ID: 902880725

View in Genome Browser
Species Human (GRCh38)
Location 1:19370240-19370262
Sequence GTCCTCTCCCATCACAGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 247}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902880718_902880725 12 Left 902880718 1:19370205-19370227 CCCAGGCGGTTCCCACTGCTCAG 0: 1
1: 0
2: 0
3: 14
4: 173
Right 902880725 1:19370240-19370262 GTCCTCTCCCATCACAGTACAGG 0: 1
1: 1
2: 0
3: 25
4: 247
902880719_902880725 11 Left 902880719 1:19370206-19370228 CCAGGCGGTTCCCACTGCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 198
Right 902880725 1:19370240-19370262 GTCCTCTCCCATCACAGTACAGG 0: 1
1: 1
2: 0
3: 25
4: 247
902880723_902880725 0 Left 902880723 1:19370217-19370239 CCACTGCTCAGGGCACTGTCCTT 0: 1
1: 0
2: 0
3: 36
4: 400
Right 902880725 1:19370240-19370262 GTCCTCTCCCATCACAGTACAGG 0: 1
1: 1
2: 0
3: 25
4: 247
902880722_902880725 1 Left 902880722 1:19370216-19370238 CCCACTGCTCAGGGCACTGTCCT 0: 1
1: 0
2: 3
3: 25
4: 258
Right 902880725 1:19370240-19370262 GTCCTCTCCCATCACAGTACAGG 0: 1
1: 1
2: 0
3: 25
4: 247
902880715_902880725 27 Left 902880715 1:19370190-19370212 CCCTTCAGGGCGTGGCCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 97
Right 902880725 1:19370240-19370262 GTCCTCTCCCATCACAGTACAGG 0: 1
1: 1
2: 0
3: 25
4: 247
902880716_902880725 26 Left 902880716 1:19370191-19370213 CCTTCAGGGCGTGGCCCAGGCGG 0: 1
1: 0
2: 0
3: 19
4: 139
Right 902880725 1:19370240-19370262 GTCCTCTCCCATCACAGTACAGG 0: 1
1: 1
2: 0
3: 25
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902880725 Original CRISPR GTCCTCTCCCATCACAGTAC AGG Intronic
901210711 1:7524501-7524523 GCCCTCACCCAACACAGTACAGG - Intronic
901324207 1:8357351-8357373 GTGCTCTCCCATGTCAGGACTGG + Intronic
902880725 1:19370240-19370262 GTCCTCTCCCATCACAGTACAGG + Intronic
903697271 1:25217189-25217211 GTCCTCTGCCTTCACACTCCTGG - Intergenic
904179294 1:28654606-28654628 GACCTCTTCCATCACAGAAAGGG - Intergenic
905237438 1:36559895-36559917 GGGCTCTCCCATCACAGAAGAGG - Intergenic
905240074 1:36575731-36575753 GTCCTCCCCCAGCACAGGACTGG + Intergenic
905919107 1:41707504-41707526 CTCCTCACCCTTCCCAGTACGGG - Intronic
906371534 1:45258193-45258215 ATCCCCTCCCATCACAGGCCTGG + Intronic
907274789 1:53311148-53311170 GTCCACCCCCATCACAGCTCAGG + Intronic
907332535 1:53680406-53680428 GTCCCCTTCCACCCCAGTACTGG - Intronic
907392251 1:54165725-54165747 AGCCTCTCCCATCACAGGACCGG - Intronic
907656091 1:56343058-56343080 GTCCTCTCCCATCACAGGACTGG + Intergenic
907925617 1:58953062-58953084 AGCCTCTCCCATCACAGGCCTGG + Intergenic
908479835 1:64527795-64527817 GTACTCTAAGATCACAGTACTGG - Intronic
908537593 1:65092568-65092590 TTCCTGTACCATCACAGTCCTGG + Intergenic
908573613 1:65435947-65435969 GTCCTCTCACATCACATTTGGGG - Exonic
909044337 1:70690898-70690920 GGCCCCTCCCATCACAGGACTGG + Intergenic
911007664 1:93243459-93243481 AGCCTCTCCCATCACAGGCCTGG - Intronic
913402170 1:118448686-118448708 ATCCCCTCCCATCACAGGCCTGG + Intergenic
913710039 1:121473448-121473470 AGCCCCTCCCATCACAGGACTGG - Intergenic
914721673 1:150294392-150294414 TTCCTGTACCATCACAGTCCTGG - Exonic
916571563 1:166032676-166032698 GTCCTCCCCCACCAAAGAACTGG - Intergenic
917931279 1:179824430-179824452 GTCCTCTCCCCTGAGAGTTCAGG - Intergenic
919366586 1:196669401-196669423 AGCCTCTCCCATCACAGGCCTGG + Intronic
919420424 1:197363842-197363864 TTCCTATACCATCACAGTCCTGG - Intronic
919554347 1:199031879-199031901 AGCCTCTCCCATCACAGACCTGG - Intergenic
919869199 1:201807891-201807913 GTCCTCCCCCATCCCAGTAGTGG + Intronic
921880461 1:220249658-220249680 AGCCTCTCCCATCACAGGCCCGG + Intronic
922606346 1:226892062-226892084 GGCCTCACCCAGCACAGCACGGG - Intronic
922724718 1:227917518-227917540 GTCCACGCCCACCACAGCACCGG - Intergenic
1066471232 10:35700305-35700327 GTCCTCTCCCTCCACATGACTGG - Intergenic
1067727032 10:48778272-48778294 GTGCCCTCCCATCACATAACAGG - Intronic
1069166460 10:65166554-65166576 AGCCTCTCCCATCACAGACCTGG - Intergenic
1070870036 10:79743648-79743670 AGCCTCTCCCATCACAGGACTGG + Intergenic
1071263794 10:83945566-83945588 GACCTCTTCCACCACAGTAGGGG - Intergenic
1071636960 10:87265868-87265890 AGCCTCTCCCATCACAGGACTGG + Intergenic
1071658287 10:87472086-87472108 AGCCTCTCCCATCACAGGACTGG - Intergenic
1072395363 10:95033757-95033779 GCTCTCTCCCATCACAGGACTGG - Intergenic
1075163468 10:120044764-120044786 AGCCTCTCCCCTCACAGTATAGG - Intergenic
1075803308 10:125166702-125166724 TTCCTGTGCCATCACAGTCCTGG - Intergenic
1077416810 11:2427753-2427775 GCCCTGTCCCATCACATTTCAGG - Intergenic
1078687379 11:13546254-13546276 AGCCTCTCCCATCACAGGCCTGG + Intergenic
1078744216 11:14095970-14095992 CTCCTGTCCCATCATAGCACTGG - Intronic
1081654163 11:44846396-44846418 GCCCTCCCCCATCACTGCACAGG - Intronic
1085707378 11:78798837-78798859 TTCCTCTCCCATCCCATTACTGG + Intronic
1087336544 11:96851658-96851680 AGCCTCTCCCATCACAGGCCTGG + Intergenic
1088443912 11:109902213-109902235 AGCCCCTCCCATCACAGTCCTGG - Intergenic
1092084221 12:5742440-5742462 TTCCTTTCACATCACAGTGCAGG - Intronic
1093076116 12:14760700-14760722 AGCCTCTCCCATCACAGGCCTGG + Intergenic
1093967312 12:25340955-25340977 AGCCTCTCCCATCACAGGCCCGG - Intergenic
1095234961 12:39785170-39785192 AGCCCCTCCCATCACAGGACCGG + Intronic
1097401690 12:59135045-59135067 AGCCTCTCCCATCACAGGCCTGG - Intergenic
1098202252 12:68068532-68068554 GTTCTCTCCCATTGCAGTATTGG - Intergenic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103588383 12:121973048-121973070 AGCCCCTCCCATCACAGTCCTGG + Intronic
1103967970 12:124652245-124652267 TTCCTCTCCCATCCCAGACCTGG + Intergenic
1106718731 13:32418134-32418156 AGCCTCTCCCATCACAGGCCTGG + Intronic
1107565350 13:41597784-41597806 GTCCTCCCCCATCTCAGTGAAGG + Intronic
1108184372 13:47873571-47873593 ATCCCCTCCCATCACAGGCCTGG - Intergenic
1108933923 13:55864262-55864284 AGCCCCTCCCATCACAGTCCTGG + Intergenic
1109276219 13:60306788-60306810 AGCCCCTCCCATCACAGTTCTGG - Intergenic
1110883200 13:80598927-80598949 GTCCTATCCCATCAAAATAGTGG + Intergenic
1111442897 13:88304235-88304257 GGCCCCTCCCATCACAGAACTGG + Intergenic
1112887567 13:104193324-104193346 AGCCCCTCCCATCACAGTCCTGG + Intergenic
1114634771 14:24181310-24181332 CTCCTGTCCCATCACAGGACTGG + Intronic
1115298507 14:31857351-31857373 AGCCTCTCCCATCACAGGTCTGG - Intronic
1116243574 14:42379234-42379256 GTGCATTCCCATCACAGTAGTGG - Intergenic
1116625142 14:47254122-47254144 AGCCTCTCCCATCACAGGCCTGG - Intronic
1117009182 14:51452874-51452896 GTCTTCTCTCCTCAAAGTACTGG - Intergenic
1118112477 14:62736900-62736922 CTCCTTTCTCACCACAGTACAGG + Intronic
1130046222 15:80447171-80447193 CTCATCTCCCATCACAGCAAGGG + Intronic
1133696831 16:8272606-8272628 GTTCTCACCCATCACAAGACTGG - Intergenic
1141473120 16:84252749-84252771 GTCCCTACCCATCACAGTCCAGG - Intergenic
1142303182 16:89270690-89270712 GTCACCGCCCATCACAGAACTGG + Intronic
1142303199 16:89270748-89270770 GTCACCACCCATCACAGAACTGG + Intronic
1142311414 16:89316326-89316348 GGCGTCTCCCCTCACAGTGCAGG + Intronic
1143775395 17:9195655-9195677 GTCCCCTCCCACCACAGCCCAGG - Intronic
1145772191 17:27501486-27501508 AGCCTCTCCCATCACAGGCCTGG + Intronic
1148801031 17:50225925-50225947 AGCCTCTCCCATCACAGGCCTGG - Intergenic
1149341080 17:55687183-55687205 GGCCCCTCCCATCACAGGCCTGG + Intergenic
1149686828 17:58540578-58540600 GCCCACTCCCATTACAGGACAGG + Intronic
1151692694 17:75696610-75696632 GTCCTCTCCCTTCTGAGTCCTGG - Intronic
1153011993 18:547576-547598 AGCCCCTCCCATCACAGTCCTGG - Intergenic
1153262838 18:3241249-3241271 AGCCCCTCCCATCACAGGACTGG + Intergenic
1153539124 18:6135257-6135279 ACCCTCTCCCATCACAGGCCTGG - Intronic
1154351714 18:13589268-13589290 GCCTTCTCCCATCACAGTTTGGG - Intronic
1155514985 18:26615595-26615617 ATCCTGTCCCCTTACAGTACTGG + Intronic
1156207944 18:34906303-34906325 AGCCTCTCCCATCACAGGCCTGG - Intergenic
1157339027 18:46762728-46762750 GTCCTCACGCATCACAATTCAGG - Intergenic
1159357715 18:67358641-67358663 AGCCTCTCCCATCACAGCCCTGG + Intergenic
1160092592 18:75841037-75841059 GACCTCTTCCATCACAGAAAGGG + Intergenic
1160817301 19:1042087-1042109 GGCCCCTCCCAGCACAGTGCGGG - Exonic
1162873927 19:13606923-13606945 ATCCTCCCCCATCCCATTACAGG + Intronic
1163957557 19:20658405-20658427 GTCCTCACTCCTCCCAGTACTGG - Intronic
925498930 2:4483211-4483233 ATCCCCTCCCATCACAGGCCTGG + Intergenic
925805202 2:7641488-7641510 AGCCTCTCCCATCACAGGCCTGG - Intergenic
926836764 2:17031765-17031787 ATCCTCTCCAATCACAGGCCTGG - Intergenic
927272650 2:21229760-21229782 GTCAGCTCCCTTCACAGAACTGG + Intergenic
930054412 2:47240874-47240896 GTCCTCTCCCATCACCCTGAAGG - Intergenic
931122421 2:59234617-59234639 GTCCTCTCCCAGCACATCATGGG - Intergenic
931869369 2:66442459-66442481 ATCCTATGCCACCACAGTACAGG + Intronic
932770191 2:74496850-74496872 CTCCTCTCCCCTCACACTGCAGG + Intergenic
933639128 2:84740820-84740842 GCTCTCTCCCATCACAAGACTGG - Intronic
934274771 2:91566896-91566918 GTCCTGTCCCAGCACTGTCCCGG - Intergenic
935153531 2:100461559-100461581 GTCCTCTACCATCACACTTTGGG - Intergenic
935751718 2:106241041-106241063 GTCCTCTACTATTACTGTACTGG - Intergenic
935912137 2:107908590-107908612 GTCCTCTACTATTACTGTACTGG - Intergenic
941560251 2:167035786-167035808 GGCCTCTCCCATCACAGATCTGG + Intronic
942203297 2:173593328-173593350 GGCCCCTCCCATCACAGGCCTGG - Intergenic
944800122 2:203230983-203231005 AGCCTCTCCCATCACAGGCCTGG + Intergenic
945364135 2:208930034-208930056 ATCCTCTGCCATCCCAGTGCTGG + Intergenic
946870571 2:224080666-224080688 GTCTTGTCCCATCACAGGGCTGG - Intergenic
947236766 2:227949590-227949612 AGCCCCTCCCATCACAGGACTGG + Intergenic
1168906713 20:1409807-1409829 TTCCTCTCACATAACAGTCCAGG - Intergenic
1170750396 20:19139798-19139820 AGCCTCTCCCATCACAGGCCTGG - Intergenic
1171975349 20:31591115-31591137 GTGCTTTCCCATCACAGCACTGG + Intergenic
1176222311 20:63975461-63975483 GTGGACTCCCATCACAGTGCTGG + Exonic
1177740347 21:25146462-25146484 AGCCCCTCCCATCACAGTTCTGG - Intergenic
1177952233 21:27552517-27552539 AGCCCCTCCCATCACAGCACTGG - Intergenic
1179310574 21:40192310-40192332 GGCCTCTCCCATGACACTATGGG - Intronic
1181367161 22:22386852-22386874 GACCTCTTCCATCACAGGAAGGG - Intergenic
1181859384 22:25806323-25806345 GACACCTCCCATCACAGGACAGG + Intronic
1184045155 22:41968692-41968714 GACATCTGCCATCACCGTACAGG + Intergenic
1184256947 22:43292690-43292712 GTCCTCTCCCAGTTCAGTGCAGG - Intronic
1184464385 22:44660363-44660385 GTCCTGACCCATCGCAGTCCTGG + Intergenic
1203296454 22_KI270736v1_random:47058-47080 GTTCTCTTTCATCACAGGACTGG - Intergenic
954477487 3:50761735-50761757 GTCCGTTCCCATCCCATTACTGG + Intronic
956551161 3:70461431-70461453 AGCCTCTCCCATCACAGACCCGG + Intergenic
959122958 3:102254557-102254579 GTTGTCTCCCGTCACAGTACAGG - Intronic
959171407 3:102848273-102848295 AGCCCCTCCCATCACAGGACTGG - Intergenic
959342590 3:105149440-105149462 AGCCTCTCCCATCACAGGCCTGG - Intergenic
961203633 3:125063551-125063573 TTCCTCTCCCCACACAGTCCAGG + Intergenic
962240633 3:133748098-133748120 GTCTCCTCCCATCACTGTCCTGG - Intronic
962339541 3:134570119-134570141 AGCCTCTCCCATCACAGGCCTGG - Intronic
963110007 3:141680703-141680725 GTCCTTGCCCATGGCAGTACTGG + Intergenic
963331659 3:143922350-143922372 GACCTCTTCCATCACAGAAAGGG - Intergenic
963683596 3:148410695-148410717 GGCCCCTCCCATCACAGTCCTGG - Intergenic
967394335 3:188990240-188990262 GGCCTCTCCCAACACAGGCCAGG - Intronic
967462335 3:189761085-189761107 AACCTCTCCCATCACAGGCCTGG - Intronic
968590503 4:1456643-1456665 GGCCCCTCCCATCACAGGCCTGG - Intergenic
968597070 4:1491175-1491197 GGCCCCTCCCATTACAGGACAGG + Intergenic
969107932 4:4822151-4822173 AGCCTCTGCCATCACAGGACTGG + Intergenic
971793706 4:31199881-31199903 AGCCTCTCCCATCACAGGCCTGG - Intergenic
972370602 4:38419653-38419675 AGCCTCTCCCATCACAGGCCTGG - Intergenic
975052600 4:69883983-69884005 ATCCCCTCCCATCACAGGTCTGG - Intergenic
975952301 4:79788784-79788806 AGCCTCTCCCATCACAGGCCTGG + Intergenic
976042770 4:80906839-80906861 AGCCCCTCCCATCACAGTTCTGG - Intronic
976051071 4:81012204-81012226 AGCCTCTCCCATCACAGGCCTGG + Intergenic
976503185 4:85815168-85815190 AGCCCCTCCCATCACAGTCCTGG - Intronic
977329699 4:95621980-95622002 GTCCTTTCCTATCACACCACAGG - Intergenic
978654724 4:111051952-111051974 AGCCTCTCCCATCACAGACCTGG + Intergenic
979839715 4:125423265-125423287 AGCCTCTCCCATCACAGGCCTGG + Intronic
980083657 4:128369461-128369483 AGCCTCTCCCATCACAGGCCTGG - Intergenic
980202737 4:129677072-129677094 AGCCTCTCCCATCACAGGCCTGG + Intergenic
980737353 4:136907754-136907776 GTCCTATCCCATCTCTGTCCTGG + Intergenic
982299834 4:153867534-153867556 AGCCTCTCCCATCACAGGCCTGG + Intergenic
982507702 4:156240808-156240830 GTCATCTTCCAGGACAGTACAGG + Intergenic
983379071 4:166968372-166968394 AGCCTCTCCCATCACAGGCCTGG + Intronic
983736689 4:171070586-171070608 AGCCCCTCCCATCACAGGACTGG - Intergenic
983886748 4:172988631-172988653 AGCCTCTCCCATCACAGGCCTGG + Intronic
984057062 4:174942664-174942686 AGCCCCTCCCATCACAGTCCTGG - Intronic
984318613 4:178161529-178161551 AGCCTCTCCCATCACAGGCCTGG - Intergenic
985030877 4:185788035-185788057 GCCCTCTCCCATCTCAGATCTGG - Intronic
985062861 4:186095575-186095597 GTCCTCGCCCATCACGGTCGTGG + Intergenic
985492273 5:186893-186915 TTCCTCCCCCACCTCAGTACTGG + Exonic
986366930 5:7041811-7041833 GTCCCACCTCATCACAGTACTGG - Intergenic
986717820 5:10536718-10536740 GGCCTCTGTCATCGCAGTACTGG + Intergenic
986869864 5:12033130-12033152 ATCCACTCCCATCACAGCCCTGG + Intergenic
988051927 5:26042044-26042066 GCTCTCTCCTATCACAGGACTGG + Intergenic
988077674 5:26373480-26373502 TTCCACTCCCATCACAGGCCCGG + Intergenic
988647246 5:33108245-33108267 ATCCCCTCCCATTACAGTTCTGG + Intergenic
989367778 5:40675826-40675848 GTCCTCTGCCAACATAATACAGG - Intergenic
989966826 5:50475004-50475026 AGCCCCTCCCATCACAGGACTGG + Intergenic
990038974 5:51356522-51356544 GTCATCAACCATCACAGTGCTGG + Intergenic
990083354 5:51944626-51944648 AGCCTCTCCCATCACAGGCCTGG + Intergenic
992375701 5:76185730-76185752 AGCCTCTCCCATCACAGGCCTGG - Intronic
994524158 5:100882617-100882639 AGCCTCTCCCATCACAGACCTGG + Intronic
994656004 5:102593614-102593636 ATCCCCTCCCATCACAGGCCTGG - Intergenic
995389696 5:111626921-111626943 AGCCCCTCCCATCACAGAACTGG + Intergenic
995828668 5:116329721-116329743 AGCCTCTCCCATCACAGGCCTGG - Intronic
996774558 5:127119851-127119873 GTCCTTTACCTTCACAGTAAAGG + Intergenic
997633320 5:135386249-135386271 CTCCTCTCCCATCACAAAACAGG + Intronic
998144618 5:139720115-139720137 AGCCTCTCCCATCACAGGCCTGG + Intergenic
998980514 5:147697513-147697535 AGCCTCTCCCATCACAGGCCTGG + Intronic
999263189 5:150250196-150250218 GTCCTCACCCTCCACAGTCCTGG - Intronic
999289421 5:150413939-150413961 GTCCTCTTCCCTCCCAGCACAGG - Intergenic
1000229151 5:159298646-159298668 ATCCCCTCCCATCACAGGCCAGG - Intergenic
1000516035 5:162237044-162237066 AGCCCCTCCCATCACAGGACTGG - Intergenic
1001473442 5:172032103-172032125 AGCCCCTCCCATCACAGTACTGG - Intergenic
1003401802 6:5796596-5796618 AGCCTCTCCCATCACAGGCCTGG - Intergenic
1003758759 6:9151109-9151131 GACCTCTTCCATCACAGAAAGGG + Intergenic
1004830891 6:19475555-19475577 AGCCTCTCCCATCACAGACCTGG - Intergenic
1005589337 6:27309167-27309189 GTCCTCTCCCAACAGAGCCCTGG + Exonic
1005701807 6:28409139-28409161 TTCCACACCCATCACATTACAGG + Intergenic
1006344107 6:33466230-33466252 AGCCCCTCCCATCACAGTCCTGG + Intergenic
1006933782 6:37703487-37703509 GTCTTCCCCCATCAGACTACGGG - Intergenic
1009538722 6:64924384-64924406 ATCCCCTCCCATCACAGCCCTGG - Intronic
1009792336 6:68419858-68419880 GGCCCCTCCCATCACAGGCCTGG + Intergenic
1011218930 6:85033785-85033807 AGCCTCTCCCATCACAGGCCTGG - Intergenic
1011321944 6:86105037-86105059 GTCCTCTCTCGTCACAGGGCTGG - Intergenic
1012161372 6:95889000-95889022 CACCACTCCCATCACAGTCCTGG - Intergenic
1013086595 6:106863003-106863025 GGCCCCTCCCATCACAGGCCTGG + Intergenic
1013503082 6:110771519-110771541 AGCCTCTCCCATCACAGGCCTGG - Intronic
1014247767 6:119085006-119085028 AACCTCTCCCATCACAGGCCTGG - Intronic
1014691637 6:124570396-124570418 AACCCCTCCCATCACAGTCCTGG + Intronic
1014771748 6:125465457-125465479 AGCCTCTCCCATCACAGGCCTGG + Intergenic
1015658872 6:135550543-135550565 GTCATCTCCAATCACAATTCTGG + Intergenic
1015853033 6:137593863-137593885 AGCCCCTCCCATCACAGGACTGG - Intergenic
1018201251 6:161397769-161397791 GACCTCTCCATTCTCAGTACTGG - Intronic
1018437668 6:163777437-163777459 TGCCGCTCCCATAACAGTACAGG + Intergenic
1019832757 7:3349509-3349531 GTCCTCTGCCCTCACAGGGCTGG - Intronic
1020455939 7:8374049-8374071 AGCCCCTCCCATCACAGGACTGG + Intergenic
1023984225 7:45085808-45085830 CTCCTCTCCCATCACAATCCGGG + Exonic
1031396966 7:121285303-121285325 AGCCCCTCCCATCACAGGACTGG - Intronic
1031435654 7:121728900-121728922 AACCTCTCCCATCACAGGCCTGG - Intergenic
1034751284 7:153571366-153571388 AGCCTCTCCCATCACAGGCCTGG + Intergenic
1034821523 7:154220818-154220840 GTCCTCTTCCTGCACAGTACAGG + Intronic
1035329459 7:158086694-158086716 GTCCTCTCCCACCTGAGCACAGG + Intronic
1036518437 8:9468088-9468110 GGCCCCTCCCATCACAGACCTGG + Intergenic
1037979161 8:23238255-23238277 AGCCTCTCCCATCACAGACCTGG - Intergenic
1038035652 8:23683768-23683790 GTCCAGTCCAGTCACAGTACCGG - Intergenic
1041430623 8:57777542-57777564 AGCCCCTCCCATCACAGGACTGG + Intergenic
1042990024 8:74628946-74628968 GCTCTCTCCCATCAGACTACTGG - Intronic
1044188396 8:89283683-89283705 AGCCTCTCCCATCACAGGACTGG + Intergenic
1044220488 8:89663683-89663705 AGCCTCTCCCATCACAGGCCTGG - Intergenic
1046311291 8:112440899-112440921 AGCCTCTCCCATCACAGGCCTGG - Intronic
1046492160 8:114967553-114967575 AGCCACTCCCATCACAGTTCTGG + Intergenic
1047500164 8:125434068-125434090 TTCCTCTCCCATCCCAGTCCAGG + Intronic
1049558393 8:143295268-143295290 GTCCCCTCCCCTCCCAGGACTGG + Intronic
1050909905 9:11055637-11055659 AGCCTCTCCCATCACAGATCAGG + Intergenic
1051984293 9:23063911-23063933 AGCCTCTCCCATCACAGGCCTGG - Intergenic
1052625043 9:30963258-30963280 ATCCCCTCCCATCACAGGCCTGG - Intergenic
1052637314 9:31121725-31121747 AGCCTCTCCCATCACAGGCCAGG - Intergenic
1053571902 9:39318604-39318626 AGCCTCTCCCATCACAGGCCTGG + Intergenic
1054093456 9:60877315-60877337 AGCCTCTCCCATCACAGGCCTGG + Intergenic
1054114939 9:61153235-61153257 AGCCTCTCCCATCACAGGCCTGG + Intergenic
1054125243 9:61300407-61300429 AGCCTCTCCCATCACAGGCCTGG - Intergenic
1054592817 9:67029299-67029321 AGCCTCTCCCATCACAGGCCTGG - Intergenic
1055920529 9:81455427-81455449 GCCCTCTCCCATCCCAGGGCAGG - Intergenic
1055985833 9:82056120-82056142 GTGCTGTCCCATCTCAGGACTGG + Intergenic
1056353714 9:85777309-85777331 GACCTCTTCCATCACAGAAAGGG - Intergenic
1056585507 9:87924998-87925020 GTGCTGTCCCATCTCAGGACTGG - Intergenic
1056611374 9:88127945-88127967 GTGCTGTCCCATCTCAGGACTGG + Intergenic
1058283666 9:103150153-103150175 AGCCTCTCCCATCACAGGCCTGG + Intergenic
1059187016 9:112283740-112283762 ATCCCCTCCCATCACAGACCTGG + Intronic
1059836653 9:118162195-118162217 GTCTTCTCCCTTCACAATTCTGG + Intergenic
1060178933 9:121518320-121518342 GTCCTCTCCCATCATGGAAGGGG + Intergenic
1060942363 9:127550196-127550218 GTCCAGTCCCTTCACGGTACGGG - Intronic
1061529485 9:131198858-131198880 GTCTTCTCCCAACACAGGAGGGG + Exonic
1062514582 9:136926191-136926213 GGCCTCTCCCTTCACTGCACAGG - Exonic
1185633813 X:1536867-1536889 GTCTTCTCCCTTGACAGTGCAGG + Intronic
1186700246 X:12083131-12083153 ATCCCCTCCCATCACAGGCCTGG + Intergenic
1186742562 X:12533997-12534019 ATCCCCTCCCATCACAGGCCTGG + Intronic
1187615820 X:20991999-20992021 AACCTCTCCCATCACAGACCTGG - Intergenic
1188091326 X:25968625-25968647 GCACTCTCCCATCACAGGACTGG + Intergenic
1188187357 X:27131063-27131085 AGCCCCTCCCATCACAGGACCGG - Intergenic
1189404935 X:40712975-40712997 GTCATCTCCCATCACAGTCAAGG + Exonic
1189578048 X:42376004-42376026 CTCTTCTCCCATCCCAGTAGTGG - Intergenic
1189656433 X:43249616-43249638 AGCCTCTCCCATCACAGGCCTGG + Intergenic
1193250247 X:79282000-79282022 AGCCTCTCCCATCACAGCCCTGG - Intergenic
1193520108 X:82519076-82519098 TTCCCCTCCCATCACAGGCCTGG - Intergenic
1193997504 X:88384596-88384618 GCTCTCTCCCATCCCAGAACTGG + Intergenic
1194554264 X:95337833-95337855 AGCCTCTCCCATCACAGGTCTGG - Intergenic
1194876914 X:99201031-99201053 AGCCCCTCCCATCACAGTCCTGG + Intergenic
1197109607 X:122756722-122756744 AGCCTCTCCCATCACAGTCCAGG - Intergenic
1197437863 X:126455238-126455260 GCCCTCTCCCAACCCAGCACTGG + Intergenic
1198021914 X:132667176-132667198 GTCCTCTCCCATCAGTTTTCAGG - Intronic
1198566011 X:137906524-137906546 AGCCCCTCCCATCACAGGACTGG + Intergenic
1199346544 X:146747160-146747182 ATCCCCTCCCATCACAGGCCTGG - Intergenic
1199373729 X:147083224-147083246 AACCCCTCCCATCACAGGACTGG + Intergenic
1199929823 X:152506758-152506780 AGCCTCTCCCATCACAGGTCTGG - Intergenic
1200250700 X:154552362-154552384 CTCCTTTCCCTTCCCAGTACTGG - Intronic
1201564225 Y:15348753-15348775 GTCATCTCCCAGCACAGTCTGGG + Intergenic