ID: 902878668

View in Genome Browser
Species Human (GRCh38)
Location 1:19356413-19356435
Sequence TGCTGGCCTCCTGCTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 1, 2: 6, 3: 40, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902878668_902878673 -4 Left 902878668 1:19356413-19356435 CCTCCCTCAGCAGGAGGCCAGCA 0: 1
1: 1
2: 6
3: 40
4: 311
Right 902878673 1:19356432-19356454 AGCAGAGTGCCAGCAGCTGTGGG 0: 1
1: 1
2: 0
3: 26
4: 319
902878668_902878672 -5 Left 902878668 1:19356413-19356435 CCTCCCTCAGCAGGAGGCCAGCA 0: 1
1: 1
2: 6
3: 40
4: 311
Right 902878672 1:19356431-19356453 CAGCAGAGTGCCAGCAGCTGTGG 0: 1
1: 1
2: 6
3: 40
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902878668 Original CRISPR TGCTGGCCTCCTGCTGAGGG AGG (reversed) Intronic
900159967 1:1218850-1218872 TGCAGACCTGCTGCTGACGGAGG - Exonic
900227917 1:1541287-1541309 CGCTGACTTCCTGCTGAGGCCGG - Intergenic
900306750 1:2013691-2013713 TGCTGGGTTGCTGCTGAGGTGGG - Intergenic
900417848 1:2543260-2543282 TGCTGGTCCCGTGGTGAGGGAGG + Intergenic
900605713 1:3522719-3522741 TCCTGGCCTCCTACTGTGAGTGG - Intronic
900770913 1:4543366-4543388 TGGTGGCCTGCTGCTTAGAGGGG + Intergenic
901181001 1:7341845-7341867 AGCTGGCCTCCTGGGGAGGAGGG + Intronic
901194550 1:7433120-7433142 TGCCTGCCTCCTGCTCATGGAGG + Intronic
901200268 1:7462989-7463011 AGCTGGACTCCAGCTGAGCGGGG + Intronic
902579899 1:17401779-17401801 TGCTGGCCTGCTTGTGTGGGGGG + Intergenic
902878668 1:19356413-19356435 TGCTGGCCTCCTGCTGAGGGAGG - Intronic
902987017 1:20161079-20161101 TGCTGGCCGACTGCTGTGTGAGG + Intergenic
903238837 1:21968905-21968927 TGCTGGCTTCCTCCTCAGGATGG - Intergenic
903242758 1:21994569-21994591 TGCTGGCTTCCTCCTCAGGATGG - Intronic
903371218 1:22837361-22837383 TGCTGGCCAGCTGCTGTGCGGGG + Intronic
903404583 1:23085696-23085718 AGCTTGCCTACAGCTGAGGGTGG + Exonic
904045319 1:27604880-27604902 TGCTGACCTCCTGCCGCGGCCGG + Intergenic
904333621 1:29783551-29783573 TGCCGGCTTCCTGGAGAGGGGGG + Intergenic
905065559 1:35178462-35178484 TGGAGGACTCCTGCTGAAGGTGG - Intronic
906172769 1:43741636-43741658 TTCTGGCCTCTGGCTTAGGGAGG + Intronic
906923101 1:50085838-50085860 TGCAAGCCTCCTTCTTAGGGAGG + Intronic
907706452 1:56836665-56836687 TGAAGGCCTCCAGCTGAGTGCGG + Intergenic
911195241 1:94987953-94987975 TGATAGCCTCTTGCTGATGGAGG + Intronic
912996440 1:114536561-114536583 TGCTGACTTCCTGGTGACGGAGG + Intergenic
913549951 1:119907540-119907562 TGGTGGCCAACTGCTGGGGGTGG + Intergenic
914198586 1:145464833-145464855 TGCTGGCCTCAGGGGGAGGGCGG - Intergenic
914477693 1:148037968-148037990 TGCTGGCCTCAGGGGGAGGGCGG - Intergenic
915117664 1:153610767-153610789 TCCTGGCCTCCAGGGGAGGGAGG - Intronic
916568442 1:166003974-166003996 TGCTGGCCTCGGGCTGGGTGTGG + Intergenic
917003737 1:170388637-170388659 TGCTGCCCTCAGGCTGAGGAGGG - Intergenic
917132992 1:171761581-171761603 TGATGGCCTTCTGCTGGGGTAGG - Intergenic
918217893 1:182408937-182408959 AGCTGGCCTCCTGCTGGAGCTGG - Intergenic
919452623 1:197788874-197788896 GGCTGGCCTGCTGCTGGGGCAGG - Intergenic
919855446 1:201703307-201703329 GGCTGGCCTCCTGCAGAAGGTGG - Intronic
920255415 1:204651181-204651203 TGCTGGCTGGCAGCTGAGGGTGG - Intronic
921638751 1:217526746-217526768 TGCTCACCTCCTGCTGTGTGTGG - Intronic
922568816 1:226619563-226619585 TGCTGGCCTCTTGCTGTATGAGG - Intergenic
922594677 1:226804523-226804545 TGCTGGCCACCTGCTGTGTCTGG + Intergenic
923094516 1:230763949-230763971 TGCTTGCATCCTGATGTGGGGGG - Intronic
923104123 1:230841333-230841355 TGCTGTCCTCCCGAGGAGGGAGG - Intronic
1062865231 10:846839-846861 CGCTTGCCTCCTGCTGAAGGTGG - Intronic
1063491434 10:6467260-6467282 TTCTGGCCACCTGCTGAGAGAGG + Intronic
1067189965 10:44060869-44060891 TGTTGGGCTGCTGATGAGGGCGG + Intergenic
1067269726 10:44779897-44779919 TGCTGACCTCCTCCTACGGGAGG - Intergenic
1068040341 10:51816261-51816283 TGCTGGCCTCCCCCTGAGCCTGG + Intronic
1068222663 10:54063935-54063957 TGCTCGCCACATGGTGAGGGGGG + Intronic
1069598136 10:69686116-69686138 AGCTGGGCTCCTGCTGGAGGTGG - Intronic
1069727855 10:70592808-70592830 TTCTGGCCTCCTGATGGGGCAGG + Intergenic
1069870013 10:71527334-71527356 TGCTGGCCTCCCGCTGGCTGTGG - Intronic
1070806749 10:79275281-79275303 TACTGTCCTCCTTTTGAGGGTGG + Intronic
1071463626 10:85920775-85920797 GGCCGGCCTTCTGCTCAGGGTGG + Intronic
1071495571 10:86165461-86165483 TGCTGGCCTCCTGGAGACAGAGG + Intronic
1071798668 10:89032986-89033008 TGCTGGTTTCCTGTGGAGGGTGG + Intergenic
1073071004 10:100793247-100793269 TGCTGGCCTGCTGCAGGGGCTGG - Intronic
1074910650 10:117905630-117905652 TGTTTGGCTCCTGCTTAGGGAGG - Intergenic
1075471928 10:122697521-122697543 GGCTGGGCTGTTGCTGAGGGTGG + Intergenic
1075495442 10:122915378-122915400 TTCTGCCCTCCTGCTAATGGGGG - Intergenic
1075624402 10:123951168-123951190 TCCCTGCTTCCTGCTGAGGGGGG - Intergenic
1075731501 10:124639240-124639262 TCCTGACCTCCTGCTGGGGTGGG - Intronic
1077191651 11:1258230-1258252 GGGTGGCCTCTTGCTGGGGGTGG + Intronic
1077372609 11:2190428-2190450 TCCCGGCTTCCTGCAGAGGGCGG - Intergenic
1080417084 11:32078850-32078872 TGCTGGCTTCTTCCTGAGAGGGG + Intronic
1081112251 11:39150402-39150424 TGGTGGACGCCTGCTGAGGCAGG + Intergenic
1082129467 11:48470975-48470997 TCCTGGCCTGGTGCTGAGGTGGG + Intergenic
1083316169 11:61816181-61816203 TGCAGGCCGCCTGGGGAGGGAGG - Intronic
1083460014 11:62805132-62805154 TGCTGGCATCCTGGTGTTGGGGG - Intronic
1084181803 11:67450688-67450710 TTCTGGCGCCTTGCTGAGGGAGG + Intergenic
1084617919 11:70248705-70248727 TGCTGGCCTATGGCTGAGGCAGG - Intergenic
1085711700 11:78834939-78834961 TGCTGAGCCCCTGCTGAGGGAGG - Intronic
1088722394 11:112605895-112605917 TGATGGCCTCCTAATGAAGGAGG + Intergenic
1088889928 11:114036327-114036349 TTCTGGCCTCCAGCGGACGGAGG + Intergenic
1089294753 11:117460926-117460948 TGATGGCTTCCTGCTGATGCTGG + Intronic
1089680125 11:120114763-120114785 TCCAGGCCACCTGCTGACGGTGG - Intronic
1091238063 11:134034748-134034770 TGCTGGCCTCCCTCTGATGCTGG + Intergenic
1091782237 12:3221100-3221122 TCTTGGCCACCTGCTGAGGGTGG - Intronic
1091813926 12:3421920-3421942 TGCTGGCCTGCTACTGGGGTGGG + Intronic
1092082731 12:5731204-5731226 TGCTTGCTTTCTGATGAGGGTGG + Intronic
1092672776 12:10882497-10882519 TGCTGGCCTCCTTGTTGGGGTGG + Exonic
1092672792 12:10882560-10882582 TGCTGGCCTCCTTGTTGGGGTGG + Exonic
1092676918 12:10930778-10930800 TGCTGGCCTCCTTGTTGGGGTGG - Exonic
1092708279 12:11308345-11308367 GGATTGCCTCCTGCTGGGGGTGG + Exonic
1093547985 12:20369772-20369794 TGCTGGCCGCCTGCTGCGGGGGG + Exonic
1094616398 12:32040112-32040134 GGCGGGCTTCCTCCTGAGGGAGG + Intergenic
1095610741 12:44124913-44124935 TGCTGGCCTCATGATGAGTTAGG + Intronic
1096629072 12:52913928-52913950 TCCTGGCCTCAGGCTGAGAGAGG + Intronic
1097191480 12:57221509-57221531 AGGTGGCCTCCTGCTGCTGGGGG - Intronic
1101399444 12:104375067-104375089 TGCTGGTGTCCTGCCCAGGGAGG + Intergenic
1102391399 12:112551797-112551819 TCCTGGCCTCTGGCTGAGGATGG + Intergenic
1103476422 12:121222175-121222197 TTGTGGCCTCCTGGGGAGGGCGG + Intronic
1104257381 12:127151636-127151658 TGCTTACCTCCTGCTGTGTGTGG + Intergenic
1104425934 12:128678120-128678142 TGCTGTCCTGCTGTTTAGGGAGG - Intronic
1104744808 12:131204094-131204116 TGCTTCCCTCCTGCTGAGGCCGG + Intergenic
1104789605 12:131473325-131473347 TGCTTCCCTCCTGCTGAGGCCGG - Intergenic
1104906102 12:132214273-132214295 CCCTGGGCTCCTGCTGACGGTGG - Intronic
1106216740 13:27708523-27708545 TGCTGGCCTCCTGCTGAGTATGG + Intergenic
1106579572 13:31005487-31005509 TGGTGGCCTGCTGCGGAAGGTGG + Intergenic
1108576307 13:51794590-51794612 TGCAGGCCTCCTGATGTGGCTGG - Intronic
1108585380 13:51866052-51866074 TGCTGGCCTTCTCCCGAGGCAGG + Exonic
1108680007 13:52771921-52771943 GGCTGGCCTCCTGCTGGGGCTGG - Intergenic
1112305206 13:98267446-98267468 TGCTGGTCTGCTGCTGTGGTTGG + Intronic
1112379569 13:98875929-98875951 TGCTGCACTCCTGCTGAAGGTGG - Intronic
1113613027 13:111661405-111661427 TGGGGGCCGTCTGCTGAGGGTGG + Intronic
1113808358 13:113122897-113122919 GGCTGGCCTCCTGCTGCTCGGGG + Exonic
1114080793 14:19200364-19200386 TGCTGGCTCCCTGGGGAGGGTGG + Intergenic
1114475134 14:22988839-22988861 GGGAGGCCTCCTGCTGAGGCAGG + Intronic
1114483062 14:23047299-23047321 CACTGGCCTCCAGCTGAGAGAGG - Exonic
1114819167 14:25995616-25995638 TGCTGGCATCCTGTTGAGTTAGG - Intergenic
1116643550 14:47497054-47497076 TGCTCACCTCCTGCTGTGTGGGG + Intronic
1117472809 14:56063390-56063412 TGCTTGAATCCTGCTGAGAGAGG - Intergenic
1117961959 14:61172041-61172063 TGCTGGCCCCTTGCAGAAGGAGG + Intergenic
1118077949 14:62322647-62322669 AGCTGGCTTCCTGCAGAGGTAGG + Intergenic
1118349171 14:64961221-64961243 TGCTGGTTTCCTGCAGTGGGAGG - Intronic
1121329234 14:93039719-93039741 TGCTGGCCTGCTGCAGGGTGTGG - Intronic
1121759885 14:96435882-96435904 TGCTCTCCTGCTGGTGAGGGTGG + Intronic
1121908447 14:97768321-97768343 TGCTGGCCACCGTCTAAGGGAGG - Intergenic
1122165507 14:99820421-99820443 AGCTGGCCTCTTGCAAAGGGAGG + Intronic
1122468115 14:101948218-101948240 GGCGGGACTCCTGCTGAGGAGGG - Intergenic
1122889445 14:104725603-104725625 TGCTTGCCTGCTGCTTAGGACGG - Intronic
1123987598 15:25658959-25658981 CCCTGGCTTCCGGCTGAGGGTGG + Intergenic
1124621982 15:31279052-31279074 AACTGGCCTCCTGCTGGGGCAGG - Intergenic
1131149246 15:90036652-90036674 TGCAGGCCTCGAGCTGGGGGTGG + Intronic
1131257538 15:90871975-90871997 TGCGGGGCCCCTGCTGGGGGCGG + Intronic
1132293002 15:100716124-100716146 CGCTGGCCTTCTGCTCAGGCTGG + Intergenic
1132568687 16:634788-634810 TTCTGGGTTCCTGCAGAGGGTGG + Exonic
1132997303 16:2829969-2829991 TGATGGCTTCCACCTGAGGGTGG - Intergenic
1133117057 16:3583305-3583327 TGGTGGCCTCCTGCTGGGCATGG + Exonic
1134126773 16:11621567-11621589 TGGAGGCCTGCTTCTGAGGGGGG - Intronic
1134259173 16:12637111-12637133 TGCTAGCCTCCCGCTGTGGCGGG - Intergenic
1134661734 16:15989370-15989392 TGCTTGCCTCCTGCTGTGTCGGG + Intronic
1135348373 16:21708381-21708403 TGCTCACCTCCTGCTGTGGCTGG + Intronic
1138221893 16:55258813-55258835 TGCCGTCCTCCTGCAGAGGAGGG - Intergenic
1139420899 16:66849004-66849026 TCCTGTCCTCCTGCTTAAGGAGG + Intronic
1139515789 16:67451651-67451673 TGCTGAGCTCCTTCTGAGTGAGG + Intronic
1140780459 16:78291855-78291877 TGATGGCCGCCAGCTGAGGGAGG + Intronic
1141619184 16:85227828-85227850 TGCTGGCCTCATGCCGACCGGGG + Intergenic
1142967475 17:3590522-3590544 GCCTGGCCTCCTGCAGTGGGGGG - Intronic
1143059778 17:4189995-4190017 TTCTGTCCCCTTGCTGAGGGTGG + Intronic
1143082049 17:4389043-4389065 AGGTGGCTTCCTGCTGAGGCTGG + Intergenic
1143480284 17:7224202-7224224 TGCTGGCCTCCTGCTAGGAGAGG + Exonic
1143543269 17:7582020-7582042 TGCTGCTCTCCTGCTGGGGGGGG - Exonic
1143712134 17:8742392-8742414 GACTGGCATCCCGCTGAGGGAGG + Intronic
1143731173 17:8883776-8883798 TGCTGGCCCCCTGGAGTGGGTGG - Intronic
1143732738 17:8890192-8890214 TGCTAGCTTCTTACTGAGGGAGG + Intronic
1144710697 17:17399659-17399681 CTCTGGCCTCATCCTGAGGGAGG - Intergenic
1146256094 17:31392130-31392152 TCCTGGGCTCCGGCGGAGGGAGG - Intronic
1147132478 17:38417724-38417746 TGCTGGCTGCCTGGGGAGGGAGG - Intergenic
1147167745 17:38602429-38602451 TCCTGGCTGCCTGCTGTGGGTGG - Intronic
1148560593 17:48603794-48603816 GGCAGGCTTCCTGGTGAGGGGGG + Intronic
1148936466 17:51167216-51167238 TGCTGCCCCCCTGCGGCGGGTGG - Intronic
1150257083 17:63755737-63755759 TGGTGGGCTCTTGCTGAGGCAGG + Intronic
1150291468 17:63984892-63984914 GGCGGGCCCCGTGCTGAGGGAGG - Intergenic
1150702250 17:67458011-67458033 TGCTGGCCCACTGCTGCAGGAGG + Intronic
1151084387 17:71364044-71364066 GACTGGTGTCCTGCTGAGGGAGG - Intergenic
1151964874 17:77426031-77426053 TGGAGGCCTCCTCCTGAGGCTGG - Intronic
1152503767 17:80732321-80732343 TGCTGGTCTTCTGCTGAAAGGGG - Intronic
1152626683 17:81390836-81390858 TGCTGCCCTCCAGTTGAGGGAGG + Intergenic
1152633011 17:81419191-81419213 TTCTGGTCTCCTGGTGCGGGCGG + Intronic
1152660323 17:81539084-81539106 TGCTGGCATCCAGCTGAGGGTGG + Intergenic
1152679103 17:81656537-81656559 GGCTGGCACCCTGCGGAGGGAGG - Exonic
1156358779 18:36365496-36365518 TGGTTGCCTCTTGCTGAGTGTGG + Intronic
1157224757 18:45852817-45852839 TGCTGGCCTCCTTCTGGTTGTGG - Intronic
1157856094 18:51107036-51107058 TACTGGCCTCCTGCTGGATGTGG - Intergenic
1158102937 18:53851173-53851195 TGTTGGCCTCCTGCTATGAGAGG + Intergenic
1160337363 18:78054402-78054424 TGCTGGTCTCCTGGTAAGGAAGG + Intergenic
1160559533 18:79747452-79747474 AGCTGGTCTGCTGCTGAGAGTGG - Intronic
1161206934 19:3046475-3046497 CTCTGGCCTCCAGCAGAGGGTGG - Intronic
1161331164 19:3688392-3688414 CTCTGGCCCCCTGCTGTGGGCGG + Intronic
1161350893 19:3790924-3790946 GGCTGGCCTCCTTCTCAGGCAGG - Intronic
1161397398 19:4052007-4052029 TGCTGGTGTCCTGGGGAGGGGGG + Intronic
1161855691 19:6763654-6763676 TGCTGAGGTCCTGCTGTGGGTGG + Intronic
1163111838 19:15166051-15166073 TGCTGGCTTCCTTCTGTGGGGGG - Exonic
1163183948 19:15623354-15623376 TGATGTGCTCCTGCTGAGCGAGG + Exonic
1163510613 19:17733078-17733100 TTCAGGCCTCCTGCTGAGGAGGG + Intronic
1164596207 19:29531916-29531938 TGGAAGCCTCCTGCTGAGGCTGG - Intronic
1164601276 19:29565252-29565274 TCCTGGCCTCCTGTGGCGGGTGG + Intergenic
1164632167 19:29768971-29768993 GGCCGGGCTCCTGCTCAGGGAGG - Intergenic
1165105594 19:33468094-33468116 GGCTGGCCACCCGGTGAGGGAGG + Intronic
1166048354 19:40242766-40242788 TGCTTGCCTGTTGCTGGGGGTGG - Intronic
1167113667 19:47476452-47476474 TGCAGGCCTCCTCCTGGGGGAGG - Intronic
1167998517 19:53426132-53426154 CTCTGTCTTCCTGCTGAGGGGGG - Intronic
925036795 2:693029-693051 TGCTGGGCTCCTGGTAAGTGTGG - Intergenic
925404176 2:3595259-3595281 AGGTGGGCTCCTGCTGAGCGAGG + Intronic
926109593 2:10173503-10173525 GGCTGGGCCTCTGCTGAGGGAGG - Intronic
927153681 2:20209930-20209952 TGGTGGCCTCAGGCTGATGGCGG - Intronic
929593538 2:43161956-43161978 TGCTGTCTTCCTGGTGAGGATGG - Intergenic
931628372 2:64277135-64277157 TTCTGGCCCCGTGCTGAGGCAGG - Intergenic
932421779 2:71605575-71605597 TGCTGCTCTCCTGCTGGGGCAGG + Intronic
932773460 2:74514198-74514220 TGCTGGCCTCCGCCTTTGGGCGG - Intronic
933888226 2:86740057-86740079 TGCTTGCCTCCTGCTGTGCACGG - Intronic
933921952 2:87056649-87056671 TGCTTGCCTCCTGCTGTGCACGG + Intergenic
935720769 2:105977000-105977022 TGCTGGGGGCCTGCTGTGGGGGG + Intergenic
937083409 2:119156325-119156347 TGCTGGAATTCTGCTGTGGGTGG + Exonic
938077643 2:128348275-128348297 GGCTGGCCTCCTGCCCAGGATGG + Intergenic
938116331 2:128605254-128605276 CGCTGGCCACCTCCTGCGGGTGG - Intergenic
938140044 2:128787694-128787716 TGCTAACCTCCTCCTGAGGCGGG - Intergenic
940638179 2:156322333-156322355 TGCTGGCCTTCCGCTGTGGATGG - Intergenic
941843251 2:170109840-170109862 TGCTGAGCTCCTGCTGGGGAGGG + Intergenic
943355356 2:186848992-186849014 CACTGGCTTCCTGCTGAGGGAGG - Exonic
944827267 2:203497195-203497217 TGCTGGCTTCCTCCACAGGGAGG - Intronic
945664397 2:212722662-212722684 TGCTGGCCTCATCCTGATAGTGG - Intergenic
947073477 2:226317123-226317145 TCCTGGCCTCCTGCTCCAGGGGG + Intergenic
948267097 2:236642985-236643007 TGCCTCCCTCCAGCTGAGGGAGG + Intergenic
948626167 2:239269576-239269598 TGCTGGCCTCCTGGAGGAGGAGG + Intronic
948897905 2:240935728-240935750 TGCTGGCCTCCCCGTGGGGGTGG + Intronic
1169082625 20:2806444-2806466 TACTTACCTCCTGCTGGGGGTGG - Intergenic
1169514837 20:6304262-6304284 TACTGGCCTCCTACTAAAGGAGG - Intergenic
1172276453 20:33682373-33682395 TGATGGCCTCCACCTGAGAGAGG + Intronic
1173131444 20:40397842-40397864 AGCTGGGTCCCTGCTGAGGGAGG - Intergenic
1175645218 20:60665027-60665049 TGTTTGCCTTCTGCTGAGGGTGG - Intergenic
1178679404 21:34659963-34659985 TGCAGCCCTGCTGCTGAGGAGGG - Intergenic
1178991167 21:37358024-37358046 TGCTTGCCTTCTGCTCAGGGCGG + Intergenic
1179213555 21:39348517-39348539 TGCGGGCCTTCTGCGGGGGGTGG - Intronic
1179884890 21:44309672-44309694 TGGTGGCCTCCTGCTCAGGTGGG + Intronic
1179886429 21:44316098-44316120 TGCTTTCCTCCTGCTGGGTGGGG + Intronic
1180499980 22:15922321-15922343 TGCTGGCTCCCTGGGGAGGGTGG - Intergenic
1181048911 22:20229537-20229559 GGCTGGCCACCTCCTGCGGGTGG - Intergenic
1181110393 22:20599298-20599320 TGCCAGCCTCCTGCTGTGGCTGG + Intergenic
1181123393 22:20687863-20687885 TCCTGCTCTCCTGCTGAGGCGGG - Intergenic
1181365364 22:22372372-22372394 TCCTTGCCTCCTTCTCAGGGCGG + Intergenic
1181479999 22:23192761-23192783 TGCTGACCTGCTGCTGACAGTGG + Intronic
1181708045 22:24660906-24660928 TCCTGCTCTCCTGCTGAGGCGGG + Intergenic
1182505261 22:30777713-30777735 TGCAGCCCTCCTGCTAAGGGAGG + Intronic
1183560546 22:38569751-38569773 CCCAGGCCTCCTGCTGAGGGAGG - Intronic
1183585704 22:38751787-38751809 CGCTGGCCAGCTGCTGAGGCCGG + Intronic
1184123945 22:42473510-42473532 TGATGGCTTCATGCTGTGGGTGG + Intergenic
1184591301 22:45485072-45485094 TGATGGCCTCAAGCTGATGGGGG + Intergenic
1184767488 22:46579165-46579187 TCTGGGTCTCCTGCTGAGGGAGG + Intronic
1185074022 22:48673537-48673559 GGCCGGCCTTCTTCTGAGGGTGG + Intronic
1185148669 22:49152407-49152429 AGCAGGCCTGCTGCTGAGAGGGG - Intergenic
1185348077 22:50319354-50319376 TGCTGGCCTCTTACTGAGAGGGG - Intronic
1203217523 22_KI270731v1_random:14715-14737 TCCTGCTCTCCTGCTGAGGCGGG + Intergenic
949970050 3:9396943-9396965 GGCCGGCCTCCTGCGGCGGGAGG - Intergenic
950246194 3:11421151-11421173 TGGTGGCCACCTGATCAGGGTGG + Intronic
952851425 3:37732819-37732841 TGGGGGCCTGCTGCTGAGGAAGG - Intronic
953918056 3:46933190-46933212 GGCTGGGCTCCCGTTGAGGGAGG - Intronic
954972440 3:54662606-54662628 TGCTGGCCTGAGGCTGAGGGAGG - Intronic
958594266 3:96201503-96201525 TGCTGCCCTCCTGCTGGGGGAGG + Intergenic
960469264 3:118040634-118040656 GGCTGGCCTACTGCTAAGGTGGG - Intergenic
960898052 3:122526940-122526962 TGCATCCCTCCTCCTGAGGGTGG - Intergenic
961173452 3:124815494-124815516 CGCTTGCCTCCTGCTGAGTCAGG - Intronic
961586557 3:127932592-127932614 TGCTGCCTTCCTGGTGAAGGAGG - Intronic
961627452 3:128273838-128273860 TGCTGCCCCACTGCTGAGGTGGG + Intronic
961771750 3:129255090-129255112 TGCTGGAGCCCTGCTGGGGGTGG + Intronic
964160685 3:153641255-153641277 TGTTGGCCTCCTGCCAGGGGTGG - Intergenic
968727071 4:2252683-2252705 TGTTGGGCTCCTCCTGGGGGTGG - Intronic
968977867 4:3831240-3831262 TGCTGGGCTCTTGTTGGGGGTGG - Intergenic
969493969 4:7515374-7515396 GGCTGGCCACCTGCTGGGGCTGG + Intronic
970874265 4:20851190-20851212 TGCTGGGCACCTGTTGGGGGAGG - Intronic
971766371 4:30837243-30837265 TGCTGGCCACCTGCAGTGTGTGG + Intronic
975617192 4:76258153-76258175 TGTTGGCTTCCTGCTGAAGCAGG + Intronic
976754679 4:88485267-88485289 TGGTGGCCTCCTGCTGAGGTGGG - Intronic
981705573 4:147655767-147655789 TGGTATCCTCCTGCTGAGGTAGG - Intronic
983410065 4:167385481-167385503 TGTTGGCTTCATTCTGAGGGAGG - Intergenic
985662007 5:1162023-1162045 TGCTGGCCCCCAGCCGAGGGAGG + Intergenic
986667563 5:10116696-10116718 TGCTGCCCTCCTGCTGGTGTGGG + Intergenic
987172242 5:15270817-15270839 TTCTGCCATCCTGCTAAGGGAGG + Intergenic
987334367 5:16885862-16885884 TTCAGGTCCCCTGCTGAGGGTGG - Intronic
988681592 5:33489138-33489160 TGCTGGACACCAGCGGAGGGTGG + Intergenic
990042424 5:51390109-51390131 CGCCGGCCGCCAGCTGAGGGCGG + Intronic
992104156 5:73436667-73436689 TGCCGGGCTCCGGCTGTGGGCGG - Intergenic
992597375 5:78360303-78360325 AGCTGGCCTCCGGCTGAGAGCGG + Intergenic
993949735 5:94159138-94159160 TCCTGTCCTCGTGCTGAGGCAGG + Intronic
995060708 5:107809000-107809022 ATCTGGGCTGCTGCTGAGGGAGG + Intergenic
996318543 5:122188528-122188550 TGCTGGCTTTCAGCTGAGGGTGG - Intergenic
997380144 5:133429776-133429798 TGGTGGCCTCATGCTGAAGGTGG - Intronic
997470871 5:134115989-134116011 TGCTGCCCTGCTCCCGAGGGGGG - Exonic
999874443 5:155786982-155787004 TGCTGGCATTCTGATGAAGGTGG - Intergenic
1006985019 6:38170251-38170273 TGCTGGGCTCATGCAGAGGCAGG - Exonic
1007427405 6:41756509-41756531 AGCTTCCTTCCTGCTGAGGGAGG - Intergenic
1007663217 6:43499085-43499107 TGCTGACCTCCTGCTCAAGCCGG - Exonic
1010653964 6:78489699-78489721 GGCTGGCCTCCTGCTTGAGGGGG + Intergenic
1010769187 6:79809051-79809073 GACTGGCCTCCAGCTGAGGAAGG + Intergenic
1011129464 6:84038355-84038377 TGCTGGTCTCCTGCTGGGGTTGG - Intronic
1013016948 6:106168523-106168545 TGCTGGCTTCTTGCTCAGGCTGG - Intergenic
1013465271 6:110412511-110412533 TTCTGGCCTCCTGCTGAGGGTGG + Intronic
1015925360 6:138304321-138304343 TGGTTGCCTCAGGCTGAGGGTGG + Intronic
1018462762 6:164014716-164014738 TGTTGGCCTCCAGCTGAGGCAGG + Intergenic
1019748735 7:2715440-2715462 TGCCTGGCTCATGCTGAGGGTGG + Exonic
1019770905 7:2883202-2883224 TGCTGGCGGCCAGCTGGGGGTGG + Intergenic
1020676315 7:11189022-11189044 TGCTGCCTTCCTGCTGAAGTGGG - Intergenic
1022315955 7:29245914-29245936 TGCTGGGCTCCTGATAAGGAGGG + Intronic
1023921022 7:44630000-44630022 TGTTGGCCTGCTGCTGAGTCTGG + Intronic
1024156811 7:46634476-46634498 TACTGGCCTTCTGCTGTGGTGGG + Intergenic
1024249474 7:47495469-47495491 TGCAGGCCTCGTCCTCAGGGCGG - Intronic
1026023008 7:66725373-66725395 TGGTGGCCTAGGGCTGAGGGTGG - Intronic
1029782501 7:102749209-102749231 TGCTTGCCCCCTGCTCAGGTTGG + Exonic
1031987161 7:128170655-128170677 TGCTGGCTTCCTGCAGGGTGGGG - Intergenic
1032842866 7:135727682-135727704 TCCTGGCCTCCTGCTTTAGGTGG + Exonic
1033310787 7:140260319-140260341 TCCTGGCCTCCTAGTAAGGGCGG + Intergenic
1033885741 7:145942906-145942928 GGCAGTCCTGCTGCTGAGGGTGG - Intergenic
1034432288 7:151047082-151047104 GGCTGGCTGCCTGGTGAGGGAGG - Intronic
1034549895 7:151813822-151813844 TCTTGGCCTCCTGCGGAGCGTGG - Intronic
1034848255 7:154467830-154467852 TGTTTGCCTTCTGCTGAGAGAGG + Intronic
1035025271 7:155820843-155820865 TGCAGGCCTCCTACTGTGGGAGG - Intergenic
1035314982 7:157991956-157991978 TGCTGGCCTGATGGTGATGGAGG - Intronic
1035566459 8:644260-644282 TTCAGGGCTCCTGCAGAGGGTGG + Intronic
1035665410 8:1376561-1376583 TGCTCTCCTCCTGCTGAAGAAGG + Intergenic
1035677895 8:1467872-1467894 TGGTGGCCTCCTGACCAGGGGGG - Intergenic
1036582042 8:10084184-10084206 TTCTGGCCTCCTGAGGATGGTGG + Intronic
1036583289 8:10098983-10099005 TGCTGGCCTCAGGATGTGGGAGG - Intronic
1036746999 8:11416968-11416990 TGCTGGTGCCCTGCTGAGCGTGG - Intronic
1037881423 8:22575202-22575224 TTCTGGCCTCCAGCTGGGTGTGG + Exonic
1038029633 8:23626494-23626516 CTCTGGCTTCTTGCTGAGGGTGG + Intergenic
1038420502 8:27431198-27431220 TGTTGGCCTCCAGCTCTGGGAGG + Intronic
1041249379 8:55919713-55919735 AGCTGGCCTCCCGCTGAGAAGGG - Intronic
1041503044 8:58560117-58560139 TGCTGGTTTCATGCTGAGGGAGG - Intronic
1041567593 8:59297603-59297625 TGCTGGAATCATCCTGAGGGAGG - Intergenic
1042343346 8:67703349-67703371 TGCTGGCCTCCTGTCCAGGAGGG - Intronic
1043176358 8:77027299-77027321 TCATGGCCTCCTGTTGAGGTGGG + Intergenic
1043793436 8:84503768-84503790 TGATGATCTCCTGCTGAGGCAGG + Intronic
1044559988 8:93603429-93603451 GGTTGCCCTCCTTCTGAGGGTGG - Intergenic
1045320987 8:101081020-101081042 TGCTCGACTCCTGCTGACTGTGG - Intergenic
1045329092 8:101140164-101140186 TGCTGGCCTCTTTCTCAGGCTGG + Intergenic
1046092906 8:109524497-109524519 TGCTCACCTCCTCATGAGGGTGG + Intronic
1046848382 8:118944454-118944476 TCCTAGCCTCCTGGTGAGGATGG - Intronic
1046880418 8:119300831-119300853 AGCTGGCCTGGTGCTGAGGCAGG - Intergenic
1047503199 8:125458225-125458247 TGCTTGCCTCCTGGTGATGATGG + Intergenic
1049238391 8:141524315-141524337 AGGTGACCACCTGCTGAGGGAGG - Intergenic
1049262940 8:141649413-141649435 TGCTGGCCTCCAGCAGGTGGAGG - Intergenic
1049333095 8:142065500-142065522 TGGTGGCCCCCTTCTGGGGGGGG - Intergenic
1049337055 8:142092192-142092214 TGCCGGCAACCTGATGAGGGAGG + Intergenic
1049417824 8:142503601-142503623 TGCCAGCCTCCTGCTGGGGAGGG + Intronic
1049487973 8:142876330-142876352 TGCTGGTGTACTGTTGAGGGCGG + Exonic
1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG + Intergenic
1049504959 8:142991251-142991273 TGCTCACCTGCTGCTGTGGGTGG - Intergenic
1049528631 8:143142468-143142490 AGCTGGCCTCCTGGGGAGGGAGG - Intergenic
1049528650 8:143142523-143142545 AGCTGGCCTCCTGGGGAGGGAGG - Intergenic
1049528669 8:143142579-143142601 AGCTGGCCTCCTGGGGAGGGAGG - Intergenic
1049528688 8:143142634-143142656 AGCTGGCCTCCTGGGGAGGGAGG - Intergenic
1049528720 8:143142744-143142766 AGCTGGCCTCCTGGGGAGGGAGG - Intergenic
1049528751 8:143142854-143142876 AGCTGGCCTCCTGCGGAGGGAGG - Intergenic
1049624629 8:143614513-143614535 CGCTGGCCTCTTACTGAGGCTGG + Intronic
1049708062 8:144051817-144051839 GGCTCGCCCCCTGCGGAGGGAGG + Exonic
1049773688 8:144395147-144395169 AGAAGGCCTCCTGCTGGGGGTGG + Exonic
1049993383 9:1011036-1011058 TGCTGAGCTCCAGCTGAGGAAGG + Intergenic
1051212967 9:14764631-14764653 TGCTGGCCTTCAGCTGAGAGAGG + Intronic
1056796434 9:89662072-89662094 TGCTGGGCTCCTGCCAAGTGCGG + Intergenic
1061002238 9:127908912-127908934 TCCTGGGCTCCTGGTGAGGGAGG + Intronic
1061089255 9:128417670-128417692 GGCTGGACTCCTGGGGAGGGTGG + Intronic
1061533754 9:131234961-131234983 TGCTGGCATCTGGTTGAGGGAGG - Intergenic
1061620362 9:131807667-131807689 TCCTGGCCTGCAACTGAGGGAGG - Intergenic
1061947718 9:133918004-133918026 TGCTGACCTCCTGTGGAAGGAGG - Intronic
1061951422 9:133938415-133938437 TGGTGGCCTCCTGGTGAGCCTGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062051820 9:134451357-134451379 AGCTGGCCTTCTTCTCAGGGAGG - Intergenic
1062511282 9:136907536-136907558 TGCTGGCTTCCTGGTGCTGGAGG + Intronic
1187185828 X:16984324-16984346 AGCTGGCCTCCTTCAGAGTGAGG + Intronic
1190325577 X:49205072-49205094 TGCCTGCCTCCTGCTGGGGAGGG + Exonic
1190934882 X:54989809-54989831 TGGAGGCCTCCTGCTGTGGTAGG + Intronic
1192121613 X:68461576-68461598 TTCTGGTCTCCTACTGAGGCAGG - Intergenic
1192242181 X:69341267-69341289 TGCTGGCCTCATCCTGAGTTAGG + Intergenic
1193980106 X:88171976-88171998 TGATGGCCTCCAGCTGTGAGAGG + Intergenic
1194268014 X:91779060-91779082 TGCTCGCCTCCTGGAGAAGGAGG - Intergenic
1197082982 X:122440986-122441008 GGCTGGCCTGGTGCTGAGGCAGG + Intergenic
1200060132 X:153480399-153480421 TGGTGGCCTGCTGCTGACGGTGG + Intronic
1200211182 X:154347212-154347234 TGCTGGCCCCAGGCTCAGGGCGG - Intergenic
1200219670 X:154384880-154384902 TGCTGGCCCCAGGCTCAGGGCGG + Intergenic
1200244482 X:154515868-154515890 TGCGGGACCCCTGCTGGGGGCGG + Exonic
1200585217 Y:4999981-5000003 TGCTCGCCTCCTGGAGAAGGAGG - Intergenic