ID: 902882566

View in Genome Browser
Species Human (GRCh38)
Location 1:19382430-19382452
Sequence CAGGTTTCAAACGGTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902882561_902882566 7 Left 902882561 1:19382400-19382422 CCCTCCGAGAAGGCTTTTTGTTT 0: 1
1: 0
2: 1
3: 21
4: 255
Right 902882566 1:19382430-19382452 CAGGTTTCAAACGGTGCTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 99
902882562_902882566 6 Left 902882562 1:19382401-19382423 CCTCCGAGAAGGCTTTTTGTTTC 0: 1
1: 0
2: 1
3: 9
4: 173
Right 902882566 1:19382430-19382452 CAGGTTTCAAACGGTGCTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 99
902882563_902882566 3 Left 902882563 1:19382404-19382426 CCGAGAAGGCTTTTTGTTTCAGC 0: 1
1: 0
2: 2
3: 20
4: 218
Right 902882566 1:19382430-19382452 CAGGTTTCAAACGGTGCTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902882566 Original CRISPR CAGGTTTCAAACGGTGCTGC TGG Intronic
900610925 1:3544364-3544386 CAGGGTGCAGACGGTGCTGGGGG - Intronic
900865772 1:5267690-5267712 GAGGTTTAAAACGGGGATGCAGG - Intergenic
902334997 1:15749582-15749604 CACGGTTCAAAGGGTGCTGCTGG - Intergenic
902882566 1:19382430-19382452 CAGGTTTCAAACGGTGCTGCTGG + Intronic
903769795 1:25756694-25756716 CAGGATTCAAACAGGTCTGCTGG - Intronic
906005474 1:42465663-42465685 CAGGTTTAAAACTGTGCTAGAGG - Intronic
907749534 1:57249044-57249066 AAGGTTTCACACAGTGCTTCAGG + Intronic
922359858 1:224811516-224811538 CAGGTTTCAATCAGCACTGCTGG + Intergenic
924932789 1:248745804-248745826 CAGGTCTCAAATTGTGGTGCAGG + Intronic
1063518690 10:6721422-6721444 CAGGCTGCAAAGGGTCCTGCTGG - Intergenic
1065766276 10:29033071-29033093 CAGGTTTCTAACGGTGCCCTTGG - Intergenic
1068033930 10:51736700-51736722 CTGGTTTCAAGCGGTCCTCCTGG + Intronic
1075718672 10:124572185-124572207 CAGGTTTCAAAAGGTCCCTCTGG + Intronic
1076885117 10:133258670-133258692 CAGGCTGCAAGCGGTGCTCCTGG - Intergenic
1079199746 11:18365916-18365938 CAGGTTTCCAGAGTTGCTGCAGG - Exonic
1086090122 11:82997079-82997101 CAGCTTTCAAAGGGTGCATCAGG + Intronic
1087377618 11:97364904-97364926 CTGTTTTCAAATTGTGCTGCTGG - Intergenic
1099661935 12:85575344-85575366 CAGTATTCAAATGGTGCTGCTGG + Intergenic
1105811496 13:24000323-24000345 AAGGTTTCAAAGGGAGCAGCAGG + Intronic
1106013788 13:25849053-25849075 CTGCTTTGAAACAGTGCTGCTGG + Intronic
1110208061 13:72941081-72941103 CAGCTTTCAAGCTGTGGTGCTGG - Intronic
1112210821 13:97375375-97375397 CAGCTGGCAAACGTTGCTGCTGG + Intronic
1117065574 14:52010496-52010518 CTGGTTTCTAAATGTGCTGCTGG + Exonic
1120905448 14:89616937-89616959 CAGGTTTCAACAGATGCTGTGGG + Intronic
1122172872 14:99891156-99891178 CAGTTTTTAAAGGGTGCTGTGGG - Intronic
1122307924 14:100777196-100777218 CAGTGTTCAAACGGTGATCCCGG + Intergenic
1122705081 14:103615835-103615857 CAGGTTTTAAAAGGTGATACAGG - Intronic
1126165199 15:45649058-45649080 CAGAGTTCAAACAGAGCTGCTGG - Intronic
1127187319 15:56493101-56493123 TAGGGTTCAAACTGTGCTCCTGG - Intergenic
1127784383 15:62343092-62343114 CTGGTTGCAAAAGGTGCTGAAGG + Intergenic
1129329602 15:74820326-74820348 CAGGTCTCAAAAGGTGCAGGGGG + Intronic
1130310629 15:82750678-82750700 CAGGTTTCAGAGGATGCGGCTGG + Intergenic
1134434826 16:14246927-14246949 CAGGTTTGACAGAGTGCTGCTGG - Exonic
1136924319 16:34357838-34357860 CCGGTTCCAAACAGTGCTGTTGG - Intergenic
1136980254 16:35053968-35053990 CCGGTTCCAAACAGTGCTGTTGG + Intergenic
1137694762 16:50454169-50454191 CAGGTTTGACCAGGTGCTGCTGG - Intergenic
1142177926 16:88653389-88653411 CAGGTTTCTGAAGGGGCTGCAGG - Exonic
1147936463 17:44014240-44014262 CAGGCTTCACACTGTGCAGCTGG + Intronic
1148997515 17:51723984-51724006 CTGGCTCCCAACGGTGCTGCAGG + Intronic
1151156305 17:72125233-72125255 GAGCCTTAAAACGGTGCTGCTGG + Exonic
1159461357 18:68725466-68725488 CAGGCTTCTAACGTTGCTGTTGG + Intronic
927141093 2:20131243-20131265 CAGGCCTCACACGGAGCTGCGGG + Intergenic
931430337 2:62203891-62203913 CAGGTTTCATGCGATTCTGCAGG - Intronic
933906919 2:86903235-86903257 AAGGTTGCTAACAGTGCTGCTGG + Intergenic
934024558 2:87990417-87990439 AAGGTTGCTAACAGTGCTGCTGG - Intergenic
935932454 2:108142482-108142504 CAGACTTCAAACTGTACTGCAGG + Intergenic
936365248 2:111848446-111848468 AAGGTTGCTAACAGTGCTGCTGG - Intronic
937789132 2:125939760-125939782 CAATTTTCAGACGGTGGTGCAGG - Intergenic
938416459 2:131106777-131106799 CAGGAATCAAACTGTGTTGCAGG + Intronic
942325445 2:174772534-174772556 CATGGTTCAAACTGTGCTCCAGG + Intergenic
943524424 2:188998671-188998693 CAGGGTCCAAAGGGTGATGCCGG + Exonic
947739370 2:232478182-232478204 CAGGTGACACACAGTGCTGCTGG + Intergenic
948115590 2:235493047-235493069 CAGGCTTTAAACGGGGATGCCGG + Intergenic
948836579 2:240628915-240628937 CAGGTGTGAGACGGAGCTGCTGG - Intronic
1170443490 20:16401725-16401747 CAGGTTTAAACAGCTGCTGCAGG - Intronic
1170714124 20:18817471-18817493 CAGGTGTAAAATGGTGATGCTGG - Intronic
1173690097 20:44954004-44954026 TCGGTTTCACATGGTGCTGCAGG - Intronic
1174051733 20:47771741-47771763 CAGGCTTCAAATGGGGGTGCTGG + Intronic
1175495654 20:59412377-59412399 CAGGTTACCAAGGGTGCTGTAGG + Intergenic
1175676686 20:60952193-60952215 CAGGTTTGAAATGCAGCTGCAGG - Intergenic
1177393582 21:20506889-20506911 CAGGTTTCATACTGGGCTGTGGG + Intergenic
1178944489 21:36935263-36935285 CAGGTTTCCTGCAGTGCTGCAGG - Intronic
1181844328 22:25694518-25694540 CAGGTTTCAAAAGCTGCAGAAGG - Intronic
1183947300 22:41333835-41333857 CTGGTTTCAAACTGTGATGAGGG + Intronic
1185111399 22:48902155-48902177 CAGGTGTGACACGGAGCTGCGGG - Intergenic
1185111512 22:48902613-48902635 CAGGTGTGACACGGAGCTGCGGG + Intergenic
1185249952 22:49795980-49796002 CAGGCTCCAAACAGTGCTGCTGG - Intronic
950488793 3:13289683-13289705 AAGGTTGCAAATGGTGCAGCCGG + Intergenic
955330534 3:58043559-58043581 CAAGTTTCAAACGGGTCTTCAGG + Intronic
956748558 3:72328840-72328862 CAGTTTTCAAAGGTTGCTCCTGG + Intergenic
969184935 4:5468014-5468036 CAGTCTCCAAACAGTGCTGCAGG - Exonic
970548575 4:17155603-17155625 CAGGATTCAGAGGATGCTGCTGG + Intergenic
974145461 4:57942373-57942395 CAGTTTTCAAACAGTGCTTTGGG - Intergenic
982344182 4:154338061-154338083 CAGGTTTCATCTGGTGCAGCTGG + Intronic
990323243 5:54649454-54649476 AAGGTTTCCCACGGTGCAGCGGG + Intergenic
992585256 5:78232281-78232303 CAGGTTTAAAACAGTTCTGGTGG - Intronic
996481202 5:123976650-123976672 TGGGTATCAAAAGGTGCTGCAGG - Intergenic
1000165133 5:158640905-158640927 CAGGATTCAAACAGATCTGCAGG - Intergenic
1002553626 5:180017038-180017060 CAGGATTCAATCGGGGCTGTCGG + Intronic
1004590364 6:17045522-17045544 CAGGTTTCTAAGTGTGCTCCAGG - Intergenic
1006983214 6:38162069-38162091 CAGGTTCCAGAGGGTGTTGCTGG + Intergenic
1024392963 7:48836115-48836137 AAGGTTTCAACAGGGGCTGCAGG - Intergenic
1026285357 7:68957884-68957906 CAGGTAACAAATGGTGCTGGCGG + Intergenic
1026499784 7:70934667-70934689 CAGCTTTGCAATGGTGCTGCAGG - Intergenic
1030699599 7:112623222-112623244 CAGGTTGTAAAGGGTGATGCTGG + Intergenic
1033357332 7:140610841-140610863 CAGGATTCTAAAGGAGCTGCCGG - Intronic
1034256226 7:149725992-149726014 CAGGTCCCAGTCGGTGCTGCTGG - Exonic
1035845600 8:2861214-2861236 CATTTTTCAAACAATGCTGCAGG + Intergenic
1035980685 8:4367463-4367485 CCGATTTCAAACTGTACTGCAGG - Intronic
1037393367 8:18417574-18417596 GAGATTTCAAACAGTGCTGAAGG - Intergenic
1039614144 8:38941555-38941577 CAGGTTTCATACAGTTTTGCAGG + Intronic
1040435803 8:47390149-47390171 CAGCTTTCAAACACTGCTGATGG + Intronic
1053369823 9:37551410-37551432 TAGATTTCAAAGGATGCTGCAGG - Intronic
1056045740 9:82713814-82713836 CAGGTTTCACACCATCCTGCAGG - Intergenic
1059150281 9:111943349-111943371 CAGGATACAAATGGTGATGCTGG - Intergenic
1060152759 9:121299354-121299376 CAGCTTGTAAATGGTGCTGCCGG - Intronic
1203485841 Un_GL000224v1:53744-53766 CAAGATTCAAACTCTGCTGCAGG + Intergenic
1185569680 X:1123981-1124003 CAGGTTGTAATCAGTGCTGCTGG - Intergenic
1187916206 X:24154487-24154509 CAGTTTTCAAAGTGTGCTGCAGG + Intronic
1189202919 X:39213158-39213180 CAGGTTCCTACAGGTGCTGCTGG - Intergenic
1194801122 X:98274509-98274531 CAGGTTTTACATGGTGATGCAGG - Intergenic
1195743896 X:108094856-108094878 CAGGGTTCAAAAACTGCTGCTGG + Intronic
1195758767 X:108224438-108224460 GAGGTTTCAAACTGAGCTGCTGG - Intronic
1198240690 X:134782914-134782936 CAGCTTTTAAAAGTTGCTGCTGG + Intronic
1202025194 Y:20514509-20514531 CATGTTTTATACTGTGCTGCTGG - Intergenic