGGCACAGAGGGAGGGAGG + Intergenic
1182039108 22:27222529-27222551 ATGGGTGGATAGATGGAGAGTGG + Intergenic
1182892670 22:33832013-33832035 CTGGGTGAAAGGAAGAAGGGAGG - Intronic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183398609 22:37587894-37587916 ATGGGTGAGGAGGTGGAGGGAGG + Intergenic
1183470943 22:38006427-38006449 CTGAGTGAGCGGCTGGAGGGTGG - Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184306487 22:43606416-43606438 CTGGGTGAACAAATGAAGAAAGG + Intronic
1184350109 22:43937707-43937729 GTGGGTGGACAGGTGGAGGGAGG - Intronic
1184390133 22:44199070-44199092 ATGGGTGCATAGATGGTGGGTGG - Intronic
1184410463 22:44323195-44323217 ATGGGTGGACAGATGGATGGTGG - Intergenic
1184467324 22:44676611-44676633 CGGGGTGAAGAGGAGGAGGGGGG + Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1185146282 22:49138578-49138600 GTGGATGAATAGATGGATGGAGG - Intergenic
1185347040 22:50314982-50315004 CTGGGTGAACGGTGGGAGAGCGG - Intronic
1203289113 22_KI270735v1_random:17240-17262 ATGGGAGAAAAGAAGGAGGGCGG - Intergenic
949926166 3:9043452-9043474 ATGGGTGAACAGAAGGGGGCAGG + Intronic
950076949 3:10194028-10194050 CTGGCAGAACTGAAGGAGGGTGG + Intronic
950102838 3:10368684-10368706 GTGGATGGACAGATGGATGGCGG - Intronic
950769631 3:15301224-15301246 CTAGGTAAGCAGATGGAGAGTGG - Intronic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
953904380 3:46861164-46861186 CTGGCTGGAGAGGTGGAGGGGGG - Intronic
954678476 3:52328325-52328347 CTGGGTGGAGGGATGGAGAGTGG - Intronic
955369132 3:58335907-58335929 GGGAGTGAAGAGATGGAGGGAGG - Intronic
955824263 3:62928672-62928694 ATGGATGAATAGATGGATGGGGG + Intergenic
956250629 3:67230623-67230645 CTTGGTGAACAGAGGATGGGTGG - Intergenic
956718194 3:72096693-72096715 CTGGGTGAACAGGAGCATGGTGG - Intergenic
956748321 3:72327129-72327151 GTGGTTGAATAGATGGAGGATGG - Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
959190517 3:103104582-103104604 CTGGGTTTAAAGATGGAAGGAGG + Intergenic
959941854 3:112088537-112088559 CTGAGTGAAGAAATTGAGGGAGG + Intronic
961514554 3:127424603-127424625 GTGTGTGAACAGAGAGAGGGAGG - Intergenic
962350723 3:134653736-134653758 TTGTGTGAGCAGCTGGAGGGAGG - Intronic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
962862249 3:139414830-139414852 CAGGGTGAGCAGATGGGGAGGGG - Intergenic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
966934208 3:184695183-184695205 CTGGGGGAAGCGGTGGAGGGAGG - Intergenic
969102905 4:4783324-4783346 CTGCGTGATGAGATGAAGGGAGG - Intergenic
969257684 4:6013710-6013732 CTGGGTCCAAAGATGGAGGCGGG + Intergenic
969501586 4:7556727-7556749 ATGGGTGGACACATGGATGGTGG - Intronic
969548455 4:7848069-7848091 GTGGGTGGACGGAAGGAGGGAGG + Intronic
969599351 4:8166817-8166839 GTGGATGGACAGATGGATGGAGG - Intergenic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
971252676 4:24986338-24986360 CCGGGCTAACAGCTGGAGGGAGG - Intergenic
971293296 4:25365292-25365314 CTGGCTGCATAGATGGATGGAGG + Intronic
972452310 4:39214365-39214387 CTGTGTGCAGAGATGGGGGGCGG - Intronic
974195121 4:58564358-58564380 GTGGGTCAAGATATGGAGGGTGG - Intergenic
975734827 4:77371056-77371078 CTGAGGGAAAAGATGGAGTGTGG - Intronic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
977761168 4:100738861-100738883 CTGGGAGAAAAGGTGGTGGGAGG - Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
978965391 4:114734729-114734751 CAGTGGGAACAGATGGTGGGAGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
985629376 5:1006814-1006836 CTGGGAGGACAGGTGGAGGTGGG - Intergenic
985999614 5:3620246-3620268 CTGGGTTCACAGATGGCTGGCGG - Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986214070 5:5701701-5701723 TTTGGTGGACGGATGGAGGGAGG + Intergenic
986676802 5:10192993-10193015 CTGGTTCAACAGAAGAAGGGTGG - Intergenic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
986798841 5:11239445-11239467 CTGGGAGAACAGAAGTGGGGAGG - Intronic
992084958 5:73270081-73270103 ATGGCAGAACAGACGGAGGGAGG - Intergenic
992484445 5:77181145-77181167 CTGGGTGAATAGACGGAGCGTGG + Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
997205439 5:132045964-132045986 CTGGGCTTAAAGATGGAGGGAGG - Intergenic
1000688409 5:164283340-164283362 TTGGGGGAAAAGGTGGAGGGTGG - Intergenic
1001517038 5:172363163-172363185 ATGGATGGACAGATGGATGGAGG - Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001686386 5:173597680-173597702 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686461 5:173597880-173597902 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686493 5:173597964-173597986 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001815875 5:174669089-174669111 CCAGGTGACCAGATGGATGGTGG + Intergenic
1001818818 5:174693764-174693786 CTGGGTTGAGAGATGGAGAGAGG + Intergenic
1002067640 5:176660128-176660150 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067648 5:176660155-176660177 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067656 5:176660182-176660204 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002349148 5:178570739-178570761 CAGGCTGAGCACATGGAGGGGGG + Intronic
1002393834 5:178938076-178938098 TTGGGTGAACAGAAGACGGGAGG + Intergenic
1002424955 5:179169484-179169506 CTGGGTGAGGAGGTGGATGGAGG + Intronic
1002472236 5:179442400-179442422 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002472264 5:179442578-179442600 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002569979 5:180134726-180134748 CTGGGTGAAGAGATGGGGACAGG - Intronic
1002615172 5:180448620-180448642 CTGGGAGAACAGGTGCAGGCCGG + Intergenic
1003127564 6:3367788-3367810 CTGGGTGCATTGATGGAGGCTGG - Intronic
1003504095 6:6725546-6725568 CTGGGTCACCAGAGGCAGGGAGG + Intergenic
1003519232 6:6843421-6843443 CTGGATGGAGAGGTGGAGGGTGG - Intergenic
1004689776 6:17983435-17983457 GTGGGTGAAGGGATGGAGTGGGG - Intronic
1004870183 6:19896496-19896518 CTGGGTGGACAGCTGGACTGGGG - Intergenic
1005123164 6:22413379-22413401 CAGGGTGAAGGCATGGAGGGTGG + Intergenic
1005761163 6:28969445-28969467 CTTGGAGAACAGCTTGAGGGAGG - Intergenic
1005817804 6:29570571-29570593 CGTGGTGAAGTGATGGAGGGAGG - Intronic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006620280 6:35359163-35359185 GTGGCTGGACAGAGGGAGGGAGG + Intronic
1006934882 6:37710382-37710404 CTGGGTGAGCACAGAGAGGGAGG - Intergenic
1007783996 6:44270216-44270238 CACGGAGAACAGATGGAGAGGGG + Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1009850984 6:69198437-69198459 TAGGGTGAAAAGATGGAGCGTGG + Intronic
1013182863 6:107732683-107732705 CTGCGAGATCATATGGAGGGTGG - Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1016505007 6:144769449-144769471 TTTGGCAAACAGATGGAGGGAGG - Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017858506 6:158373443-158373465 CTGAGTGAACAGTTAGAGTGTGG + Intronic
1019327081 7:443800-443822 GTGGGTGAATAGATGAATGGAGG + Intergenic
1019510480 7:1415193-1415215 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019510510 7:1415289-1415311 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019549615 7:1595420-1595442 CTGGGAGGATGGATGGAGGGAGG - Intergenic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019704710 7:2491993-2492015 CTGGATGGAGAGATGGATGGTGG - Intergenic
1019710278 7:2515291-2515313 CTGGTTGAACTGATGGTGGGGGG - Intronic
1020608666 7:10368025-10368047 GAGGGTGAGCAGATGCAGGGTGG - Intergenic
1020975448 7:15000433-15000455 CTGACTCAACAGATAGAGGGTGG + Intergenic
1022740071 7:33112243-33112265 CTGGGAGAACATATGGGGGCAGG - Intergenic
1022779098 7:33560029-33560051 CTGGGTAAACTGATAGAGAGGGG - Intronic
1023915642 7:44586820-44586842 CTGGTTGAACAAATGAAGGACGG - Intergenic
1024255868 7:47539644-47539666 CTGGGAGGTCAGATGGGGGGCGG - Intronic
1024459510 7:49645512-49645534 CTGGCTGTGCAGATGTAGGGAGG + Intergenic
1024579152 7:50787885-50787907 CAGGGTGAAAAGATGGGCGGGGG + Intronic
1024673736 7:51619885-51619907 ATAGGAGAACAGCTGGAGGGAGG + Intergenic
1026930762 7:74221810-74221832 TTGGGTGGACAGAAGGAGGCTGG + Intronic
1028516476 7:91682746-91682768 CTAGCTGAACACATGGAGAGTGG + Intergenic
1028529167 7:91819138-91819160 CTGGGGGAAAAGGTGGAGGGAGG - Intronic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034897356 7:154886084-154886106 CTGGGAGCAGAGAAGGAGGGCGG - Intronic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035278964 7:157765505-157765527 GTGGGTGAATGGATGGAGGAAGG - Intronic
1035279175 7:157766454-157766476 ATGGGTGGATAGATGGATGGAGG - Intronic
1035705086 8:1669253-1669275 CTGGGGGCCCAGATGGACGGCGG - Intronic
1036290125 8:7480395-7480417 GTGGGGGAAAAGAGGGAGGGAGG + Intergenic
1036331351 8:7831127-7831149 GTGGGGGAAAAGAGGGAGGGAGG - Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036920619 8:12851014-12851036 CTGGGGGAAAAGACGGAGGCTGG - Intergenic
1036924771 8:12893751-12893773 CTGGGTCAATACATGGCGGGAGG + Intergenic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037703508 8:21296043-21296065 CTGGGTGAGATGAGGGAGGGAGG - Intergenic
1037766635 8:21776199-21776221 CTGGGTGACCACATGCAGTGGGG - Intronic
1037769605 8:21790624-21790646 CTGGGGGAGAAGATGGAGGGAGG - Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038127024 8:24685894-24685916 CTGGCTTTAAAGATGGAGGGAGG - Intergenic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1038682957 8:29687114-29687136 TTGGGAGAACAGATTGAGGGAGG - Intergenic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1040279526 8:46031933-46031955 GTGGGGGAACGGATGGATGGAGG + Intergenic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1042955341 8:74244317-74244339 CTGGGTGAACATAGGGGTGGTGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045689617 8:104746812-104746834 CTGGCTTAACAGAGGGAGGTAGG + Intronic
1047252683 8:123192600-123192622 CTGGGTGAACAGCTGATTGGTGG + Intronic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1048979764 8:139697001-139697023 ATGGGTGGACGGATGGATGGTGG + Intronic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1048979801 8:139697168-139697190 GTGGGTGGACAGATGGATGGTGG + Intronic
1048984949 8:139730316-139730338 CTGGGCTAGCAGATGCAGGGAGG + Intergenic
1049302692 8:141879972-141879994 CTGGGAGCACAGGTGGAGAGGGG - Intergenic
1049386986 8:142347850-142347872 TTGGGTGAACGGATGCAGTGTGG - Intronic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050340221 9:4629919-4629941 ATGGGTGAACAGATGAACTGTGG + Intronic
1051062758 9:13064099-13064121 CTGAGTGAACAGATGGTGTAGGG + Intergenic
1051192736 9:14532394-14532416 CTTGCTGAGCAGATGAAGGGAGG + Intergenic
1053199974 9:36145665-36145687 ATGGGTGGGTAGATGGAGGGAGG + Intronic
1053300117 9:36942985-36943007 CTGGGTGCAGAGAAGGAGAGCGG - Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1054889045 9:70232355-70232377 TTGGGGGAACAGAAGCAGGGTGG + Intergenic
1055042795 9:71893532-71893554 ATGGCTGAGCACATGGAGGGTGG - Intronic
1055469533 9:76597612-76597634 GTGGGTGGACAGCTTGAGGGGGG - Intergenic
1055865000 9:80802413-80802435 CTCACTGAACAGATGGAGGCAGG + Intergenic
1056300063 9:85231445-85231467 TGGGGTGAACAGTAGGAGGGGGG + Intergenic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056831433 9:89920305-89920327 CTGGGAGGCCAGGTGGAGGGTGG + Intergenic
1057169077 9:92950056-92950078 ACAGGTGAACAGATGAAGGGAGG - Intronic
1057995008 9:99813899-99813921 CTGGTTGCCCAGATTGAGGGAGG - Intergenic
1058098371 9:100889291-100889313 CTGGGTGGGGGGATGGAGGGAGG - Intergenic
1058743637 9:107968446-107968468 CTGTGTGTCCAGTTGGAGGGAGG + Intergenic
1058814243 9:108668805-108668827 CTGGGTGAGCAGCTGATGGGAGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1061244930 9:129396683-129396705 ATGGATGAAAAGATGAAGGGTGG + Intergenic
1061431739 9:130535651-130535673 CTGAGTGAGCAGCTGGAGGCGGG + Intergenic
1062292241 9:135801325-135801347 CTGGTTTTGCAGATGGAGGGAGG - Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062343416 9:136103836-136103858 CAGGGTGGACAGGTGGAGTGTGG - Intergenic
1062376745 9:136265266-136265288 CTGGGGGCACATGTGGAGGGGGG - Intergenic
1062465406 9:136678599-136678621 CTGGGGGATCAAATGGTGGGGGG - Intronic
1062622393 9:137428785-137428807 CTGGGTGGGCAGACCGAGGGAGG + Intronic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1187193052 X:17054913-17054935 CTGGCTGCAGAGTTGGAGGGAGG - Exonic
1187696793 X:21930435-21930457 GTGGGTGAGGAGATCGAGGGTGG - Intergenic
1187723669 X:22179347-22179369 TTGGGGGAACAGATGGTGGTTGG + Intronic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1190722287 X:53159678-53159700 CTGAGTGCAAAGATGGAGAGAGG - Intergenic
1190911527 X:54776060-54776082 CTGGGGGCAGAGTTGGAGGGTGG - Intronic
1190919690 X:54840148-54840170 CTGGGGGCAGAGGTGGAGGGTGG + Intergenic
1191223610 X:58016810-58016832 TTTGGTGATCAGATGGAGGCAGG - Intergenic
1192341298 X:70265717-70265739 CCGGGTGTACAGAATGAGGGTGG + Intergenic
1195446417 X:104957455-104957477 CTGGGGGTTCAGAGGGAGGGAGG + Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196025025 X:111033115-111033137 CTGTGTGTACAGAGAGAGGGAGG - Intronic
1199715564 X:150505326-150505348 TAGGGTGAAGGGATGGAGGGTGG - Intronic
1201900896 Y:19045473-19045495 ATGGGAGAACAGATGGATGGAGG + Intergenic