ID: 902875704

View in Genome Browser
Species Human (GRCh38)
Location 1:19339635-19339657
Sequence CGTTATCAGCAGATTGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3424
Summary {0: 1, 1: 0, 2: 1, 3: 130, 4: 3292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902875702_902875704 -5 Left 902875702 1:19339617-19339639 CCTGCAAGGGAGGAAAGGCGTTA 0: 1
1: 0
2: 0
3: 11
4: 86
Right 902875704 1:19339635-19339657 CGTTATCAGCAGATTGAACAGGG 0: 1
1: 0
2: 1
3: 130
4: 3292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902875704 Original CRISPR CGTTATCAGCAGATTGAACA GGG Intronic
Too many off-targets to display for this crispr