ID: 902876983

View in Genome Browser
Species Human (GRCh38)
Location 1:19346540-19346562
Sequence GTTCTCCTGGTTCCAAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 146}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902876983_902876996 19 Left 902876983 1:19346540-19346562 CCTCTCTTTGGAACCAGGAGAAC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 902876996 1:19346582-19346604 GATACTGTCTCAGAGGGTACGGG 0: 1
1: 0
2: 0
3: 10
4: 118
902876983_902876992 -5 Left 902876983 1:19346540-19346562 CCTCTCTTTGGAACCAGGAGAAC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 902876992 1:19346558-19346580 AGAACAGGGTGGAGTCTGGGGGG 0: 1
1: 0
2: 2
3: 52
4: 420
902876983_902876989 -8 Left 902876983 1:19346540-19346562 CCTCTCTTTGGAACCAGGAGAAC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 902876989 1:19346555-19346577 AGGAGAACAGGGTGGAGTCTGGG 0: 1
1: 0
2: 5
3: 60
4: 418
902876983_902876991 -6 Left 902876983 1:19346540-19346562 CCTCTCTTTGGAACCAGGAGAAC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 902876991 1:19346557-19346579 GAGAACAGGGTGGAGTCTGGGGG 0: 1
1: 0
2: 3
3: 47
4: 450
902876983_902876993 12 Left 902876983 1:19346540-19346562 CCTCTCTTTGGAACCAGGAGAAC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 902876993 1:19346575-19346597 GGGGGGAGATACTGTCTCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 171
902876983_902876988 -9 Left 902876983 1:19346540-19346562 CCTCTCTTTGGAACCAGGAGAAC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 902876988 1:19346554-19346576 CAGGAGAACAGGGTGGAGTCTGG 0: 1
1: 0
2: 4
3: 58
4: 752
902876983_902876995 18 Left 902876983 1:19346540-19346562 CCTCTCTTTGGAACCAGGAGAAC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 902876995 1:19346581-19346603 AGATACTGTCTCAGAGGGTACGG 0: 1
1: 0
2: 0
3: 10
4: 194
902876983_902876990 -7 Left 902876983 1:19346540-19346562 CCTCTCTTTGGAACCAGGAGAAC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 902876990 1:19346556-19346578 GGAGAACAGGGTGGAGTCTGGGG 0: 1
1: 0
2: 11
3: 78
4: 534
902876983_902876994 13 Left 902876983 1:19346540-19346562 CCTCTCTTTGGAACCAGGAGAAC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 902876994 1:19346576-19346598 GGGGGAGATACTGTCTCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902876983 Original CRISPR GTTCTCCTGGTTCCAAAGAG AGG (reversed) Intronic
900775995 1:4585882-4585904 CTTCTCCTGATTCCAGACAGGGG - Intergenic
900825610 1:4924253-4924275 TTTCTCCACGTTCCAAAGAAAGG + Intergenic
902327083 1:15708186-15708208 GTTCTCATGATTTAAAAGAGAGG + Intronic
902876983 1:19346540-19346562 GTTCTCCTGGTTCCAAAGAGAGG - Intronic
903127386 1:21257287-21257309 TTTGTCCTGGTTCTAGAGAGAGG - Intronic
903811081 1:26035421-26035443 GTTCTCCGGTGTCCCAAGAGCGG - Exonic
905478967 1:38248263-38248285 GTTCTCCTCCTGCCCAAGAGAGG - Intergenic
905708549 1:40081226-40081248 GATCTGATGGTTTCAAAGAGGGG + Intronic
908557733 1:65274030-65274052 ATTCTGTTGGTTCCCAAGAGAGG + Intronic
909495319 1:76271318-76271340 ATTCTTCTGGTTCCAAGAAGTGG - Intronic
912509227 1:110176903-110176925 GCCCTCCAGGTTCCAAGGAGAGG + Intronic
912735203 1:112144214-112144236 GTTCTGCTGGTTCCTATGTGTGG + Intergenic
913465126 1:119132602-119132624 ATTCTCCTGCTTCCCAAAAGGGG + Intronic
913648360 1:120884474-120884496 GTTCTCCTAATTCTAAAAAGAGG + Intergenic
914078334 1:144378820-144378842 GTTCTCCTAATTCTAAAAAGAGG - Intergenic
914100845 1:144587682-144587704 GTTCTCCTAATTCTAAAAAGAGG + Intergenic
914173241 1:145247350-145247372 GTTCTCCTAATTCTAAAAAGAGG - Intergenic
914298135 1:146349953-146349975 GTTCTCCTAATTCTAAAAAGAGG - Intergenic
914527895 1:148488488-148488510 GTTCTCCTAATTCTAAAAAGAGG - Intergenic
914638493 1:149578576-149578598 GTTCTCCTAATTCTAAAAAGAGG + Intergenic
916701400 1:167299728-167299750 CCTCACCTAGTTCCAAAGAGTGG + Intronic
916880104 1:169012526-169012548 CTTCTCCTGCTTCGAAAGACTGG - Intergenic
919860876 1:201739016-201739038 ACTCTCCTGGTTCCAGAGAAAGG - Intronic
921890080 1:220344854-220344876 CTTCTGCTGGCTCCCAAGAGAGG + Intergenic
922026186 1:221751361-221751383 GTTCTCCTGGGTTTAAAAAGAGG - Intergenic
922608222 1:226904452-226904474 GTTCTCCTGGTTTTAAAGGCGGG + Intronic
924020720 1:239778777-239778799 GTAATCGTGGCTCCAAAGAGAGG - Intronic
1064016695 10:11778557-11778579 TTTCATCTGGTTCAAAAGAGGGG - Intergenic
1064323514 10:14328181-14328203 TTTCCCCTGGTTTCCAAGAGAGG + Intronic
1068277156 10:54815011-54815033 GTGCTCCTGGTGCAGAAGAGGGG - Intronic
1069051432 10:63798957-63798979 GGTCTCCTGGTTCCCAGGACAGG + Intergenic
1073009736 10:100349799-100349821 GTTCTGCTGGATCCTCAGAGGGG - Intronic
1073831176 10:107385072-107385094 GTTGTCTTGTTTCTAAAGAGTGG - Intergenic
1074372393 10:112910605-112910627 CTGCTCCTGGCTCCAAAGGGTGG - Intergenic
1080336418 11:31202732-31202754 GGACTACTGGTTCCAAAGTGTGG + Intronic
1082570720 11:54735268-54735290 GTTAACCTGGATGCAAAGAGGGG - Intergenic
1087588307 11:100151064-100151086 TTTCTCATGGTTCTAAAGGGTGG - Intronic
1090439009 11:126710995-126711017 GTTCTCCTTGCCCCAAGGAGGGG - Intronic
1090580661 11:128155038-128155060 GGTCTCCTGCTGCCAAAGAAGGG + Intergenic
1091372579 11:135073205-135073227 GGTCTCCTGGTTCCAAAGTGTGG - Intergenic
1091910116 12:4223760-4223782 GTCCACCTGGTACCAAAGATGGG + Intergenic
1092855159 12:12666239-12666261 TTTCCCCTGGTTACAATGAGAGG + Intronic
1093623686 12:21322185-21322207 ATTCTCATAGTTCCAAAGACTGG + Intronic
1094297661 12:28926427-28926449 GTTATCTGGGTTCCCAAGAGTGG + Intergenic
1100349963 12:93771311-93771333 ATTCTCCAGGTTCACAAGAGTGG - Intronic
1107198032 13:37677727-37677749 GTTCTGTTGGTTACAGAGAGAGG - Intronic
1110044333 13:70809988-70810010 ATTCTCTTGGCTCCAAAGAGGGG + Intergenic
1116081537 14:40180116-40180138 ATTACCCTGATTCCAAAGAGAGG - Intergenic
1116974200 14:51097315-51097337 GTTCACCCTGTTCCAAACAGGGG + Intergenic
1119531347 14:75363352-75363374 GGTCTCCTGGCACCAAGGAGAGG - Intergenic
1119812112 14:77530768-77530790 GTTCTTCTGGTTTCAAAGACTGG + Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1126848152 15:52780806-52780828 GATCTCATAGTCCCAAAGAGAGG - Intronic
1130322136 15:82850311-82850333 GTTCCCCTGGTCCCACAGAGAGG + Intronic
1132092784 15:98959394-98959416 GATGTTCTGGTTCCAAAGACAGG - Exonic
1132175342 15:99709669-99709691 TCTCACTTGGTTCCAAAGAGAGG - Intronic
1132369688 15:101286483-101286505 ATTCTCCTAGCTCCAAGGAGGGG + Intronic
1133131051 16:3676348-3676370 GTTCTCCTGGTTCCCTCGGGCGG + Intronic
1133151036 16:3830677-3830699 GTTCTATTGGTTACTAAGAGAGG - Intronic
1134474693 16:14562538-14562560 GGCCTCCTGGTTTCAAGGAGTGG - Intronic
1134678545 16:16107681-16107703 GGTCTCCTTGTTACAAAGAGAGG - Intronic
1138965735 16:62081922-62081944 GTTTTCCTGTTTCCAAGGTGAGG - Intergenic
1140735833 16:77896948-77896970 ATTCTGCTGTTTCCAAAGACTGG + Intronic
1141741990 16:85899426-85899448 GTTTGCCTGTTTCCAAAGATTGG + Intronic
1148821466 17:50362145-50362167 GTTCTCCTAGTTGCCAGGAGGGG + Intronic
1151233578 17:72702220-72702242 GTTCTACTGAGTCCAAAGATAGG + Intronic
1152205656 17:78973210-78973232 GTGCTCCTGGTTTCTAAGAAGGG + Exonic
1153527444 18:6011003-6011025 GGTCTCCTTATTCCAAAGTGGGG + Intronic
1153771223 18:8417911-8417933 GTTCTGGAGGTTCCAGAGAGAGG + Intergenic
1155271406 18:24144724-24144746 ATTCTCCTCCTTCTAAAGAGGGG - Intronic
1159711063 18:71761399-71761421 GTTCTCCTGCATACAAAGATAGG - Intronic
1160038463 18:75322178-75322200 GGTCTGCTGGTTCCTGAGAGAGG + Intergenic
1167338046 19:48898595-48898617 GGTCCCCAGCTTCCAAAGAGAGG - Exonic
1168325960 19:55538285-55538307 GGGCTCCTGATTCCAAAGAGAGG + Intergenic
925271211 2:2608814-2608836 ATTCTCCTGGGTCCCCAGAGAGG - Intergenic
925793025 2:7512254-7512276 GATCTCTTGTTTCTAAAGAGGGG - Intergenic
927392327 2:22609398-22609420 TTTCCCCTGTTTCCACAGAGCGG - Intergenic
928178420 2:29050815-29050837 GCTCTCCTGGGTCCCCAGAGGGG - Intronic
928337471 2:30410041-30410063 GTTCTCCTTGATCCATTGAGAGG - Intergenic
932998160 2:76883087-76883109 ACTCTCCTGGTTCCAGTGAGTGG + Intronic
941680498 2:168393392-168393414 GTTCTCTTGGCAGCAAAGAGAGG - Intergenic
942462779 2:176179929-176179951 GTTATCCTGGCTGAAAAGAGAGG + Intergenic
942794830 2:179805551-179805573 CTTCTCCTGGTTTCAAGGCGTGG + Intronic
948021290 2:234735848-234735870 GTTCTCCTGGCACCCAACAGAGG + Intergenic
1168850680 20:974689-974711 ATCCTCCTAGATCCAAAGAGAGG - Intronic
1169000715 20:2166012-2166034 GGTCTCAGCGTTCCAAAGAGCGG - Intronic
1169198695 20:3697220-3697242 CTTCTCCTGGTTCCGAAATGGGG - Exonic
1171193755 20:23180740-23180762 GTTCTTCAGGTTCCAAGGAGAGG - Intergenic
1173110056 20:40178480-40178502 GTTTTCATGGATGCAAAGAGTGG + Intergenic
1174244772 20:49169927-49169949 GTCCTCCTGGTTCTTAAGATTGG + Intronic
1174816881 20:53694699-53694721 GCTCTCTTGGTTCCAAAGAAAGG - Intergenic
1175401967 20:58706182-58706204 GTTAACCTGGGTCTAAAGAGGGG - Intronic
1181467444 22:23117827-23117849 GTTCTCCTGGTGACACAAAGGGG - Intronic
1183028725 22:35085907-35085929 GCTCTCCTGGTTCAGAAGACAGG + Exonic
1183658458 22:39204620-39204642 GGTCTCCTGGTTGCACACAGAGG + Intergenic
949765496 3:7521567-7521589 GTTCTCATAGTTCCAAAGGTTGG - Intronic
950898517 3:16475372-16475394 GAGCTGCTGGTTCCCAAGAGAGG + Intronic
951750871 3:26035076-26035098 ACTCTCCTGCTTCAAAAGAGTGG + Intergenic
952645902 3:35658564-35658586 TTTCTCTTGGTTACAAAGACTGG + Intronic
953910870 3:46892505-46892527 GTTCTGCTGGTTCCACTTAGCGG - Intronic
965737502 3:171836946-171836968 GTTCTGCTGGGGCCAAAGTGAGG + Intergenic
966388289 3:179425214-179425236 GTTCCCATTGTTCCAAAGAAGGG + Intronic
967205521 3:187117090-187117112 GTTATCTGAGTTCCAAAGAGTGG + Intergenic
970900245 4:21150451-21150473 GTTCACCTGGTTCCAACCTGGGG + Intronic
974168654 4:58237520-58237542 TTTCCCATGGTTCCAGAGAGGGG + Intergenic
976674385 4:87688222-87688244 GTTCTGCTAGTTCCTAACAGTGG + Intergenic
978834671 4:113134538-113134560 GTTCTCCTTGTTCCAGAGCAAGG + Intronic
983495326 4:168436770-168436792 GATATCTTAGTTCCAAAGAGAGG + Intronic
985189429 4:187355763-187355785 TTTCTTCTGGCTCCAAAGACTGG - Intergenic
986502015 5:8410666-8410688 GTTTTGCTGGTTGCAAGGAGAGG + Intergenic
988181236 5:27796856-27796878 GTTCTCCTGTTGCCACATAGGGG - Intergenic
989721589 5:44535159-44535181 GTTCTCCTGGAGCCAGAGAAAGG + Intergenic
989979621 5:50628013-50628035 GTTCTCCTAATTCTAAAAAGAGG + Intergenic
990375346 5:55164633-55164655 GTGCTCTTGAATCCAAAGAGTGG - Exonic
991030270 5:62075087-62075109 ATTATCCTGGTCCCAAAGATGGG + Intergenic
991447221 5:66713191-66713213 GTTCTCCTTGTACCATATAGAGG + Intronic
994241355 5:97425038-97425060 TTTCTGCTGGTACCAAAGAAGGG + Intergenic
994772727 5:104003640-104003662 GTTTTCCCAGGTCCAAAGAGAGG + Intergenic
999816761 5:155184690-155184712 GATGTCCTGTTTCCAAAGAACGG - Intergenic
1001206287 5:169766260-169766282 GTTCACATGGATGCAAAGAGCGG - Intronic
1002878713 6:1233813-1233835 GTTCTCCTGCTTCCAGGGTGTGG - Intergenic
1004071995 6:12307870-12307892 TTTCCCCTGTTTTCAAAGAGTGG + Intergenic
1009191827 6:60638537-60638559 CGTCCCCTGGTTCCAATGAGAGG - Intergenic
1010067258 6:71698002-71698024 GTTCTCATGGTCCAAAAGAGAGG - Intergenic
1010667348 6:78646157-78646179 GTTATCCTGATTCCAAAGCCTGG - Intergenic
1011242073 6:85283148-85283170 GATCTCATGGTTTCAAAGTGTGG - Intergenic
1017451175 6:154555671-154555693 GTTCTCCTGGAACCTGAGAGGGG + Intergenic
1018644095 6:165931793-165931815 CTTCTCCTCCTTCCAAAGCGTGG + Intronic
1019510052 7:1413200-1413222 GGTCTCCTGGCTGCAAAGCGAGG + Intergenic
1019841659 7:3452328-3452350 AATCACCTGCTTCCAAAGAGTGG - Intronic
1020880077 7:13750204-13750226 TTTCTACAGGTTCCAAAAAGTGG - Intergenic
1022212952 7:28229518-28229540 CTTATCCTGGTTCCATATAGTGG + Intergenic
1023781805 7:43662841-43662863 GGTCTCTTGGTTCCTTAGAGAGG - Intronic
1028861780 7:95659708-95659730 GTTCTTCTGGTTTGAAATAGAGG + Intergenic
1030234390 7:107242717-107242739 GTTCTCCTGGTGACAAGCAGTGG - Intronic
1033579181 7:142716029-142716051 GGACCCCTGGTTCCACAGAGTGG - Intergenic
1033741402 7:144278362-144278384 GTGCTCCTGGTTGGAAAGTGTGG + Intergenic
1033752501 7:144371252-144371274 GTGCTCCTGGTTGGAAAGTGTGG - Exonic
1033952916 7:146807626-146807648 GCTCAGCTGGTTCCAAAGCGTGG - Intronic
1035052998 7:156014808-156014830 GTTCCCCTAGCTCCAGAGAGAGG - Intergenic
1036917051 8:12814257-12814279 GTTCTGCTGATTCCAAGGGGTGG + Intergenic
1039721097 8:40165221-40165243 GTCCTCCTGGTAACAAAAAGAGG - Intergenic
1051679793 9:19595557-19595579 GTTTTCCTGCTTCCAAAGCCCGG + Intronic
1052037733 9:23702010-23702032 GTTCTCCTTGTTTCAAGGACAGG - Intronic
1052116631 9:24656387-24656409 ATTCTCTTGGTTACTAAGAGAGG + Intergenic
1055802025 9:80048376-80048398 GTGCTGCTGATTCTAAAGAGAGG + Intergenic
1057673323 9:97115020-97115042 TTTCTCATGGTTCTAAAGACTGG - Intergenic
1058664302 9:107296187-107296209 GTGCACCTGGTTCCAAAGTCTGG + Intronic
1061450864 9:130666404-130666426 GGTCTCCAGGTTGCAAACAGAGG + Intronic
1061623268 9:131825163-131825185 TTTCTCCGGGTTCCAGGGAGGGG + Intergenic
1185627451 X:1492752-1492774 ATTGTCCTAGTTCCAGAGAGAGG + Intronic
1185712594 X:2316055-2316077 TTTCTCCTTGTTGGAAAGAGTGG + Intronic
1189197616 X:39165531-39165553 GTTTTCCTATTTCCAAAGTGAGG - Intergenic
1193786788 X:85769371-85769393 ATTATCCTGATTCCAAAGACTGG - Intergenic
1195531079 X:105959071-105959093 GTTCTTCTGGTCCTAAAGAAAGG - Intergenic
1200756876 Y:6998320-6998342 GCTCTGATGGCTCCAAAGAGAGG - Intronic