ID: 902882227

View in Genome Browser
Species Human (GRCh38)
Location 1:19379970-19379992
Sequence CACATCACAATGATGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902882227_902882230 -8 Left 902882227 1:19379970-19379992 CCTGACCACATCATTGTGATGTG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 902882230 1:19379985-19380007 GTGATGTGGAATGCATGTTAAGG 0: 1
1: 0
2: 0
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902882227 Original CRISPR CACATCACAATGATGTGGTC AGG (reversed) Intronic
902882227 1:19379970-19379992 CACATCACAATGATGTGGTCAGG - Intronic
905231469 1:36517170-36517192 CACAGCAGAATGGAGTGGTCAGG - Intergenic
905278005 1:36831440-36831462 CACATACCAAAGATGTGGGCAGG - Intronic
906718529 1:47988426-47988448 CACAACACAGTGAGGTGCTCTGG + Intronic
911060321 1:93741887-93741909 ATCTTCACAATGATGTGGTAAGG + Intronic
912688296 1:111784556-111784578 CAGCTCCCAATTATGTGGTCTGG + Intronic
916271132 1:162942813-162942835 CACATAACAATTAAGTGGTAGGG + Intergenic
916317441 1:163465535-163465557 CACAGAACAATGATGTGGAATGG + Intergenic
923846778 1:237742621-237742643 CTCATCTCAGCGATGTGGTCTGG + Intronic
1063172003 10:3517452-3517474 AAGATCAAGATGATGTGGTCGGG - Intergenic
1063192604 10:3711186-3711208 CACATCACATTCATGTGTTATGG - Intergenic
1063213956 10:3907239-3907261 CACATGACAATTATGTTTTCAGG - Intergenic
1066811101 10:39336518-39336540 CACATCACAAAGATGTTTCCAGG + Intergenic
1067088060 10:43253195-43253217 CACATCAGGATGAGGTGGTGGGG - Intronic
1070662776 10:78319570-78319592 CATTTCACAATGATGTGCTGGGG - Intergenic
1076916797 10:133426779-133426801 CAAATCACCATGATCAGGTCAGG + Intergenic
1076936900 10:133571579-133571601 CAAATCACCATGATCAGGTCAGG + Intergenic
1077980032 11:7290910-7290932 CATATAACAAAGATATGGTCAGG + Intronic
1078525254 11:12096027-12096049 TACATCACAGTGATGTTGTCAGG - Intronic
1079621218 11:22557035-22557057 AAAATCATAATGATGTGATCTGG + Intergenic
1086416063 11:86589924-86589946 CACATCACAGTGATGGGGTGTGG + Intronic
1088013154 11:105027835-105027857 GAGATCACTATGATGTGGTTGGG + Intronic
1088201570 11:107341221-107341243 CACATCACAATGTTGTGCTAAGG - Intronic
1093278454 12:17159242-17159264 CACATCAAAATGATGAGATGAGG + Intergenic
1097745252 12:63294553-63294575 TATATCACAACTATGTGGTCTGG - Intergenic
1099498101 12:83377612-83377634 CACATGACAATTATGTGTTTTGG + Intergenic
1104542199 12:129676197-129676219 CACATCAAGATGATGGGGGCAGG + Intronic
1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG + Intergenic
1106149014 13:27079920-27079942 CACATTACAATGAGGGGGTCAGG + Intronic
1107199171 13:37693029-37693051 TACATCACAAAAATGTTGTCAGG - Intronic
1111249437 13:85584396-85584418 CACATTACAATGAGTTGTTCTGG - Intergenic
1111895130 13:94132435-94132457 CAGACCACAAGGCTGTGGTCAGG - Intronic
1117562222 14:56952457-56952479 CAGATCTCTATGATGTGGGCGGG + Intergenic
1117716364 14:58585709-58585731 CACCTCACAGTTTTGTGGTCAGG - Intergenic
1121990795 14:98554919-98554941 CATATCTCAATGATGTTCTCTGG + Intergenic
1125826101 15:42677891-42677913 CACAACACCATGATGTACTCTGG - Intronic
1125829920 15:42707833-42707855 CACATCAGAATGATTTGGATGGG + Intronic
1129361304 15:75026287-75026309 CACCTACCAATGATGTGTTCTGG + Intronic
1129789150 15:78329137-78329159 CAAATCAAAATGAGGTCGTCAGG - Intergenic
1130688685 15:86061497-86061519 CAGATGACCATGATCTGGTCTGG + Intergenic
1131077050 15:89501931-89501953 CACATCAAAATGCTGTGGGCTGG - Intergenic
1134308676 16:13056705-13056727 CGCTTCACAGTGTTGTGGTCAGG + Intronic
1138062378 16:53905289-53905311 CACAACAAAATGATGAAGTCAGG - Intronic
1139678704 16:68543058-68543080 CAATTTAAAATGATGTGGTCAGG + Intronic
1141753715 16:85977149-85977171 AACATCACAAGGATGAGGTATGG - Intergenic
1145111994 17:20172108-20172130 CACTGCACAAGCATGTGGTCAGG + Intronic
1146132049 17:30286378-30286400 TAAACCACATTGATGTGGTCTGG + Intronic
1149090804 17:52776122-52776144 CACAGCAAAGTGCTGTGGTCAGG - Intergenic
1151333308 17:73423991-73424013 CACATCTCACAGACGTGGTCGGG - Exonic
1153684149 18:7528624-7528646 CACATAATAATGATGTCCTCAGG - Intergenic
1154395787 18:13987355-13987377 CAAATACCAATCATGTGGTCTGG - Intergenic
1158088822 18:53685723-53685745 CAAATTTTAATGATGTGGTCAGG - Intergenic
1158824350 18:61198669-61198691 CATATCACAATGATTTCATCAGG + Intergenic
1160226160 18:77012713-77012735 CACAGCACACTGACGTGGTGGGG + Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
934182520 2:89639176-89639198 CACAACACATAGATGGGGTCAGG + Intergenic
934400559 2:93219600-93219622 AACATCACAAAGATGTTGTCTGG - Intergenic
941176324 2:162201540-162201562 CACATAACAAGGAAGTGGCCGGG - Intronic
943661854 2:190567457-190567479 CACATCTCAATGATGTGCCTTGG - Intergenic
946577125 2:221087599-221087621 CACCACTCAATGATATGGTCTGG - Intergenic
947023346 2:225708910-225708932 GTCATCACAAAGATGAGGTCAGG + Intergenic
947901889 2:233727946-233727968 CACCTCAGGATGATGTGGGCAGG - Intronic
947995815 2:234526215-234526237 CAAATCACAAGGATGAGGTGTGG - Intergenic
948068435 2:235100372-235100394 CACATCACAAGTTAGTGGTCTGG + Intergenic
948545321 2:238724076-238724098 AACATCAGAATGATATGGTTTGG - Intergenic
1169789043 20:9390168-9390190 CACATTAAAATGATTTGGTTTGG - Intronic
1173070687 20:39761941-39761963 CATATCCCAAGGAAGTGGTCAGG + Intergenic
1173942159 20:46920753-46920775 CACATCTCAAGGATGTGTCCTGG + Intronic
1175610895 20:60350386-60350408 CACACCAGAAGGATGTGCTCAGG - Intergenic
1176204985 20:63883412-63883434 CTCATCACCATGCTGTAGTCAGG - Intronic
1176222315 20:63975468-63975490 CCCATCACAGTGCTGGGGTCTGG + Exonic
1178472160 21:32903605-32903627 CCCTTTACAATGATGTGGGCAGG + Intergenic
1179587606 21:42383579-42383601 CACACCACAAGGGTGGGGTCTGG - Intronic
1184094624 22:42309824-42309846 CACCTCACAGTGTTGTGGTGAGG + Intronic
1184458372 22:44624067-44624089 GAGATCACAATGGAGTGGTCTGG + Intergenic
1185032574 22:48452230-48452252 CACATCAGAATCATGTGCTGTGG - Intergenic
951677428 3:25258044-25258066 GACAACACAATGATGAAGTCAGG - Intronic
955037555 3:55283606-55283628 CTAATCACAATCATGTGGTGTGG + Intergenic
955575010 3:60351636-60351658 AACACCACCATGATGTGGTGAGG + Intronic
958056208 3:88415686-88415708 CACATACCAATGAGGTGTTCTGG + Intergenic
958129995 3:89406223-89406245 CTCCTCAAAATGTTGTGGTCTGG + Intronic
959584831 3:108016182-108016204 CACAGCACAATCAAGTGGTGGGG - Intergenic
961426544 3:126852784-126852806 CCCATGACAGTGATGTGTTCTGG - Intronic
963716554 3:148810676-148810698 GATATCACAATGATATGGTTTGG + Intronic
965616375 3:170596951-170596973 CACATGACATTAATGGGGTCAGG - Intronic
966451103 3:180062958-180062980 AACATCACAATGGTGTGCTTTGG + Intergenic
967510573 3:190306519-190306541 CACCTCACAGTGATGTTGTGGGG - Exonic
968704243 4:2070644-2070666 GTCATCACAATGAATTGGTCAGG - Intergenic
968955607 4:3717350-3717372 CCCATCACAATGACATGGTGGGG - Intergenic
969874925 4:10129220-10129242 CACAGCACAATGATATAGTCTGG + Intergenic
970322908 4:14893099-14893121 CACCTCACAAAGTTGTGGTGAGG + Intergenic
972165076 4:36274093-36274115 AATATCACAAAAATGTGGTCAGG - Intergenic
975954046 4:79814793-79814815 TACCTCACAAAGATGTGGTAAGG - Intergenic
976665229 4:87583496-87583518 CCCCTCACAGGGATGTGGTCAGG - Intergenic
977915024 4:102582386-102582408 TACATCACAAGGTTGTGGTGAGG + Intronic
981137949 4:141234844-141234866 CACCTATCAATGATGGGGTCTGG - Intergenic
984126152 4:175813309-175813331 CAAATCACAATGCTGCAGTCTGG + Intronic
985336414 4:188900757-188900779 AACATCACAATGATCTTGTCAGG - Intergenic
985574730 5:668796-668818 CACATCACAGCACTGTGGTCTGG - Intronic
986938015 5:12916160-12916182 CACAGCACAATGATGTAGCTGGG + Intergenic
992596782 5:78355280-78355302 CACACCACAGTGGTGTGGACAGG + Intergenic
994354077 5:98775151-98775173 CACTTCACAACGTTCTGGTCTGG + Intronic
996820646 5:127623078-127623100 CACAACACAATGAGGAGGCCAGG + Intergenic
996876974 5:128250783-128250805 CACATCACTGTGCTCTGGTCTGG + Intergenic
997103346 5:130992646-130992668 CACATAACAATAGTGTGCTCTGG + Intergenic
998380655 5:141722889-141722911 CTCACCACAATGATGGGCTCAGG - Intergenic
1000297507 5:159924971-159924993 CACTTCACAATCCTGTGGACAGG - Intronic
1000720856 5:164704755-164704777 CACATCACTGTACTGTGGTCTGG + Intergenic
1011982912 6:93406631-93406653 CACATCTTAGTGATGTGGTGAGG + Intronic
1013068705 6:106708716-106708738 AATATCACAATGATGTGCTTTGG + Intergenic
1018526102 6:164711010-164711032 CACATCACAGTGATACGGACAGG - Intergenic
1023230055 7:38018324-38018346 CAGATCACAATGATCAGCTCTGG - Intronic
1027441162 7:78220390-78220412 CACATAACAATGAAGTGTCCTGG - Intronic
1031529419 7:122858095-122858117 CCCATCAGAAGGATGTGGGCGGG - Intronic
1033368047 7:140686049-140686071 CACACCTCACTGATGTGGACAGG + Intronic
1037684434 8:21126623-21126645 TTCATGACAATGATGTGGTGAGG + Intergenic
1038324878 8:26565472-26565494 CACATCTTGATGATGTGGTTAGG + Intronic
1038969756 8:32619630-32619652 CACCTCACAATGAATTGGTTAGG - Intronic
1040483587 8:47849727-47849749 CAGAGCACAGTGATGTGGACTGG - Intronic
1040722442 8:50342345-50342367 CAAAACACAATGATGATGTCAGG - Intronic
1041090795 8:54299457-54299479 CACTCCACAATGATGTAGCCAGG + Intergenic
1041629732 8:60073230-60073252 CAGATCATAATTATCTGGTCTGG + Intergenic
1042393671 8:68265675-68265697 CCCATCACTATGTTGTGCTCTGG + Intergenic
1042432948 8:68728792-68728814 CAAAACACAATGATATGGTTTGG - Intronic
1044830572 8:96243926-96243948 AACTTGACAATGATGTGGTGGGG + Exonic
1045051214 8:98327619-98327641 CACAACACAGAGATGTGGTGGGG - Intergenic
1050288235 9:4126392-4126414 CCCTTCACAAGGATGTAGTCTGG + Intronic
1051173234 9:14340702-14340724 CAGCTCAGAATGATGTGGTTTGG + Intronic
1056724206 9:89098397-89098419 CACAGCACAATGATCAAGTCAGG - Intronic
1059056316 9:110984683-110984705 CAAATCAAAATAATGTGCTCAGG + Intronic
1186807865 X:13158168-13158190 CAAATTACAATGATCTGGTTTGG + Intergenic
1190010185 X:46777685-46777707 CTCAACACAATGATATGATCTGG - Intergenic
1198514764 X:137394779-137394801 CACAGCAAAATGATATGGTTTGG - Intergenic