ID: 902875835

View in Genome Browser
Species Human (GRCh38)
Location 1:19340175-19340197
Sequence TCTTACCCACTCCCAAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902875835_902875840 16 Left 902875835 1:19340175-19340197 CCCACCCTTGGGAGTGGGTAAGA 0: 1
1: 0
2: 0
3: 15
4: 144
Right 902875840 1:19340214-19340236 GTCTGAGCACACTGTGTTTATGG 0: 1
1: 0
2: 1
3: 13
4: 155
902875835_902875841 29 Left 902875835 1:19340175-19340197 CCCACCCTTGGGAGTGGGTAAGA 0: 1
1: 0
2: 0
3: 15
4: 144
Right 902875841 1:19340227-19340249 GTGTTTATGGCCCACGCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902875835 Original CRISPR TCTTACCCACTCCCAAGGGT GGG (reversed) Intronic
901616000 1:10540217-10540239 TCTAGCCCACTACCAAGGTTGGG - Intronic
902644122 1:17786289-17786311 TCTCACCCACCCTCAAGGGGAGG + Intronic
902875835 1:19340175-19340197 TCTTACCCACTCCCAAGGGTGGG - Intronic
903206235 1:21784426-21784448 CCTAACCCACTTCCAAGGGCAGG - Intergenic
903964451 1:27078216-27078238 TCCCACCCACACTCAAGGGTGGG - Intergenic
906346621 1:45019554-45019576 TCTTAGCCCCTCACAAGGATGGG + Intronic
907462221 1:54611887-54611909 TCCTACCCCTTCCCAAGGGCAGG + Intronic
908124106 1:61013288-61013310 TCTTCCACACTCCCAAGGAGTGG - Intronic
910083050 1:83364672-83364694 TCTTAGCCAATCCCAAGAGCTGG + Intergenic
914427609 1:147592529-147592551 TGTTATCCACCCCCAAGGGCTGG + Intronic
914490649 1:148148524-148148546 ACTTGTCCACTCCCAAGGGAAGG + Intronic
915727118 1:158025809-158025831 TCTTTCCCACTCCCCAGGAGAGG + Intronic
915912369 1:159923055-159923077 TCTTCCCCACCCCCACGGGCAGG + Intronic
916013860 1:160730929-160730951 TCTTAGCCACTCAGAAGGGTGGG - Intergenic
917793265 1:178513396-178513418 TCCTTCCCACCCCCAAGGCTAGG - Intronic
920698680 1:208201339-208201361 ACTGACCCCCTCCCCAGGGTGGG - Intronic
921389885 1:214606692-214606714 ACTTGTCCACTCCCAAGGGAAGG - Intronic
924158166 1:241202873-241202895 TCTTACTCTCCCCCAAGGTTAGG - Intronic
1065339915 10:24695224-24695246 TCTAGCCCACACTCAAGGGTAGG - Intronic
1067367466 10:45647071-45647093 TCATGCCCACACTCAAGGGTAGG - Intronic
1068866948 10:61904020-61904042 TCTTTCCCCCTCCCAAGGTCTGG + Intronic
1070289697 10:75106053-75106075 TCGGACCCTATCCCAAGGGTAGG - Intronic
1073175487 10:101554019-101554041 TCTTCCCCACACCCAAGAGGAGG + Exonic
1077982463 11:7314406-7314428 TCTCAACCACTCCCACTGGTAGG - Intronic
1079166112 11:18045023-18045045 CCTTGACCTCTCCCAAGGGTCGG - Intergenic
1080947495 11:36990751-36990773 TCTTACCCACTGACAAAGATAGG - Intergenic
1081393755 11:42560770-42560792 TCTTGCCCACACTCAAGGGAAGG + Intergenic
1081770013 11:45644243-45644265 CGTTACCCACTCCCAAGTGAAGG + Intergenic
1081772016 11:45655932-45655954 TTTTTCCCACTCCCAATGGAGGG - Intronic
1085256457 11:75176280-75176302 CCTGACCCAGTCCCAAGGGCAGG - Intronic
1088970531 11:114771163-114771185 TTTGACCCATTCCCAAAGGTGGG - Intergenic
1090274638 11:125410730-125410752 TCCTACCCACTCCCATGGCAGGG + Intronic
1091433404 12:454907-454929 TCTTCCCCACTCCCAAGTCATGG - Intergenic
1092651700 12:10641824-10641846 GCTGACCCACTCCCTAGGGAGGG - Intronic
1095899338 12:47311642-47311664 TCTCACCCACACTCAAGGGGAGG + Intergenic
1096584523 12:52611161-52611183 CCTTACTCACTCCTAAGGGAGGG - Intronic
1104205596 12:126635398-126635420 TCTTACCCAGCCCCATGGGTGGG + Intergenic
1104205613 12:126635458-126635480 TTTTACCCAGCCCCATGGGTGGG + Intergenic
1104205643 12:126635579-126635601 TCTTACCCAATCCCATGAGTGGG + Intergenic
1104931227 12:132340494-132340516 ACTCACCCACTGCCAAGGGAGGG - Intergenic
1108721463 13:53136961-53136983 TCTGGCCCACTCTCAAGGGGAGG + Intergenic
1111392001 13:87608620-87608642 TTTTTCCCCCTCCCATGGGTTGG + Intergenic
1111611417 13:90612949-90612971 TCTAGCTGACTCCCAAGGGTGGG + Intergenic
1113090462 13:106612676-106612698 TCTAACCCACTCTCAAAGGCAGG - Intergenic
1116114288 14:40628662-40628684 TCTTCCCCTTTCCCTAGGGTTGG + Intergenic
1119546762 14:75477710-75477732 TCTTCCCCACTCCCTAGCTTGGG + Intergenic
1119724475 14:76913828-76913850 ACTTCCCCAGTCCCTAGGGTGGG - Intergenic
1120776013 14:88438960-88438982 TCTTGCCCACACTTAAGGGTTGG + Intronic
1120868964 14:89320189-89320211 TCTTGCAGCCTCCCAAGGGTGGG + Intronic
1121872882 14:97425756-97425778 TCTTTCCCACTCTCAAGGCTTGG - Intergenic
1123425979 15:20170463-20170485 ATGTACCCACTCCCAAGTGTAGG - Intergenic
1123535211 15:21176987-21177009 ATGTACCCACTCCCAAGTGTAGG - Intergenic
1124291318 15:28455974-28455996 ACTTGTCCACTCCCAAGGGAAGG - Intergenic
1129513454 15:76141605-76141627 TCTTAACCATTCCTAAGCGTAGG + Intronic
1136219971 16:28822818-28822840 CCTTACCCACTCCCAGGGCTAGG + Intergenic
1136707459 16:32201697-32201719 ACTTGTCCACTCCCAAGGGAAGG + Intergenic
1136760452 16:32727720-32727742 ACTTGTCCACTCCCAAGGGAAGG - Intergenic
1136807651 16:33142666-33142688 ACTTGTCCACTCCCAAGGGAAGG + Intergenic
1136858274 16:33679055-33679077 ATGTACCCACTCCCAAGTGTAGG + Intergenic
1140215145 16:73001021-73001043 TATTGCTCACTCCCAAGGGGAGG - Intronic
1140218761 16:73028535-73028557 CCTTGGCCACACCCAAGGGTGGG + Intronic
1140469726 16:75207234-75207256 TCTTGCCCACTCCCAGGGAAGGG - Intergenic
1141192775 16:81836424-81836446 TCTTAACCACTACCAAGGGAAGG - Intronic
1141257734 16:82418443-82418465 TCTTCCCCAATCCCAAGGGCGGG + Intergenic
1142145739 16:88492293-88492315 CCCCACCCAATCCCAAGGGTGGG + Intronic
1203062605 16_KI270728v1_random:988035-988057 ACTTGTCCACTCCCAAGGGAAGG - Intergenic
1203119845 16_KI270728v1_random:1527525-1527547 ATGTACCCACTCCCAAGTGTAGG + Intergenic
1144998335 17:19286120-19286142 TCTGACCCACCACCATGGGTGGG - Intronic
1149302016 17:55314019-55314041 TCTTCCTCACTGCCAATGGTAGG - Intronic
1150900453 17:69269900-69269922 TCATACCCACTCCCAACCCTAGG - Intronic
1151449463 17:74189267-74189289 TCTCACCCACACACAAGGGGAGG + Intergenic
1151585484 17:75005843-75005865 TGTTACCCTCTCCCATGGCTGGG - Intergenic
1154056986 18:11022230-11022252 TCATACCCACTCCAAAGGTCAGG - Intronic
1155190322 18:23423700-23423722 TCTTACCCACTCACTAGACTAGG - Intronic
1155882343 18:31165002-31165024 ACTAACCCACTCCCGAGGGTGGG + Intergenic
1157519914 18:48338340-48338362 GCTGACCCACTCCTCAGGGTTGG + Intronic
1159636349 18:70809621-70809643 TTTTACCAACTCCCCTGGGTTGG + Intergenic
1160994969 19:1878302-1878324 ACTTGTCCACTCCCAAGGGAAGG - Intronic
1164511566 19:28901333-28901355 TCTTGCCCACTCCAAAGTGCTGG - Intergenic
1164768275 19:30788411-30788433 GCTTTCCTACTCCCAAGGGATGG - Intergenic
1167851535 19:52206086-52206108 TCTTGCCCACCCCTTAGGGTCGG + Intronic
1168071377 19:53954080-53954102 TCTTGTCCACACCCAAGGGAAGG + Intergenic
927051439 2:19333592-19333614 TATTACACAGTCCCAAAGGTGGG + Intergenic
927710663 2:25323829-25323851 TAGTACCCACTTCAAAGGGTTGG - Intronic
932090928 2:68805673-68805695 TCCTACCCACTACCCAGCGTAGG - Intronic
932700074 2:73985703-73985725 TCTTCCCCACCCCCACGGGCTGG - Intergenic
933770097 2:85738264-85738286 TCTCACCCACTCCCTAGGCCTGG + Intergenic
936417022 2:112325020-112325042 TCAGACCCACTCCCATGGTTAGG - Exonic
946284599 2:218693597-218693619 TCTCTCACACTCCCAAGTGTGGG + Intronic
948337026 2:237217453-237217475 TCTTACCCACTGACATGGTTTGG - Intergenic
948484661 2:238272650-238272672 TCTTAAGCACACCCAAAGGTGGG - Intronic
1171238667 20:23547944-23547966 TCTTGCCCATTCCCAGGGCTGGG + Intergenic
1172338293 20:34134472-34134494 TTCTGCCCATTCCCAAGGGTAGG - Intergenic
1174182815 20:48685615-48685637 TCTTTATCACCCCCAAGGGTTGG - Intronic
1177516473 21:22158278-22158300 TCTCAGCCACACCCAAGGGGAGG - Intergenic
1178157929 21:29876081-29876103 TATTACACAATCCCAAGGGGAGG + Intronic
1178688206 21:34728313-34728335 TCCTACCCACCCTCGAGGGTGGG + Intergenic
1178758860 21:35381037-35381059 TCTTCCCAACTCCCAAAGGTAGG + Intronic
1179418907 21:41220356-41220378 TCCTCCCCACTCCCCAAGGTTGG + Intronic
1179786840 21:43734975-43734997 TCCTTCCCACTCCCAAGAGTAGG - Intronic
1181121025 22:20668836-20668858 ACTTGTCCACTCCCAAGGGAAGG - Intergenic
1181333991 22:22115862-22115884 ACTTGTCCACTCCCAAGGGAAGG - Intergenic
1181511803 22:23392721-23392743 CCTTACCCAGTCCCAGGGGCAGG + Intergenic
1181934740 22:26430038-26430060 TCTTTCCCACTCTCCAGGGCAGG + Intronic
1182094915 22:27619645-27619667 TTTCACCCACTCCCAGGGTTTGG - Intergenic
1183825941 22:40387681-40387703 TCATTCCCACTACCAGGGGTGGG - Intronic
1184663126 22:45974706-45974728 TCTTACCCCCTCCCAGAGGGAGG + Intronic
949102433 3:162132-162154 TCTAACCTACTCTCAAGGGAAGG + Intergenic
949643567 3:6067399-6067421 CCTTAGCCACGCCAAAGGGTTGG - Intergenic
949856658 3:8468008-8468030 TCTTACCCACACTCAAGGGGAGG - Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
959467536 3:106706935-106706957 TCTAGCCCACTCCCAAGCTTAGG + Intergenic
961035451 3:123638583-123638605 TCTCACCCACCCCAAGGGGTAGG + Intronic
962342034 3:134593946-134593968 ACTTGCCCAGTCCCTAGGGTGGG + Intergenic
963979903 3:151525932-151525954 TCTCACCCACACTCAAGGGGAGG + Intergenic
964149081 3:153502277-153502299 TCTTTCCCATGCCAAAGGGTTGG + Intronic
966713140 3:182989658-182989680 TCTTAACCCCTCCCAAGTGGTGG - Intergenic
966882988 3:184360436-184360458 TCCTACCCCATCCCAAGGGTTGG + Intronic
972730302 4:41788229-41788251 TCTCCCCCACTCCCAGGGCTGGG - Intergenic
973074976 4:45912813-45912835 TCTCACCCACACTCAAGGTTTGG + Intergenic
973171256 4:47147032-47147054 CCTTATCCACTCTCTAGGGTAGG - Intronic
979322066 4:119336418-119336440 TTTTCCCCACTCCTATGGGTGGG + Intergenic
981074649 4:140578943-140578965 TCTTGCACAGTGCCAAGGGTGGG - Intergenic
983240044 4:165222027-165222049 TTTTCCCCACTCCTATGGGTGGG + Intronic
986845569 5:11748844-11748866 TCTAGCCCACTCTCAAGGGGAGG - Intronic
994164586 5:96595560-96595582 TCATAACCAATGCCAAGGGTGGG + Intronic
994937241 5:106271042-106271064 TCGTCCCCACTCCCAAGGCCAGG - Intergenic
997265648 5:132493587-132493609 TCTTCCCTACTGCCAAGGGTAGG - Intergenic
1000374499 5:160566947-160566969 TCTTGCCCACTGGCAGGGGTTGG - Intronic
1000626806 5:163547939-163547961 TCTTACTCTCTCTAAAGGGTAGG + Intergenic
1001136775 5:169109007-169109029 TCTTACCCACACTCAAGTGGGGG - Intronic
1007029584 6:38615968-38615990 TCCTGCCCACTCTCAAGGGGAGG - Intronic
1017455801 6:154600235-154600257 TGTTCCCCAATACCAAGGGTGGG - Intergenic
1022114912 7:27252842-27252864 TCTTTCGCTCTCCCAAGGGGTGG - Intergenic
1024093674 7:45967959-45967981 GCCTGCCCATTCCCAAGGGTTGG + Intergenic
1024097066 7:45990626-45990648 GCTTACCCACTTCCACAGGTAGG + Intergenic
1024644615 7:51360813-51360835 TCCTACCCAGTGCCCAGGGTTGG + Intergenic
1026473819 7:70717146-70717168 TCTTAGCTACTCGCAAGGCTGGG - Intronic
1027299883 7:76820872-76820894 TCTTAGCCAATCCCAAGAGCTGG + Intergenic
1029450963 7:100641628-100641650 TCCTCACCACCCCCAAGGGTGGG + Exonic
1032778643 7:135143705-135143727 TCTCACCCACTCCCCAGTGGTGG + Intronic
1035982795 8:4392003-4392025 ACTTACCCACTCACAAGTTTAGG - Intronic
1036679564 8:10861183-10861205 TCTCCCCCACTCCCAATGCTAGG - Intergenic
1038205127 8:25458402-25458424 TCTGTCCCACACCCAAGGTTCGG + Exonic
1041541275 8:58987859-58987881 GGTTCCCCACTCCCAAGGGTTGG + Intronic
1042285859 8:67109535-67109557 TCCTACCCATTCTCAAGGGGAGG + Intronic
1043349670 8:79345069-79345091 TCTCACCCACACTCAAGGGGAGG + Intergenic
1044426721 8:92060365-92060387 ACTTACCCACCCCCAAAGATTGG + Intronic
1047311248 8:123694231-123694253 TCTCACCCACACTCAAGGGAAGG - Intronic
1054806521 9:69401136-69401158 TCCTACCCACACTCAAGGGGAGG + Intergenic
1056193084 9:84204100-84204122 TCTTACTCACTGCCAAGCATTGG + Intergenic
1056772646 9:89491207-89491229 TCCCACCCACTCCCAAGTGTGGG + Intronic
1062183812 9:135205572-135205594 TCTCACCCTCTGCCATGGGTTGG + Intergenic
1186448435 X:9652305-9652327 TCTTGCCCATACTCAAGGGTCGG + Intronic
1188224594 X:27581697-27581719 TCTTAGCTACTCCCAAGGTGAGG - Intergenic
1188596222 X:31904398-31904420 TCTTGACCACTCTCAAGGGGAGG - Intronic
1190408094 X:50107660-50107682 TCTTGCCCACACTCAAGGGGAGG + Intergenic
1193418759 X:81257740-81257762 TCCTACCCACACTCAAGGGGAGG + Intronic
1194932283 X:99902018-99902040 TCTTTCCCACTTCCATGGTTTGG + Intergenic
1197443400 X:126517728-126517750 CATTACCCACTCTCTAGGGTTGG - Intergenic