ID: 902878461

View in Genome Browser
Species Human (GRCh38)
Location 1:19355040-19355062
Sequence CAGAGGGGCTGGAGGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 773
Summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 683}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902878461_902878473 14 Left 902878461 1:19355040-19355062 CCTTCTGGCCTCCAGCCCCTCTG 0: 1
1: 0
2: 6
3: 83
4: 683
Right 902878473 1:19355077-19355099 GTGGAGCTTCTATAGGTGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 128
902878461_902878472 13 Left 902878461 1:19355040-19355062 CCTTCTGGCCTCCAGCCCCTCTG 0: 1
1: 0
2: 6
3: 83
4: 683
Right 902878472 1:19355076-19355098 AGTGGAGCTTCTATAGGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 104
902878461_902878475 18 Left 902878461 1:19355040-19355062 CCTTCTGGCCTCCAGCCCCTCTG 0: 1
1: 0
2: 6
3: 83
4: 683
Right 902878475 1:19355081-19355103 AGCTTCTATAGGTGGAGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 173
902878461_902878471 10 Left 902878461 1:19355040-19355062 CCTTCTGGCCTCCAGCCCCTCTG 0: 1
1: 0
2: 6
3: 83
4: 683
Right 902878471 1:19355073-19355095 GGCAGTGGAGCTTCTATAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 81
902878461_902878474 17 Left 902878461 1:19355040-19355062 CCTTCTGGCCTCCAGCCCCTCTG 0: 1
1: 0
2: 6
3: 83
4: 683
Right 902878474 1:19355080-19355102 GAGCTTCTATAGGTGGAGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 165
902878461_902878470 7 Left 902878461 1:19355040-19355062 CCTTCTGGCCTCCAGCCCCTCTG 0: 1
1: 0
2: 6
3: 83
4: 683
Right 902878470 1:19355070-19355092 AGAGGCAGTGGAGCTTCTATAGG 0: 1
1: 0
2: 1
3: 13
4: 132
902878461_902878469 -5 Left 902878461 1:19355040-19355062 CCTTCTGGCCTCCAGCCCCTCTG 0: 1
1: 0
2: 6
3: 83
4: 683
Right 902878469 1:19355058-19355080 CTCTGACACAGGAGAGGCAGTGG 0: 1
1: 0
2: 4
3: 31
4: 435
902878461_902878476 25 Left 902878461 1:19355040-19355062 CCTTCTGGCCTCCAGCCCCTCTG 0: 1
1: 0
2: 6
3: 83
4: 683
Right 902878476 1:19355088-19355110 ATAGGTGGAGGGAGGGTCCCAGG 0: 1
1: 0
2: 1
3: 31
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902878461 Original CRISPR CAGAGGGGCTGGAGGCCAGA AGG (reversed) Intronic
900080940 1:856922-856944 GAGAGGGGCTTGAGGCAGGAAGG - Intergenic
900122186 1:1053534-1053556 GAGACGGGCGGGAGGACAGATGG - Intronic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183791 1:1323968-1323990 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183798 1:1323984-1324006 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900300241 1:1973449-1973471 GGGAGGGGATGGAGGCCAGAAGG + Intronic
900357198 1:2270679-2270701 CAGAGGGGCTGGAGGTGGGGCGG + Intronic
900398319 1:2462344-2462366 CAGAGGGGCTGTCAGGCAGAGGG - Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
900643763 1:3699478-3699500 GAGAAGGCCAGGAGGCCAGAGGG + Intronic
900686915 1:3954547-3954569 CAGAGGGGCGGGAGGAGAGGCGG - Intergenic
900721035 1:4175982-4176004 CAGAGGGGTCGGAGGTCAGAGGG - Intergenic
900721046 1:4176025-4176047 CAGAGGGGTCGGAGGTCAGAGGG - Intergenic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
900940217 1:5793614-5793636 CAGTGGTGGTGGTGGCCAGATGG + Intergenic
901190944 1:7409395-7409417 CTTAGTGGCTGGTGGCCAGAGGG - Intronic
901648508 1:10729203-10729225 CTGCAGGGCGGGAGGCCAGAGGG + Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902018654 1:13328431-13328453 CAGACGGGGTGGTTGCCAGACGG - Intergenic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903336440 1:22627557-22627579 CAGAGAGGCTGAAGCCCAGGGGG + Intergenic
903637982 1:24834023-24834045 CAGACGGGGTGGTTGCCAGACGG + Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
903845954 1:26280121-26280143 CAGACGGGCCGGCGGGCAGAGGG - Exonic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904330711 1:29756186-29756208 CAGAGGGAGGGGAGGCCGGAGGG + Intergenic
904356344 1:29942565-29942587 CACAGGGTCTGGGGGGCAGAGGG + Intergenic
904492624 1:30870277-30870299 CAGGAGGCCAGGAGGCCAGATGG - Intronic
904698953 1:32346915-32346937 GAGAGGGGCTGGAGGAGGGAGGG + Intergenic
904832917 1:33316744-33316766 GAAGGGGGCTGGAGCCCAGAAGG + Intronic
905095242 1:35464722-35464744 CACAGGGGCTGGAGGCCTGGAGG + Intronic
905124404 1:35707255-35707277 GAGAGGGGCTGGGAGGCAGATGG + Intergenic
905283059 1:36861389-36861411 AAGACAGGCTGGGGGCCAGAAGG - Intronic
905434302 1:37946401-37946423 CAGAGGGGTTGGGGGCAGGAGGG + Intronic
906260121 1:44380621-44380643 CAGAGAGCCTGGAGGGCAGTGGG - Intergenic
906279346 1:44542878-44542900 GAGTGGGGCTGGGGGCCGGAGGG + Intronic
906526001 1:46493634-46493656 CACAGTGGCTGTAGACCAGAGGG - Intergenic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
906531311 1:46525571-46525593 CCAAGGGGCTGGAGGTGAGATGG - Intergenic
906666589 1:47626455-47626477 CACAGGGTCTGGATGCCATATGG - Intergenic
907045668 1:51298676-51298698 CAGAGGGGCTGTGTGCCACAGGG - Intronic
907178372 1:52547067-52547089 CCCAGGAGGTGGAGGCCAGAAGG + Intronic
907248757 1:53123962-53123984 CAGAGGAGCGGGTGGCCAGAGGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
907494687 1:54836083-54836105 CAGAGGGGTTTGAGGGGAGAAGG - Intronic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
908225625 1:62053156-62053178 CAGAGGGCCTGGAGGCCTGAGGG + Intronic
910684319 1:89900915-89900937 CATGGCGACTGGAGGCCAGAGGG + Intronic
912381143 1:109248947-109248969 CAGAGTGGGTGGAAGCCAGGTGG - Intergenic
912453536 1:109783059-109783081 CAGCGGGGGTGGGGGCCAGCTGG - Intergenic
912503847 1:110142054-110142076 CAGAGGCCCTGGAGGCCAAGAGG - Intergenic
912551805 1:110489761-110489783 CAGAGGAACAGGAGGTCAGACGG - Intergenic
914264873 1:146029996-146030018 CAGAAGCCATGGAGGCCAGAGGG - Intergenic
914355094 1:146877939-146877961 CAGAGGGGCTGGAAGGGTGAAGG - Intergenic
914490483 1:148147908-148147930 CAAAGGGGCAGCAGGACAGATGG - Intronic
915447357 1:155981573-155981595 CAGAGACTCTGGAGCCCAGATGG - Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915731625 1:158058248-158058270 CAGAGGGGCTGAGGGCAGGAAGG - Intronic
915905411 1:159873284-159873306 AAATGGGGCTGGAGCCCAGAGGG - Intronic
915980339 1:160416232-160416254 CTGAGGGGCTGGAGGCTCCACGG + Intronic
916903684 1:169257573-169257595 CAGAGGGGGAGGAGCCAAGATGG - Intronic
917468610 1:175306896-175306918 CAGAGTGGCTGAAGCACAGATGG - Intergenic
919082874 1:192887565-192887587 GACAGGGGCTGGGCGCCAGAAGG - Intergenic
919892153 1:201983154-201983176 CAGGGCGGCTGGGGGCCGGAAGG - Intronic
919921658 1:202169766-202169788 CACAGGGGCTGGAGGAAGGATGG - Intergenic
919958226 1:202439573-202439595 CAGAGGGGGTGGCGGCCACCTGG - Intronic
921140354 1:212299238-212299260 CAGACGGGGTGGTTGCCAGACGG + Intronic
921219683 1:212964365-212964387 CAGAGCTGCTGCAGGCCAGGTGG - Intronic
921221422 1:212976763-212976785 CAGATGGGCAGGAGGGCAGAGGG - Intronic
921794792 1:219329893-219329915 CAGAGGGGGTGGGGGCGAGGAGG - Intergenic
922899322 1:229123888-229123910 CTGAGGGGCTGGAGGCTGGGTGG - Intergenic
923245501 1:232127364-232127386 CAGAAGGCATGGAGGCCACAAGG - Intergenic
924200746 1:241655965-241655987 CACAGGGCCTGGTGTCCAGAAGG + Intronic
924415044 1:243849983-243850005 CGGAGGGAGTGGAGGCCAGGCGG + Intronic
924458075 1:244234106-244234128 CAGAGGGGGTGGCGGCAGGAAGG - Intergenic
924570669 1:245234942-245234964 CACAGGGGCAGGAGGCCAGGAGG - Intronic
924603236 1:245509856-245509878 CAGAGGAGCTGAAGGCAGGAAGG - Intronic
924796720 1:247297869-247297891 GTGAGGGGCTGGAAGCCACAGGG - Exonic
1062854685 10:773999-774021 CAGGGGTGCAGGAGGCGAGAGGG + Intergenic
1062911475 10:1215127-1215149 CCAAGGGGCTGGAGGTCAGGGGG - Intronic
1063199683 10:3776063-3776085 CAGAGGGACTCCAGGCCAGAGGG - Exonic
1064118201 10:12596793-12596815 AAGGGGGACTGGAGGCCAGGAGG - Intronic
1065020920 10:21500920-21500942 CAGTGGGGCTTTGGGCCAGAAGG + Intergenic
1065022971 10:21516346-21516368 CAGCGGCGGCGGAGGCCAGATGG + Exonic
1065093453 10:22258667-22258689 CTGAGGGGCAGGTGGTCAGATGG - Intergenic
1065134987 10:22659084-22659106 CAGAGGGACCTGAGGCCAGAGGG - Intronic
1066085320 10:31969877-31969899 CAGACGGGGTGGTTGCCAGACGG - Intergenic
1066253944 10:33660827-33660849 GGGAGGGGCTGGAGGGCAGGGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067146057 10:43694732-43694754 CAGAGGGGCTGGAGGAGGGGAGG + Intergenic
1067225089 10:44370725-44370747 CAGAGGGGCTGAATAGCAGAAGG - Intronic
1067451531 10:46384874-46384896 CAGAGGAGCCGGAGTCCAGATGG - Intronic
1067585708 10:47474882-47474904 CAGAGGAGCCGGAGTCCAGATGG + Intronic
1067789697 10:49278397-49278419 CAGAGTGCCTGGAAGGCAGATGG - Intergenic
1068845033 10:61662804-61662826 CAGAGGAGCAGGAGGCCGGGAGG - Intergenic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069903152 10:71717352-71717374 CGAAAGGGCTGGGGGCCAGAGGG - Intronic
1070589741 10:77793442-77793464 CAAAGAGGCTGAAGGCCAGAAGG + Intronic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070756789 10:78998288-78998310 CACAGGCCCTGGGGGCCAGAAGG + Intergenic
1070793761 10:79205038-79205060 CAGATGGACTGGTGGACAGATGG + Intronic
1070948233 10:80410380-80410402 GAGCGGGCCTGCAGGCCAGAGGG + Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071468411 10:85961500-85961522 CAGAAGGGAGGGAGGACAGACGG - Intronic
1072391579 10:94992935-94992957 ATCAGGGGCTGGAGGCCAGAAGG + Intergenic
1073078044 10:100836749-100836771 CAGAGGAGCAGGAGGCCTGGAGG - Intergenic
1073459491 10:103658481-103658503 CAGGGAAGCTGGAGGCCTGACGG - Intronic
1074044588 10:109825814-109825836 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
1074048719 10:109863339-109863361 CAGAAATTCTGGAGGCCAGAAGG + Intergenic
1074165763 10:110872349-110872371 CAGAGGGGGAGGAGGGCTGAGGG - Intronic
1074551330 10:114445079-114445101 CATTGGTGCTGGAGGTCAGAGGG - Intronic
1074929738 10:118112198-118112220 CAGATGGGATGGAGACCAGTTGG + Intergenic
1075121175 10:119666096-119666118 CAGAGGGCCTGGAGGGTAAAGGG - Intronic
1075516055 10:123109202-123109224 TAGAGGAGATGGAGGCAAGAAGG + Intergenic
1076106004 10:127824170-127824192 CAGAGGGGCTGGAAGGCATGGGG + Intergenic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076736481 10:132461395-132461417 GAGAGGGGCTGGGGGCAACAAGG - Intergenic
1077028418 11:451954-451976 CACAGGGCCCGGAAGCCAGAGGG - Intronic
1077238071 11:1492805-1492827 GAGAGGTTCTGGAGGCCACACGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1078636137 11:13052239-13052261 GAGAGCTGCTGGAGCCCAGAGGG + Intergenic
1079117901 11:17652227-17652249 CTGGGGGGCTAGAGGCCAAAGGG - Intergenic
1079259660 11:18866153-18866175 CACAGGGGCTGGAGGCCTCCAGG + Intergenic
1079289157 11:19171241-19171263 CATAGGGGATGGAAGCCAGCAGG - Intronic
1080235353 11:30062313-30062335 CAGAAAGCATGGAGGCCAGAAGG + Intergenic
1081526309 11:43930118-43930140 CACAGGGGCTGGGGGCCAGGTGG - Intronic
1081632924 11:44701645-44701667 CAGAAGGGGCTGAGGCCAGAGGG + Intergenic
1081703523 11:45166536-45166558 CAGGGGGCCTGGATGCCAGCAGG + Intronic
1082956691 11:58877404-58877426 CAGAGGGAGTGGAGCCAAGATGG - Intronic
1083712116 11:64555892-64555914 CTGAGGGGCAGGAAGGCAGAAGG + Exonic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1084196254 11:67524769-67524791 CAGAGGGGCAGGCGGTGAGATGG - Intergenic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1084805460 11:71575889-71575911 CAGAGGGGATGCAGTGCAGACGG + Intergenic
1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG + Intronic
1084979457 11:72821608-72821630 CGGAGGGACTGGAGGCCTGGAGG + Intronic
1085084111 11:73655481-73655503 CAGGTGGGCTAGAGGACAGAAGG + Intronic
1085296209 11:75433203-75433225 CAAAGGGGCTGGACGCCAGGAGG + Intergenic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085784818 11:79440129-79440151 CAGAGGGGCTGCAGGCGACCGGG + Intronic
1087370750 11:97280283-97280305 CAGTGGTGGTGGTGGCCAGAGGG + Intergenic
1088883292 11:113988304-113988326 CAGAGGGGCAGCAGGCTGGAGGG - Intronic
1089071158 11:115700684-115700706 CAGAGGGTGGGGAGACCAGAGGG + Intergenic
1089609348 11:119660840-119660862 CAGAGGAGCAGGAGCCCTGAGGG - Intronic
1090212979 11:124935906-124935928 CAGACAGGTAGGAGGCCAGAGGG - Exonic
1090421455 11:126578266-126578288 CAGAGAAGCTGGAGGGGAGAGGG - Intronic
1090471582 11:126985598-126985620 CAGAGGGACAGGAGGCACGAGGG + Intronic
1091230606 11:133985745-133985767 AGGAAGGGCTGGAAGCCAGACGG - Intergenic
1091322224 11:134659837-134659859 CTTAGAGGCTGGAGGACAGATGG + Intergenic
1091378570 12:42051-42073 CAGACGGGGTGGTTGCCAGACGG - Intergenic
1091400212 12:176736-176758 CAGATGGGCTGGCAGCCACAGGG - Exonic
1091869001 12:3871876-3871898 CAGAAGGGCAGGAGATCAGAGGG - Intronic
1092170335 12:6370372-6370394 AAGAGGGGCTAGAGGGGAGAGGG - Intronic
1092225271 12:6744371-6744393 CAGAGGGGCCTGAGCCCAGGTGG + Intergenic
1092609201 12:10153940-10153962 GAGAGGGGCTGGAGGGCAGGAGG + Intergenic
1093728662 12:22543978-22544000 CTGAGGGGCTGGGGGCGAGGTGG + Intronic
1094745445 12:33339244-33339266 CACAGGTGCTGGAGAACAGATGG + Intergenic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096048628 12:48586614-48586636 GGGAGGGGCTGGAGGGCAGGAGG - Intergenic
1096563282 12:52452110-52452132 GTGAGAGGCTGGAGGCGAGAGGG + Exonic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096882588 12:54684871-54684893 GAGAGGGGCTGGCAGCCTGAGGG + Intergenic
1098304406 12:69087996-69088018 AAGAGGTCCTGGAGGCCAGTGGG - Intergenic
1098590141 12:72201499-72201521 CAGAGGGTCTGGAGCCTAGAGGG - Intronic
1100570760 12:95841578-95841600 CAGACGGGGTGGTTGCCAGACGG + Intergenic
1100741169 12:97595260-97595282 CAAAGGGGCTGGGGGTCAGAAGG + Intergenic
1102573065 12:113839276-113839298 CAGGAGGGCAGGAGGCCAGCAGG + Intronic
1103045690 12:117732850-117732872 CAGAGGGGATGTAGGCCAGGAGG + Intronic
1103567777 12:121825469-121825491 CAGAGGGGCTGGCACACAGAGGG + Intronic
1104715919 12:131016114-131016136 CAGAGGGCTTGGAGGAGAGAAGG - Intronic
1105284512 13:18993447-18993469 CAGAAAGCCAGGAGGCCAGAAGG + Intergenic
1105284836 13:18995368-18995390 CAGATGGGCAGAAGGCCAAAAGG + Intergenic
1105285052 13:18996609-18996631 CAGAGGGCCAGAATGCCAGAAGG + Intergenic
1105431356 13:20340321-20340343 CCCAGGGGCTGGAGGGCAGGTGG - Intergenic
1105982651 13:25534818-25534840 CAGAGCTGCTGGAACCCAGATGG + Intronic
1106434693 13:29713071-29713093 CATAGAACCTGGAGGCCAGATGG + Intergenic
1109814183 13:67557851-67557873 CAGAAGCCATGGAGGCCAGAAGG + Intergenic
1110136265 13:72071048-72071070 CAGAAGAGCTGGAGGATAGAAGG - Intergenic
1110663300 13:78084873-78084895 GAGAGGGGATGAAGGCCAGAAGG + Intergenic
1112475916 13:99730646-99730668 GACAGGAGCTGAAGGCCAGAGGG + Intronic
1112477705 13:99747380-99747402 CAGAGCGGCAGGAGGCAAGGAGG - Intronic
1112484915 13:99811315-99811337 GAGAGGGGCTGGAAGCCACAGGG + Intronic
1113107201 13:106784386-106784408 AAAAGGGGCTGGAGCCAAGATGG - Intergenic
1113871904 13:113564877-113564899 AAGAGGGGCTGAGGGCCCGAGGG - Intergenic
1115772250 14:36676537-36676559 CAGAAGGGTTGGAGGGCAGGAGG - Exonic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1116396741 14:44455661-44455683 CAGAGGAGCTGGTTGCCATATGG - Intergenic
1116546138 14:46167264-46167286 GAGAGGGGGTGGAGCCAAGATGG - Intergenic
1117015851 14:51515963-51515985 CAAAGGGGTTGAAGGCCAGAAGG + Intronic
1117064884 14:52002788-52002810 TAAAGGGGCTGGAGGACAAAAGG - Intronic
1117280271 14:54233874-54233896 AGGAGGGGCTGGAGCCAAGATGG + Intergenic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1118141085 14:63083829-63083851 CAGAAACTCTGGAGGCCAGAAGG + Intronic
1118341255 14:64895883-64895905 CAGACGGGGTGGTTGCCAGACGG + Intergenic
1118377920 14:65192882-65192904 GAGAGAGGCAGGAGGTCAGAAGG + Intergenic
1119421508 14:74510318-74510340 CAGAGGGGCCGCAGGCCACCTGG + Intronic
1119441071 14:74629227-74629249 TGGAGGGGCTGCAGGTCAGATGG - Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1120858839 14:89236190-89236212 AAGAGCGACTGGAAGCCAGAAGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121665875 14:95671744-95671766 CAGAGGAGGAGGAGGACAGAGGG + Intergenic
1121908742 14:97770065-97770087 AAGATGGGCTGGAGGCCAAGGGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122181535 14:99958607-99958629 CAGAGGCACAGGAGGTCAGAGGG + Intergenic
1122251290 14:100441593-100441615 CAGATGGGCTGGGGGCCACATGG + Intronic
1122308999 14:100783034-100783056 CAGAGGGGCTGCAGGCACCAGGG + Intergenic
1122352346 14:101103455-101103477 CAGAGAGGCTGGAGTGCTGAGGG - Intergenic
1122382913 14:101322460-101322482 ATCAGGGGCTGGAGGCCGGATGG - Intergenic
1122516865 14:102314867-102314889 CAGGGGTGCAGGAGGGCAGAGGG + Intergenic
1122530071 14:102419163-102419185 CAGAGGAGTCGGAGGCCATATGG + Intronic
1122809313 14:104280238-104280260 AAGAGGGGCTGCAGGCCGGGAGG + Intergenic
1125722313 15:41851209-41851231 CAGAGGGGCCCCAGGACAGAGGG - Intronic
1127836600 15:62795583-62795605 CAGAAGGGCTGGAGTCTAGAGGG - Intronic
1127838901 15:62812797-62812819 CCGAGGGGCGGGCGGGCAGATGG + Intronic
1128159677 15:65415373-65415395 CAGAGGGGCTGGCGGCTGGCTGG + Intronic
1128460026 15:67859930-67859952 CAGAAGGGCTTGAGCACAGAGGG + Intergenic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128650933 15:69413162-69413184 CAGAGGGGTGGGAGACAAGAGGG + Intergenic
1128772529 15:70292753-70292775 AAAAGGGGCTGGAGGGCTGAGGG - Intergenic
1129358963 15:75012560-75012582 CAGAGTGGCCGGTGGCCACAGGG + Intronic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1131076388 15:89497709-89497731 AAGAGGGGCTGGAGGGGAGCAGG + Intergenic
1131910965 15:97200925-97200947 CACAGGGGAAGGAGGCCAGTGGG - Intergenic
1132141729 15:99402663-99402685 AAGAGGGGCTGGAGCCCAGTGGG - Intergenic
1132234450 15:100208540-100208562 CAGAGGGACTAGTGACCAGAAGG + Intronic
1132244600 15:100284589-100284611 CTGAGGGGTGGGAGGCTAGAGGG + Intronic
1132415563 15:101616231-101616253 TAGCAGGGCAGGAGGCCAGAGGG + Intergenic
1132500176 16:281511-281533 CAGAGGAGCTGCAGGCCTGGCGG + Intronic
1132513525 16:355174-355196 CCGAGGAGCTGGAGGCCCAAGGG - Intergenic
1132550637 16:552597-552619 CCGAGGGGCTGGAGGCTACAAGG - Exonic
1132574108 16:656880-656902 CCGTGGGGCTGGTGGCCAGCTGG - Intronic
1132602528 16:780059-780081 CAGGAGGGCTGGATGCCAGCGGG - Exonic
1132684367 16:1156152-1156174 CAGAGGTGCTGGCGGCGAGGAGG - Intronic
1132746830 16:1439678-1439700 CTGGGGGGCAGGAGGCCAGCAGG - Intronic
1132895594 16:2228017-2228039 GAGAGGGGCTGGGAGGCAGAGGG - Intronic
1132983076 16:2749213-2749235 CATGGGGCCTGGAAGCCAGAAGG + Intergenic
1133092402 16:3414386-3414408 AATAGGGGCTGGAGGCAATATGG + Intronic
1133323759 16:4931008-4931030 AAGAGGGACTGGAGGCCTGCTGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1133971552 16:10571771-10571793 GAGAGGGGATGGATTCCAGAAGG + Intronic
1135162477 16:20109422-20109444 ATGAGGGGTTGGTGGCCAGATGG + Intergenic
1135528076 16:23229185-23229207 TATAGGGGTTGGAGGCCAAAAGG + Intergenic
1135715117 16:24757621-24757643 GAGAGGGGCTTGAGGACAGCAGG - Intronic
1135989749 16:27210712-27210734 CAGAGGGGTTGCAGGCCACGAGG - Intronic
1136073556 16:27803254-27803276 CAGAGGGGCTTGGGGCGCGATGG - Intronic
1136499824 16:30664620-30664642 GGGAGTGGCTCGAGGCCAGAGGG + Intronic
1136536635 16:30903398-30903420 CAGAGGGGCTGAAGGAAAGGAGG - Exonic
1136547998 16:30966082-30966104 CACAGGGGCAGGAGGGCAGAGGG + Exonic
1137407088 16:48197775-48197797 CTGATGGGCAGGAGGCCTGAAGG - Intronic
1137547680 16:49415719-49415741 CAGAGGGAGGGGAGGCCAGAGGG + Intergenic
1138089916 16:54165545-54165567 CCGCGGGGCTGAAGGACAGAAGG + Intergenic
1138105913 16:54287067-54287089 CGGAGGGGCGGGAGGCGGGAGGG - Intergenic
1138414122 16:56861544-56861566 CAGTGGGGCTGAAGGCTTGAGGG - Intergenic
1138551662 16:57752029-57752051 CAGAGCTGCCGGAGGCCAGGAGG - Exonic
1138722268 16:59096416-59096438 CACAGGGGGTGGAGCCAAGATGG + Intergenic
1139920079 16:70454420-70454442 CAGCGGGGCTGCAATCCAGAAGG - Exonic
1139978922 16:70837590-70837612 CAGAGGGGCTGGAAGGGTGAAGG + Intronic
1141430264 16:83967677-83967699 CAGATGGGCGGGCGGGCAGATGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142028839 16:87828520-87828542 CAGCTGGGCTGGGGGCCAGGCGG + Intergenic
1142031937 16:87842876-87842898 CAGATGGGAGAGAGGCCAGAGGG - Intronic
1142194648 16:88733806-88733828 AAGAGGCTCTGGAGCCCAGAGGG + Intronic
1142283815 16:89162896-89162918 CAGAGGCTCAGGAGGCCAGAGGG - Intergenic
1142596492 17:1032155-1032177 CGGAGGGGCCGGGGGCCAGGCGG + Intronic
1142604638 17:1074688-1074710 CAGGGAGGCTGGAGGCCAGGAGG + Intronic
1142742590 17:1939872-1939894 CAAAGGGGCTGGAGGCTAGCTGG - Intronic
1142872440 17:2829494-2829516 TAGAGGGGCTGGAGGTGAGCAGG - Intronic
1142958115 17:3535048-3535070 CAGAGGGGCAGGAGGGGAGGAGG - Intronic
1142964499 17:3572270-3572292 CAGAGGAGCTGAGGGGCAGAGGG + Intronic
1143308964 17:5972460-5972482 CAGAGGAGCTGAAAGTCAGAGGG + Intronic
1143344499 17:6240015-6240037 GAGATGGGCTGGTGGCTAGAGGG - Intergenic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1143450304 17:7032337-7032359 CAGAGGCCTTGGAGGACAGAGGG - Intergenic
1144085390 17:11803793-11803815 CAGAGGAGTTGGAGTCCAGCTGG - Intronic
1144517511 17:15928857-15928879 CAGAGTGGCTGGAGGTCTGGAGG + Intergenic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145209077 17:20999965-20999987 CAGAGGGCCCCGGGGCCAGAGGG + Exonic
1145241049 17:21241264-21241286 CGGATGGGCTGGAGGCCACAGGG + Exonic
1145269621 17:21397791-21397813 CAGGGGAGCTGGAGGCCGCAGGG - Intronic
1145733646 17:27212184-27212206 CAGACGGGGTGGTTGCCAGACGG - Intergenic
1146144483 17:30401091-30401113 CAGAAGCCATGGAGGCCAGAAGG - Intronic
1146178148 17:30679698-30679720 CAGAGGAGGGGGAGGACAGAGGG + Intergenic
1146797752 17:35795004-35795026 CAGACGGGCAAGAGCCCAGAGGG - Intronic
1147242132 17:39097312-39097334 CATAGGGTCTGCAGACCAGATGG + Intronic
1147620835 17:41865557-41865579 CAGAGCTGCTGGAGGCGAGGCGG - Intergenic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148018052 17:44536456-44536478 CAGAGGGGCTGTCAGCCAGATGG + Intergenic
1148196785 17:45719756-45719778 GAGAGGAGGTGGAGGCCAGCTGG + Intergenic
1148539914 17:48472179-48472201 CAGAGGAGCTAGAGGCCAGTGGG + Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1150284873 17:63949007-63949029 CACTGGGGCTGGGGGCCAGGAGG - Intronic
1150627232 17:66849344-66849366 CAGAGGAGGAGGAGGCCAGCAGG + Intronic
1150711172 17:67531987-67532009 CAGAGAGGCAGGAAGGCAGATGG + Intronic
1151306793 17:73267741-73267763 GGGAGGGGCTGGAGGTCAGGAGG + Intergenic
1151318303 17:73337347-73337369 CAGAGGCACAGGAGCCCAGAGGG - Exonic
1151477995 17:74354597-74354619 CATAGCAGCTGGAGGCCTGAGGG + Intronic
1151534962 17:74733901-74733923 GAGAGGGGCTGCAGGCCTGCTGG - Intronic
1151657927 17:75504268-75504290 CAGAGCGGCAGTTGGCCAGAGGG + Exonic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1152010672 17:77711817-77711839 CAGATCGGCGGGAGCCCAGATGG - Intergenic
1152170023 17:78739723-78739745 CACAGGAGCTGGAGACCAGTTGG + Intronic
1152306255 17:79522415-79522437 CACCAGGGCTGGAGGCCTGAGGG + Intergenic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1152709243 17:81862066-81862088 TGTAGGGGCTGGAGGACAGAAGG + Intergenic
1153818379 18:8810445-8810467 CAGAGGAGCTTGTGGGCAGAAGG + Intronic
1153966807 18:10189926-10189948 CAGTGGGCTTGGAGGCCTGATGG + Intergenic
1154061953 18:11070669-11070691 CAGAAGGGCTTCAGCCCAGAAGG + Intronic
1155438748 18:25839647-25839669 ATGAGGTGCTGGAGGCCAGAGGG + Intergenic
1156449684 18:37259770-37259792 AAGAGAGGCTGCAGGCCAGGGGG - Intronic
1157314452 18:46576239-46576261 CTGACTGGCTGGATGCCAGATGG - Intronic
1157622791 18:49025902-49025924 CAGAGGCCGTGGAGGCCAGAGGG - Intergenic
1158215619 18:55097700-55097722 CAGGGGGCCTGGAGGCTGGACGG - Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1159913379 18:74167061-74167083 CAGGGGTTTTGGAGGCCAGAGGG - Intergenic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160451793 18:78971522-78971544 CAGAGGTGCTGAAGGCCTTAAGG - Intergenic
1160752550 19:741354-741376 CAGCTGGGCTGGAGGGCTGAGGG + Intronic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161314856 19:3613031-3613053 GGGCGGGGCTGGAGGCCAGGGGG - Intronic
1161456735 19:4373377-4373399 CTGAGAGGCTGGAGGCTCGAAGG - Intronic
1161569656 19:5023567-5023589 CACAGGGGCTGGAGGCCGGCTGG + Intronic
1161737834 19:6002505-6002527 CACAGCGCCTGGACGCCAGAGGG + Intronic
1162283658 19:9720801-9720823 ATTAGGGACTGGAGGCCAGATGG - Intergenic
1162450089 19:10749249-10749271 CATAGGGGCTGGAAGTCAAAAGG + Intronic
1162602025 19:11676783-11676805 CAGACGGGGTGGAGGCCAGGCGG + Intergenic
1163112712 19:15170964-15170986 CAGTGGGGTTGGATGCCAGGTGG - Intronic
1163115008 19:15183951-15183973 CTGAGGTGCTTGAGCCCAGAAGG + Intronic
1163400949 19:17092051-17092073 CACAAGGGCTGAAGGCCACATGG - Intronic
1163406478 19:17126188-17126210 CAGAGGGGGCGGAGGCCAGCAGG - Intronic
1163613619 19:18313320-18313342 CAGGGTGGCTGGGGGCCAGGTGG + Intronic
1163692000 19:18743248-18743270 CCGAAATGCTGGAGGCCAGATGG - Intronic
1164066436 19:21721142-21721164 CAGACGGGGTGGTTGCCAGACGG - Intergenic
1164159140 19:22615386-22615408 CAGAGTGGCTTGAGGCTAGCTGG + Intergenic
1165013848 19:32866797-32866819 CAGAGGGGATGGAGGAGGGACGG - Intronic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165226227 19:34357198-34357220 CAGCAGTGCTGGAGGCCAGAGGG + Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165421786 19:35725646-35725668 CAGGGTGGGTGGAGGCCTGAAGG + Intronic
1165766741 19:38356383-38356405 CGGAGGGGCTGGTGGGCATAAGG + Intronic
1166007749 19:39918682-39918704 AATGAGGGCTGGAGGCCAGATGG - Intronic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166679751 19:44759208-44759230 AAGAGGGGCCGGGGGTCAGAAGG - Intronic
1166913922 19:46181143-46181165 CAGTGAGGCTGGAAGCAAGATGG - Intergenic
1167135405 19:47612631-47612653 GAGAGGGGCTGGGGGGCTGACGG + Intronic
1167161038 19:47767169-47767191 TAGAGGGGCTTGAGGACAAAGGG - Intergenic
1167419980 19:49397180-49397202 AGGAGGGACTAGAGGCCAGAAGG + Intronic
1167737017 19:51300919-51300941 CAGAGGGGATGGAGGAGGGATGG + Intergenic
1167980773 19:53273072-53273094 CAGAGGTGCTGGAGGCATGGAGG + Intergenic
1168113819 19:54209683-54209705 CACAGAGCCTGGAGGGCAGATGG + Intronic
1168251275 19:55143648-55143670 CAGAGGGGTGGGAGGCAAGCCGG - Intronic
925146822 2:1587732-1587754 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925146883 2:1587941-1587963 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925336908 2:3105429-3105451 CAGAAGGGCAGAAGGCCTGAAGG + Intergenic
925900023 2:8502616-8502638 CAGAGGGGCTTGAGGACTGGAGG - Intergenic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
926132912 2:10316367-10316389 CACAGGGGCTAGAGACCAGCAGG - Intronic
926897002 2:17703035-17703057 TAAAGGGGCTTGAGGCCAAAAGG + Intronic
927554395 2:24022089-24022111 CAGAGGGGCTGGTGCCGGGAGGG + Intronic
928361125 2:30663100-30663122 GAGAGGGGCTGGAGGCTTCAGGG + Intergenic
929346555 2:40890790-40890812 CAGAATGCCTGGAAGCCAGAGGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929862152 2:45688205-45688227 CTGAGCAGTTGGAGGCCAGAAGG + Intronic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
931157591 2:59653079-59653101 GAGAGGAGTTGGAGGTCAGAAGG - Intergenic
931244375 2:60480153-60480175 TGGAGGAGCTGGAGGCCAGGGGG + Intronic
931533725 2:63248280-63248302 CAGAAGCTTTGGAGGCCAGAAGG - Intronic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932247564 2:70208206-70208228 CAGAGGGAATGGTGGCCAGTTGG + Intronic
932586023 2:73029568-73029590 CCCAGGGGCTGGTGGCAAGATGG + Intronic
933093231 2:78146500-78146522 CGGAGGGGCCTGAGGCCACAGGG - Intergenic
933752098 2:85609487-85609509 CAGAAGAGCTGATGGCCAGAAGG + Exonic
934128182 2:88919806-88919828 CAGAGGGGCAGAGGGGCAGAGGG - Intergenic
934660872 2:96143058-96143080 CAGAGGGGCCAGCGGCCGGAAGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
934997205 2:98975179-98975201 CAGAAGTAATGGAGGCCAGAAGG + Intergenic
935601173 2:104922954-104922976 CAGAAATTCTGGAGGCCAGAAGG + Intergenic
935695073 2:105764212-105764234 CACAGGTGCTGAAGGCCAGCAGG - Intronic
935958817 2:108403779-108403801 ATCAGGGGCTGGAGGCCAGATGG - Intergenic
936716232 2:115190600-115190622 ATCAGGGGCTGGAGGCCAGATGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936918215 2:117661578-117661600 CAGAGGGCCTGGGGACCCGAGGG + Intergenic
937589967 2:123601021-123601043 CATAGTGGCTGAAAGCCAGACGG - Intergenic
937955997 2:127422154-127422176 AAGAGAGGGTGCAGGCCAGAGGG - Intronic
937985562 2:127636645-127636667 CGGAGGGGCTGGGGGCCACCAGG + Intronic
938036856 2:128041837-128041859 ATCAGGGACTGGAGGCCAGATGG - Intergenic
938052806 2:128190646-128190668 CTGACGGGCTGGATGCGAGAGGG - Exonic
938166145 2:129028672-129028694 CAGAGGGGCTGGCAGTGAGAGGG + Intergenic
938249137 2:129800019-129800041 CAGAGGGGCCGGAGTTCACAAGG - Intergenic
938310286 2:130285012-130285034 CTGAGGGGCAGGAAGGCAGAGGG - Intergenic
938344399 2:130556942-130556964 CAGAGGGGCAGGTGGCCAGCAGG - Intergenic
938345434 2:130563780-130563802 CAGAGGGGCAGGTGGCCAGCAGG + Intergenic
938844020 2:135189742-135189764 CAGAAGTCTTGGAGGCCAGAAGG + Intronic
939266164 2:139876254-139876276 CAAAGTGGCTGTAGGCCACAAGG - Intergenic
939602250 2:144207439-144207461 TAGAGGTACTGGAGGCAAGATGG + Intronic
939853430 2:147327636-147327658 GACAGGGGCTGGAAGCCTGAGGG + Intergenic
939998910 2:148947806-148947828 CAGTGATGATGGAGGCCAGAGGG - Intronic
940573729 2:155472626-155472648 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941670060 2:168283557-168283579 AGGAAGGGCTGGAGGCAAGAGGG - Intergenic
942650642 2:178163704-178163726 TAGAGGGCCAGGAGGCCAGAAGG + Intergenic
942759898 2:179385753-179385775 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
943247350 2:185473078-185473100 CAGAGGGGCCTGAGGCAACAGGG - Intergenic
943309929 2:186312989-186313011 CAGAGGGGGCGGAGCCAAGATGG + Intergenic
944431064 2:199634058-199634080 AACAGGGGCTGGAGGCAATAGGG - Intergenic
944598880 2:201283878-201283900 CAGACGGGGTGGTTGCCAGACGG + Intronic
945483318 2:210366915-210366937 ATCAGGGGCTGGAGGCCAGATGG + Intergenic
945959044 2:216113212-216113234 CAGAGGGGCTGGACACTATAAGG - Intronic
945970446 2:216226757-216226779 CAGACGGGGTGGTTGCCAGACGG + Intergenic
946883583 2:224200786-224200808 TAAAGGGGCTGGGGGCCAGCTGG + Intergenic
947232650 2:227903519-227903541 CAGAGGGGCAAGTGACCAGAGGG + Intronic
947670198 2:231930868-231930890 CAGTGGGGTTGGAGGCCATCTGG - Intergenic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948461721 2:238132895-238132917 CAGGGGGCCTGGATGCCAGGAGG - Exonic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948647824 2:239419257-239419279 CAGAGATGCTGGAGGGGAGATGG + Intergenic
948701917 2:239765925-239765947 CAGAGAGGCTGGAGGCTGGCGGG + Intronic
948892769 2:240915374-240915396 CCCAGGGGCTGGTGGCCAGTTGG + Intergenic
1168939852 20:1699980-1700002 CAGAAGCACTGGAAGCCAGAAGG + Intergenic
1170127187 20:12976807-12976829 GAGAGGGGCTGGCAGACAGAGGG + Intergenic
1171157597 20:22890653-22890675 CAGAGTGGCTGAGGTCCAGATGG - Intergenic
1171393205 20:24814736-24814758 CCGAGGAGCTGGAGTCCAGCAGG - Intergenic
1172012926 20:31856901-31856923 CAGAGATTCTGGAAGCCAGATGG + Intronic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1173583450 20:44163823-44163845 CAGAGGGGCTGGAAGCACTAGGG - Intronic
1174056150 20:47799988-47800010 GAGAGGGGCTGGAACCCAGAGGG - Intergenic
1174553280 20:51376492-51376514 TAGAGGGGCAGGAGGCATGAGGG + Intergenic
1174744286 20:53046133-53046155 CAAGGGGGCTGCAGGCAAGAGGG + Intronic
1174872447 20:54195691-54195713 GACAGGTGCTGGAGACCAGAGGG + Intergenic
1174883049 20:54302112-54302134 CAGAGGGCCTGGAGTACTGATGG + Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175451783 20:59075753-59075775 CAGAGAGACAGGAGGCCAGGTGG + Intergenic
1175480882 20:59309906-59309928 CAGAGGGACTTGAGGCTGGAAGG + Intronic
1175523521 20:59618230-59618252 CAGGGGAGCTGGGAGCCAGACGG + Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176349936 21:5785136-5785158 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176356750 21:5905720-5905742 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176544257 21:8183206-8183228 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176563208 21:8366251-8366273 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1177206569 21:18017429-18017451 CAGAGTGGCTGGAAGGCAAAGGG - Intronic
1178470108 21:32884871-32884893 CAGAGGGACTCGAGATCAGAGGG + Intergenic
1178624349 21:34202790-34202812 AGGAGGGGATGGAGGCGAGATGG + Intergenic
1179409824 21:41153984-41154006 CAATGAGGCTGGAGGCCTGAGGG + Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179541957 21:42088760-42088782 CGAGGGGGCAGGAGGCCAGAGGG - Intronic
1179982617 21:44904190-44904212 CAGGGGGGCTGAAGGCTGGAGGG - Intronic
1180037900 21:45259346-45259368 AAACGGGGCTGGAGTCCAGAGGG - Intergenic
1180928579 22:19573505-19573527 CAGAAGGGCAGAAGGGCAGAAGG + Intergenic
1181013686 22:20056477-20056499 CAGAGGGGCTCGAGGCCCTGAGG - Intronic
1181666715 22:24403603-24403625 CGGAGGGGCTGGAGGGCCAAGGG - Intronic
1181796992 22:25318456-25318478 CCTAAGGCCTGGAGGCCAGAGGG - Intergenic
1181854480 22:25772280-25772302 CAGGGGGCCAGAAGGCCAGAAGG + Intronic
1181947149 22:26527288-26527310 CATAGAGGCTGGGGGACAGAAGG + Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182087868 22:27573829-27573851 GAGAGGGGCTGGGGGCCTGATGG + Intergenic
1182351346 22:29701780-29701802 TGGAGGGGATGGAGGCCACAGGG - Intergenic
1182555958 22:31128392-31128414 AAGAGGGGCAGGAGGCAAGGTGG + Intronic
1183371083 22:37432910-37432932 CACAGGGGGTGGAGCCCAGGAGG + Intergenic
1183372858 22:37444796-37444818 CACAGGGCCTGGAGGCATGAAGG + Intergenic
1183379705 22:37484773-37484795 CTGAGGTGCTGGGGGCCAGCTGG + Intronic
1183443104 22:37834606-37834628 CAGGGCGGCTTGAGCCCAGAAGG + Intronic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1183871728 22:40745597-40745619 CAGACGGGGTGGTTGCCAGACGG + Intergenic
1184110704 22:42392476-42392498 GAGAGGGGCTGAAGGTGAGAGGG + Intronic
1184549699 22:45197941-45197963 CAGATCGGCTGGAGGAAAGAAGG + Exonic
1184675011 22:46036783-46036805 CAGAGGCCCTGGAGGGCAAAGGG + Intergenic
1185143701 22:49117806-49117828 CAGAGGGGCTGGCGACCTGCTGG - Intergenic
1185171424 22:49296771-49296793 CAGAGGGCCTGGGGACCAGCAGG + Intergenic
1185228209 22:49665178-49665200 CAGCGGGGCTGGGGGTCAGCAGG - Intergenic
1203249126 22_KI270733v1_random:99444-99466 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1203270551 22_KI270734v1_random:49287-49309 GAGAGGGGCTGGTAGCAAGAAGG + Intergenic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
950254351 3:11492472-11492494 TGGAGGGGCTGGAGCCAAGATGG - Intronic
950359621 3:12441144-12441166 CAGATGGGCTGGAGCCAGGAAGG + Intergenic
950479520 3:13235878-13235900 CAGCGGGGCTGGTGGCTACAGGG - Intergenic
950681533 3:14588534-14588556 CAGTGAGGCTGGACCCCAGAAGG - Intergenic
950933135 3:16811213-16811235 CAGAGGGTCAGGAAGCCAGGAGG + Intronic
951356477 3:21672967-21672989 CAAAGGGGCTGCAGTACAGAGGG - Intronic
951710676 3:25582666-25582688 GAGAGGTGCTGGAGGCAGGAAGG - Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952332354 3:32375745-32375767 TAAAATGGCTGGAGGCCAGATGG - Intergenic
953447622 3:42981018-42981040 CAGAGTGCCTGGAGGAGAGATGG + Intronic
953448582 3:42988137-42988159 CAGCTGGGCTGGAGGCCAGAAGG - Intronic
953793904 3:45968269-45968291 CACAGGAGCTTGAGGCCACACGG - Exonic
954382344 3:50226408-50226430 CAGAAGGGCGGGAGGCGGGAGGG + Intronic
954675991 3:52315693-52315715 AAGAGGGGCAGGAGTCCAGTGGG + Intergenic
954976415 3:54699301-54699323 GGAAGGGGCTGGAGGTCAGAGGG + Intronic
955947653 3:64210528-64210550 CAGAGCCGCTGGAGCCCAGCCGG - Intronic
956454911 3:69410961-69410983 AAGAGGGGCTGTAAGCCATAAGG + Intronic
957011425 3:75010033-75010055 CAGATGGGCTAGAGTACAGAAGG - Intergenic
957661796 3:83165642-83165664 CGGAAAGCCTGGAGGCCAGAAGG - Intergenic
957867030 3:86039078-86039100 CAGAGGGGGTGGAGCCAAGATGG + Intronic
957923020 3:86771980-86772002 CAGAGGGGCTCGAGGCAGCAGGG - Intergenic
958833251 3:99114963-99114985 CAGAGGGGCTGGAGCTAAGATGG + Intergenic
959674683 3:109021040-109021062 CAGGTGGGCTGGTGCCCAGAGGG + Intronic
959701932 3:109307056-109307078 GAGAGTGGCTTGAGCCCAGAAGG - Intronic
959851886 3:111097225-111097247 CAAAGGGGCTGAAGTCCAGTGGG - Intronic
960013245 3:112856381-112856403 CATAAGGGCTGGAAGCCAGATGG - Intergenic
960373878 3:116874640-116874662 ATGAGGGGCTGGAGGGCAGGAGG + Intronic
960624994 3:119673967-119673989 CAGATGGGGTGGTGGCCAGGCGG - Intronic
961509433 3:127391958-127391980 AGGAGGAGCTGGAGGGCAGAGGG + Intergenic
961634441 3:128323998-128324020 CAGAGCAGATGGAGGCCAGTGGG - Intronic
961641298 3:128366251-128366273 CATATGGGCTGGTGACCAGAAGG + Intronic
962573009 3:136730078-136730100 CAGAGGGCCTGGGTGACAGAGGG - Intronic
963007992 3:140744116-140744138 CAGAGTGGGTGGAATCCAGAGGG + Intergenic
963102729 3:141622088-141622110 CCGAGGCCCTGGTGGCCAGAAGG + Intergenic
965080498 3:164025439-164025461 CCGAGGGTCTGGAGGCCGGGAGG + Intergenic
965628795 3:170709333-170709355 TAGAGGGGAAGGAGCCCAGATGG - Intronic
966853870 3:184180891-184180913 CAGATTGGCTGGCGGCGAGAGGG + Exonic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
968078449 3:195830020-195830042 CAGAGGAGCTGGAGGGCGGGCGG - Intergenic
968573832 4:1355787-1355809 GCGAGGGGCTGGAGGCTGGAGGG + Intronic
968600479 4:1506339-1506361 CAGAGGGGTGGGACTCCAGAGGG + Intergenic
968611850 4:1560818-1560840 GCCACGGGCTGGAGGCCAGAGGG + Intergenic
968770304 4:2501413-2501435 CAGGGAGGCTGGAGCCCAGGAGG + Intronic
968964233 4:3761454-3761476 CTGAGGCCCTGGAAGCCAGAAGG + Intergenic
969484193 4:7462728-7462750 CACAGGGGCTGGGGCCCAGCTGG - Intronic
969564539 4:7970328-7970350 CAAAGGTGCTGGTGGGCAGAGGG + Intronic
969569185 4:7998599-7998621 CAGATGGGCAGGTGGCCAGCAGG - Intronic
969622088 4:8283781-8283803 CAGGGAGGCTGGAGGCCTCAGGG - Intronic
970439515 4:16068028-16068050 CAGGGGTGCAGGAAGCCAGAGGG + Intronic
971355349 4:25890282-25890304 CCGAGGGGCTGCAGGCCTGCAGG + Intronic
972252326 4:37316313-37316335 CAGAAGGAGTGGAAGCCAGAAGG - Intronic
972938434 4:44167946-44167968 CAGAGGGGGTGGCTGCCAGGCGG - Intergenic
973573189 4:52261139-52261161 CAGAGTGCAGGGAGGCCAGACGG - Intergenic
973607212 4:52599837-52599859 CAGATGGGCTGGAGCTCAGAGGG - Intronic
973730282 4:53816354-53816376 CACAGGGGATTGAGGCAAGAGGG - Intronic
974425939 4:61743718-61743740 GACAGGGGCTGGAGCCAAGATGG + Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975793880 4:77984805-77984827 CAGAGGGGCAGAGGGGCAGAGGG + Intergenic
975793883 4:77984813-77984835 CAGAGGGGCAGAGGGGCAGAGGG + Intergenic
976511281 4:85911946-85911968 CAAAAGGAGTGGAGGCCAGAAGG - Intronic
977029573 4:91864441-91864463 CATAGGGGGTGGAGCCAAGATGG - Intergenic
977411734 4:96674813-96674835 AAGAGGGGCTGGAGACAGGAGGG - Intergenic
977429761 4:96916596-96916618 CAGACGGGGTGGAGGGCGGATGG + Intergenic
979188663 4:117831756-117831778 CAGATGGATGGGAGGCCAGAAGG + Intergenic
980711230 4:136571132-136571154 AGGAGAGACTGGAGGCCAGATGG - Intergenic
980969534 4:139556040-139556062 CAGAGGGCCTGGAGCGCGGAAGG - Intronic
981056415 4:140366809-140366831 CAGAGGGGATGTAGCCCACACGG + Intronic
981280938 4:142957799-142957821 CAGAGGAGATGGAGGGCGGATGG - Intergenic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
982198423 4:152937411-152937433 CAGAGGGGCTGGCGCCCTGGGGG + Intronic
982374541 4:154674994-154675016 GAGAGGGGAGGCAGGCCAGATGG - Intronic
982565916 4:156986521-156986543 CAGAGCTGCTTGAGGTCAGACGG - Intergenic
982579128 4:157155615-157155637 CAGAAGCCATGGAGGCCAGAAGG - Intronic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
983566728 4:169160992-169161014 CAGAAGGCTTGGAGGGCAGAGGG - Intronic
984467417 4:180118640-180118662 CAGAATGGTTGGAGGCCACAGGG + Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985055545 4:186032756-186032778 CAGCTGGGCTGGATGCCACAGGG + Intergenic
985927981 5:3032754-3032776 CAGAGAGAGTGGAGGCCACACGG - Intergenic
986287715 5:6372328-6372350 CCGAGGGGCTGGAGGAGAGGCGG - Exonic
986599410 5:9456626-9456648 CAAAGGGGCTGGAGGAGAAAAGG + Intronic
987072620 5:14352202-14352224 CAGGGGATCTGCAGGCCAGAGGG - Intronic
987075661 5:14379830-14379852 CAGAACGGCTGGAAGGCAGATGG - Intronic
988944186 5:36178671-36178693 CAAAGAAGCAGGAGGCCAGATGG - Intronic
989098045 5:37799006-37799028 CAGAGAAGATGGAGGGCAGAGGG + Intergenic
989695348 5:44193901-44193923 CAGAAGCGATGGAGGCCAGAAGG - Intergenic
989809652 5:45658437-45658459 CAGAGGGGGAGGAGCCAAGATGG + Intronic
990023605 5:51159475-51159497 CAGAGACGCTGGGGACCAGAGGG - Intergenic
990367036 5:55081484-55081506 CAGCGGGGGTGGAGCCAAGATGG - Intergenic
990510669 5:56486631-56486653 CAGAGGTGGTAGAAGCCAGAAGG + Intergenic
991304633 5:65164014-65164036 CAGAGGGGGAGGAGCCAAGATGG + Intronic
991587567 5:68215861-68215883 CAGCCGGGCTGGAGGCCGGTCGG + Exonic
991683649 5:69162366-69162388 CAGTGGGGTTGGAGGGCTGAAGG + Intergenic
995840894 5:116442256-116442278 GAGAGGGACTGCAGGCCAGCTGG - Intergenic
996682505 5:126243114-126243136 CAGAGATAGTGGAGGCCAGAAGG - Intergenic
997235685 5:132270861-132270883 AGGAATGGCTGGAGGCCAGAGGG + Intronic
997259743 5:132456775-132456797 CTGAGGGTCTACAGGCCAGAGGG - Intronic
997352504 5:133240981-133241003 TAGAGGGGCTGGGGACGAGAGGG + Intronic
998358786 5:141566126-141566148 TAGCGGGGCTGGAGGCCTGTTGG + Intronic
998546239 5:143030265-143030287 AAGAGGGGCCTGAGGCCTGAGGG - Intronic
998582092 5:143387166-143387188 TAGAAAGGCTGGAAGCCAGAAGG - Intronic
998664876 5:144285454-144285476 AAGAGGGGCTGTATGACAGAAGG - Intronic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999349446 5:150854642-150854664 CAGAAAGGTTGCAGGCCAGAAGG - Intronic
999383902 5:151140885-151140907 GAGCGGGGCTGGAGAGCAGAGGG - Intronic
1000971467 5:167719431-167719453 CAGAGATCCTGGAGACCAGAAGG + Intronic
1002107752 5:176888558-176888580 TAGAGGGGCTGGAGGGGAAAGGG + Exonic
1002210626 5:177596820-177596842 CAAAGGGCCCAGAGGCCAGAGGG - Intergenic
1002587151 5:180256403-180256425 CAGGGGGGCAGGGGGCAAGAGGG + Intronic
1003157028 6:3605415-3605437 CAGAGAGGCTGCAGGCCTGTTGG + Intergenic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1003685530 6:8298374-8298396 CAGAGGGTGTCGAGGCCAGCTGG - Intergenic
1004009130 6:11664739-11664761 TAGAGGTGGTGGAGGACAGAAGG + Intergenic
1004325203 6:14668459-14668481 CAGAGGGACCAGAGGCCTGAGGG - Intergenic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1004399013 6:15271235-15271257 CAGGAGGGCTTGAGGCCAGTGGG + Intronic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1004822541 6:19383241-19383263 CAGAGGGGCAGGGGGGCAGGAGG - Intergenic
1005101933 6:22180856-22180878 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
1005837200 6:29718691-29718713 CAGACGGGGTGGTTGCCAGACGG - Intergenic
1006335937 6:33420478-33420500 AGGAGGGATTGGAGGCCAGAGGG + Intronic
1006719724 6:36142468-36142490 CAGAGGGCCTGCAGCCCAGGGGG - Intronic
1006897258 6:37479113-37479135 AAGAGGGGATGAAGCCCAGAAGG - Intronic
1006945106 6:37779550-37779572 CAGAAGGGCTGGTGACCTGAGGG + Intergenic
1006946192 6:37785858-37785880 CAGCGAGGCTGGGCGCCAGATGG - Intergenic
1007185608 6:39969194-39969216 GAGAAGCTCTGGAGGCCAGAAGG + Intergenic
1007385075 6:41514961-41514983 CAGAGGGGCTGGAAGGCTGGGGG + Intergenic
1007577171 6:42932670-42932692 AAGAGGGGAGGGAGCCCAGATGG + Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008624074 6:53300721-53300743 CAGACGGAGTGGAGGACAGAAGG - Intronic
1008874202 6:56307853-56307875 AAGAGGGGGTGGAGCCAAGATGG - Intronic
1008926621 6:56895219-56895241 CAGACGGGGTGGTTGCCAGACGG + Intronic
1009054223 6:58316167-58316189 CAGAGGGGTGGGTGGCAAGATGG + Intergenic
1009905723 6:69867694-69867716 CAGAGGAGCTGGGGGACAGGCGG + Intronic
1010482860 6:76375574-76375596 AAGATGGGCTGGAGCCAAGATGG - Intergenic
1013623074 6:111909222-111909244 CAGAGGTGCAGGAGGGCAGAAGG - Intergenic
1014257959 6:119183131-119183153 CATCAGGGCTGGAGGACAGAAGG + Intronic
1014764245 6:125389329-125389351 CAGACGGGGTGGTTGCCAGACGG + Intergenic
1014817775 6:125953835-125953857 CAGAGGGGCTGCTGGCCACAGGG + Intergenic
1014857530 6:126420237-126420259 CAGAGTGGCTGGATGTGAGATGG + Intergenic
1015434670 6:133172379-133172401 CAGAGGGGGCTGAGGCCACAGGG - Intergenic
1015697304 6:135995149-135995171 CAGAGGGCCTGGAGGCCTGTAGG - Intronic
1017638429 6:156466332-156466354 CAGAGGGGATGGAAGCCATGGGG - Intergenic
1018100825 6:160438170-160438192 TAGATGGGGTGCAGGCCAGAAGG + Intronic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019286016 7:223514-223536 CAGAGGGGCAGGCGGGCACATGG + Intronic
1019328910 7:453113-453135 AAGAGGGGCTGGGGCCCAGGTGG + Intergenic
1019398360 7:835858-835880 CAGGGGGGCTGGAGACATGAGGG + Intronic
1019476698 7:1247773-1247795 CAGAGGGGCGGGAAGGCGGAAGG + Intergenic
1019588260 7:1816213-1816235 CCGAGGGGCTGGTGGCCTGCGGG + Exonic
1019735863 7:2649489-2649511 CTGCTGGGCTGCAGGCCAGAAGG - Intronic
1022506036 7:30909091-30909113 CATTGGGGCAGGAGGCCAGGGGG - Intergenic
1023529812 7:41140590-41140612 CAGGGGTGCTCAAGGCCAGAAGG + Intergenic
1023863290 7:44227632-44227654 AGGAGGGTCTGGAGGACAGAGGG + Intronic
1023864303 7:44231677-44231699 CAGAGGGGCAGGTGCCCTGAGGG - Intronic
1023965535 7:44961619-44961641 CTGAGGGGCTGAGGGCCTGAGGG + Intergenic
1024049428 7:45609440-45609462 CGGAGGGGCTTGGAGCCAGAGGG + Intronic
1024447126 7:49493810-49493832 AAGAGGATCTGGAGGCCAGAAGG + Intergenic
1024568753 7:50706900-50706922 CAGAGGGTTGGGAGGCCAGCGGG - Intronic
1025211608 7:57022338-57022360 CACTGGGGCTGGGGGCCACATGG - Intergenic
1025236848 7:57240166-57240188 GAGAGGGGCTGGAACCCAGAGGG + Intergenic
1025660348 7:63554489-63554511 CACTGGGGCTGGGGGCCACATGG + Intergenic
1026851429 7:73725984-73726006 CAGAGGTTCTGGAGGACAGGTGG - Intergenic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027646674 7:80809942-80809964 ATCAGGGGCTGGAGGACAGAGGG + Intronic
1029012213 7:97273853-97273875 CACAAGGGCTGGAGGCCAGATGG - Intergenic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029654012 7:101912577-101912599 CAGAGGGGCCGGTGGGGAGAGGG - Intronic
1029674825 7:102061338-102061360 CACTGGGGCTGGGGGCCACATGG - Intronic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030333934 7:108303379-108303401 CAGAGGGGCTGAAGAGGAGACGG - Intronic
1032061508 7:128729137-128729159 AAGAGGGCCTGGAGGCCACCTGG - Intronic
1032061630 7:128729994-128730016 GAGAGGGGCTGCAGGCCGGAGGG - Exonic
1032077808 7:128844328-128844350 CATAGGGGGCAGAGGCCAGAGGG + Intronic
1032196752 7:129793899-129793921 CAAAAGGGCTGCAGGCCAGAGGG - Intergenic
1033172313 7:139095026-139095048 CAGAGGGGATGAAGGAGAGAAGG - Intronic
1033587876 7:142787716-142787738 AAAAGGGGCTGGAATCCAGACGG + Intergenic
1034278746 7:149837308-149837330 CAGAGGGGCAGAAGGGCAAAGGG + Intergenic
1034455366 7:151167328-151167350 GCGAGGGGCGGGAGGCCAGCGGG + Exonic
1034688891 7:152998271-152998293 AGGAGGGGCTGGAAGTCAGATGG + Intergenic
1034891758 7:154845903-154845925 CAGAGGCCCTGCAGGCCACATGG - Intronic
1034891775 7:154845995-154846017 CAGAGGCCCTGCAGGCCACATGG - Intronic
1035022802 7:155809080-155809102 CTAAGGGGCAGGAGGCCAGAGGG - Intronic
1035211540 7:157332319-157332341 CACAGAGGCTGCAGGGCAGAGGG - Intergenic
1035446454 7:158946554-158946576 CAGAGAGGCTGAAGGCCCCAGGG - Intronic
1035481986 7:159194299-159194321 CAGAAGGCCAGGAGCCCAGAAGG + Intergenic
1035524329 8:300540-300562 GAGAGGGGCTTGAGGCAGGAAGG + Intergenic
1035560765 8:602066-602088 CACAGGTGCTGGAGGCCTGGAGG + Intergenic
1035635420 8:1140316-1140338 CAGATGGAAGGGAGGCCAGAGGG - Intergenic
1035643394 8:1200477-1200499 CCGAGGAGCACGAGGCCAGATGG - Intergenic
1037235817 8:16718260-16718282 CAGAATGGCTTGAGGCCAGGAGG - Intergenic
1037605454 8:20434222-20434244 CAGAGGGGCGGGGGGAGAGAAGG - Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1038375102 8:27032454-27032476 CAGATTAGCTGGAGGCCACATGG + Intergenic
1038737543 8:30185914-30185936 CAGAGAGGATGGAAGCCACAAGG + Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039613437 8:38936952-38936974 CTCAGGGGCTGGAGGCCTGGGGG + Intronic
1039752710 8:40492893-40492915 AAGAGGGGTTGTAGGGCAGATGG + Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040539539 8:48339995-48340017 ATGAGGGGGTGGAGGCTAGATGG - Intergenic
1040785472 8:51159163-51159185 CAGAGTGGCTGCCGGGCAGAGGG - Intergenic
1040945529 8:52881158-52881180 CAAAGGCACTGGAGGCCAGCTGG - Intergenic
1041100974 8:54396254-54396276 GAGAGGGGCTGGGGGCCTGGAGG + Intergenic
1041153503 8:54960523-54960545 CAGGGGTGCCTGAGGCCAGAGGG - Intergenic
1041986970 8:63933380-63933402 CACAGGGGCTGGAGGGGGGAAGG - Intergenic
1042532737 8:69832421-69832443 CAGAGGGACTGGGGGCCAACGGG + Exonic
1044418190 8:91960316-91960338 CAGCGGGGCTGGGAGCCCGATGG - Exonic
1044991337 8:97798841-97798863 GAGAAGGGTTAGAGGCCAGATGG + Intronic
1045939199 8:107718074-107718096 CAGAGGGAGTGGAGCCAAGATGG - Intergenic
1046400106 8:113694088-113694110 CAGAGGTCATGGAAGCCAGAAGG - Intergenic
1046454538 8:114440901-114440923 GGGAGGGGCTGGTGGGCAGAAGG - Intergenic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047536675 8:125726469-125726491 GAGAGTGGCTGGAGGTGAGATGG + Intergenic
1048333438 8:133486395-133486417 CAGAGCGGGTGGAGCCCAGCTGG - Intronic
1048934195 8:139341804-139341826 CAGGTGGGCTGGAGGCTAGAGGG - Intergenic
1049183691 8:141237452-141237474 AAGATGGGCTGGAAGCCAGGAGG - Intronic
1049414637 8:142489668-142489690 CAGAGTGGTTGGAGCCCAGGTGG - Intronic
1049472816 8:142783880-142783902 CTGAGGGGCTGGGGGCGAGTGGG - Intergenic
1049495189 8:142926916-142926938 GAGAGGGACTGGAGCACAGAAGG - Intergenic
1049693306 8:143972173-143972195 CAGGAGGGCTGGAGCCCAGGTGG + Intronic
1049713312 8:144077348-144077370 CAGAGTGGCTGTAGAGCAGAGGG + Intergenic
1050154234 9:2649065-2649087 AAGAGGGGCTGAAGGCCAAGGGG - Intronic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1050726914 9:8660567-8660589 CTGAGGGGCTGGGAGCCAGCTGG - Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1053807842 9:41821592-41821614 CAGGGAGGCAGGAGGTCAGAGGG - Intergenic
1054622750 9:67365836-67365858 CAGGGAGGCAGGAGGTCAGAGGG + Intergenic
1055315302 9:75028376-75028398 CAGCGCGGATGGAGGCCTGAGGG - Exonic
1055479705 9:76697404-76697426 TCGAGTGGTTGGAGGCCAGAGGG - Intronic
1056697310 9:88870861-88870883 CACAGCAGCTGGAAGCCAGAGGG + Intergenic
1056943047 9:90971592-90971614 CAGAGAGGCTGACGGCCAGCAGG + Intergenic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1058478614 9:105367757-105367779 CAGAGGGGCTGGGGTGAAGAGGG - Intronic
1058843608 9:108934254-108934276 CAGATGGGCAAGAGGGCAGAGGG - Exonic
1060283000 9:122226581-122226603 CAGAGGCGCTGAAGCTCAGAAGG + Intronic
1060484359 9:124037719-124037741 CAGAGAGGCTGGGAGCCAGAGGG - Intergenic
1060555654 9:124506059-124506081 CAGGCGGGCGGGAGCCCAGATGG - Intronic
1060874803 9:127075044-127075066 CTGAGGGGCAAGAGGCCTGAAGG - Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061167878 9:128934849-128934871 CAGAGGGGCCCAAGACCAGAGGG - Intronic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061758831 9:132835615-132835637 CAGAGGAGAATGAGGCCAGAGGG - Intronic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061990811 9:134157649-134157671 GACAGGGGCAGGAGGCCACAGGG - Intronic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062082900 9:134633886-134633908 CTGAGGGGCTGGAGACAGGAGGG - Intergenic
1062231537 9:135484718-135484740 CAGAGGGGCCACAGGGCAGAGGG + Exonic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1062359488 9:136180811-136180833 CAGAGGTACGGGAGCCCAGAGGG + Intergenic
1203465525 Un_GL000220v1:82706-82728 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1185492838 X:532023-532045 CAGTGGGGTGGGGGGCCAGAGGG - Intergenic
1185666291 X:1767924-1767946 CAGAGTGACTGCAGCCCAGAGGG + Intergenic
1186515642 X:10164562-10164584 AGGCGAGGCTGGAGGCCAGATGG + Intronic
1186625399 X:11287881-11287903 AAGAGGAGCTGAAGGCCAAAAGG - Intronic
1187305233 X:18089392-18089414 CAGAGGAGCTGGAGGAATGAGGG - Intergenic
1187393967 X:18904150-18904172 CAGAGAGGCAGGAGCCCATAAGG + Intronic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1187701470 X:21967983-21968005 CGGAGGGGCTGGGGTCCAGATGG + Intronic
1189179107 X:38986767-38986789 CAGAGGGGCTGCAGGGAGGAGGG - Intergenic
1190032661 X:46989530-46989552 CAGAGACCATGGAGGCCAGAAGG - Intronic
1190288141 X:48974052-48974074 TAAAGGGGCTAGAGGCCTGATGG - Exonic
1190321824 X:49184317-49184339 GAGGGGTGCTGGAGGCCAGAGGG + Intronic
1190342480 X:49308582-49308604 CAGAGTGGCTGGGGGGCAGCAGG + Intronic
1190921798 X:54860083-54860105 CACAGGGGGTGGAGCCAAGATGG - Intergenic
1191068991 X:56380309-56380331 CAGACGGGGTGGCTGCCAGACGG + Intergenic
1191157880 X:57295467-57295489 TAGAGGGGGTGGAGCCAAGATGG + Intronic
1192106988 X:68326657-68326679 CAGACGGGGTGGTTGCCAGACGG - Intronic
1192225433 X:69224100-69224122 TAGAGGGGCTGAAGACCAGCAGG - Intergenic
1192567698 X:72178739-72178761 CAGACGGGGTGGCTGCCAGACGG - Intergenic
1192660583 X:73037818-73037840 CCGGGGGGCTGGAGCCAAGATGG - Intergenic
1193511043 X:82400164-82400186 CAGATGGACTGGAAGCCAGAAGG + Intergenic
1194243526 X:91480675-91480697 CAGACTGTCTGGAGCCCAGATGG - Intergenic
1195399467 X:104446264-104446286 CAAAGGGGCTGAAGGAAAGAGGG + Intergenic
1195766123 X:108298440-108298462 GAGAGGGCCCGGAGGCCAGGCGG - Intronic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200120184 X:153786469-153786491 GAGAGTGGGTGGAGGGCAGAAGG + Intronic
1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG + Intronic
1200562507 Y:4722050-4722072 CAGACTGTCTGGAGCCCAGATGG - Intergenic
1201142638 Y:11041413-11041435 GATGGGGGCTGGTGGCCAGAAGG + Intergenic
1202095097 Y:21241598-21241620 CAGATGCAATGGAGGCCAGAGGG + Intergenic
1202147727 Y:21817448-21817470 CATAGGGACTGGAGCCAAGAGGG - Intergenic