ID: 902884237

View in Genome Browser
Species Human (GRCh38)
Location 1:19393435-19393457
Sequence CCTATTCGGAGGCAGGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902884232_902884237 1 Left 902884232 1:19393411-19393433 CCACGTGAGCTAGGGTATGGCGC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 902884237 1:19393435-19393457 CCTATTCGGAGGCAGGATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 66
902884228_902884237 15 Left 902884228 1:19393397-19393419 CCTTAGGATAATAGCCACGTGAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 902884237 1:19393435-19393457 CCTATTCGGAGGCAGGATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902884237 Original CRISPR CCTATTCGGAGGCAGGATTG AGG Intronic
900420048 1:2552360-2552382 CCTTTTCGGAGGCAGGTTCCAGG - Intergenic
902813358 1:18902204-18902226 CCTACTCGGTCGCAGGATTCGGG + Intronic
902884237 1:19393435-19393457 CCTATTCGGAGGCAGGATTGAGG + Intronic
903816506 1:26067831-26067853 CCTGTTCAGAGGCAGGCTTAGGG + Intronic
906719037 1:47992589-47992611 TCATTTCGGAGGCAGGTTTGTGG - Intronic
908842587 1:68294457-68294479 CCTATTGAGAGCCAGGATTGCGG + Intergenic
909126468 1:71677255-71677277 CCTATCCGGAGACCAGATTGTGG - Intronic
912802094 1:112726275-112726297 TCTATCCGGAGGCAGGGATGAGG + Intronic
917928587 1:179808489-179808511 CCTTTTGGGAGGCTGGATTGAGG + Intronic
1067555801 10:47269232-47269254 CTTATGGGGAGACAGGATTGTGG - Intergenic
1070600323 10:77861791-77861813 CCTATTAGGAGGCATTGTTGTGG - Intronic
1091935102 12:4428667-4428689 CCTAGTCCGGGGCAGGGTTGAGG + Intronic
1092751721 12:11725494-11725516 CCTATTCTGAGGCTGAATTATGG + Intronic
1093189888 12:16061693-16061715 CCAATTTGGAGAGAGGATTGAGG + Intergenic
1094678741 12:32648596-32648618 TCTATTGGGATGGAGGATTGGGG - Intergenic
1096113960 12:49044304-49044326 CCTATGAGGAGGCAGAGTTGTGG + Exonic
1100135960 12:91553587-91553609 CCTATTCGGAGGAAAGAATTCGG - Intergenic
1102613025 12:114129121-114129143 CGTATTAGGAAGCAGTATTGTGG + Intergenic
1108953583 13:56121436-56121458 CCAGTTCAGAGGGAGGATTGGGG + Intergenic
1121467831 14:94127511-94127533 CCTGTTGGGAGGCAGGGGTGAGG - Intergenic
1124074981 15:26435964-26435986 ACTCTTCGGAGGGAGGAGTGTGG + Intergenic
1128820873 15:70651971-70651993 CCTTTTTGGAGGTAGGAATGGGG + Intergenic
1129047820 15:72752506-72752528 CCCATTCGGAGGCAGGCTCCAGG - Exonic
1129868494 15:78926239-78926261 CCTCTAGGGAGGCAGGACTGAGG - Intronic
1139145016 16:64312910-64312932 CTTATTAGAAGGCAGTATTGTGG - Intergenic
1141225197 16:82108362-82108384 CCTGCTGGGAGGCAGGGTTGTGG + Intergenic
1147165072 17:38588763-38588785 CCTGTGGGGAGGCAGGATGGTGG - Intronic
1148217806 17:45843243-45843265 CCTATTTGGGGGCACAATTGTGG - Intergenic
1149403150 17:56319567-56319589 CCTATACAAAGGCATGATTGAGG + Intronic
1151876616 17:76870625-76870647 CTTATCTGAAGGCAGGATTGGGG + Intronic
1157422192 18:47556428-47556450 CCTTTTCATAGGCAGAATTGTGG + Intergenic
1158388695 18:57024593-57024615 CCTATTCTCAGGCAGGAATAGGG + Intronic
1158388726 18:57024869-57024891 CCTATTCTCAGGCAGGAATAGGG + Intronic
1158741926 18:60152958-60152980 CCTATACGGAGGAAGGGTGGCGG + Intergenic
1159031106 18:63233173-63233195 GCTATTAGGAGGCAGGATTTTGG - Intronic
1162866774 19:13554053-13554075 CCTATTCAGGGGCTGGAATGAGG - Intronic
1163161406 19:15466679-15466701 GCTATTCCCAGGCATGATTGTGG + Intergenic
1164504617 19:28849378-28849400 ACTATACTGAGCCAGGATTGTGG - Intergenic
925502131 2:4516742-4516764 CCTTTTCGGAGGCAGAGTTGAGG - Intergenic
927911092 2:26900217-26900239 CCTATTAGAAGTCAGGATAGTGG - Intronic
932438664 2:71717969-71717991 CCTCTTCAGAGGCAGGAGTGTGG - Intergenic
945030093 2:205655279-205655301 ACTAATTGGAGGCAGGATTTGGG - Intergenic
1171792207 20:29537636-29537658 CCTGTTGGGAGGCGGGATGGAGG + Intergenic
1174612994 20:51814425-51814447 GCTATTCACAGGCACGATTGTGG - Intergenic
1176015565 20:62929429-62929451 CCTCTGCCGAGGCAGGATGGAGG + Intronic
1178742956 21:35220222-35220244 CCTGTTGGGAGGCAGGGTGGGGG + Intronic
1183632397 22:39041152-39041174 CCTATTCAGAAGCAGCAGTGGGG - Intronic
953588440 3:44227759-44227781 CCTTTGAAGAGGCAGGATTGTGG + Intergenic
954856435 3:53647751-53647773 CCTTTTTAGTGGCAGGATTGAGG + Intronic
962087763 3:132209802-132209824 TCTATTCAGAGGCAAGATTATGG + Intronic
974051909 4:56949677-56949699 CCAAGTCGGAGGCTGGATTAAGG - Intergenic
979082950 4:116365911-116365933 CCTATGCTGAAGCAGGTTTGAGG - Intergenic
980237990 4:130133042-130133064 CATATTTGGAGGGATGATTGAGG + Intergenic
980525939 4:133991467-133991489 CATATTCCAAGGCAGGCTTGAGG + Intergenic
987270751 5:16305962-16305984 ACTAAAGGGAGGCAGGATTGGGG + Intergenic
990233304 5:53739129-53739151 GCTATTGGCAGGCAGGGTTGAGG + Intergenic
999592470 5:153163496-153163518 CATATAAGGAGGCAGGATTGAGG - Intergenic
1002045904 5:176541769-176541791 CCTCTTTGGAGGGAGGTTTGAGG - Intergenic
1019715695 7:2538287-2538309 CCTCTGCGGAGGCAGTGTTGGGG + Exonic
1032425355 7:131818413-131818435 CCTTTCCAGAGGCAGGTTTGAGG - Intergenic
1039923226 8:41907365-41907387 CCAATTCGGAGGATGGCTTGAGG + Intergenic
1043395563 8:79832318-79832340 CCTAGTCAGTGGCAGGTTTGGGG - Intergenic
1044318981 8:90780956-90780978 ACTAATATGAGGCAGGATTGGGG - Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1045392295 8:101727523-101727545 CCTATTCACAGGCAAGATTGTGG + Intronic
1052276077 9:26678196-26678218 ACTATTCTGAGGCAGGTTTTAGG + Intergenic
1052960460 9:34291887-34291909 CCAAATGGGAGGCAGGTTTGCGG - Intronic
1053793746 9:41705946-41705968 CCTGTTGGGAGGCGGGATGGAGG - Intergenic
1054151429 9:61608884-61608906 CCTGTTGGGAGGCAGGATGGAGG + Intergenic
1054182155 9:61917959-61917981 CCTGTTGGGAGGCGGGATGGAGG - Intergenic
1062514039 9:136923159-136923181 CCTCTTCTGAGGCAGGCTTGGGG + Intronic
1185938877 X:4290801-4290823 CCTATCCCGAGGAAGGATGGAGG - Intergenic
1190276811 X:48904456-48904478 CCTCTTTGGAGGCAGGGTTGGGG - Exonic
1195387037 X:104323296-104323318 CCTAAGCTGAGGCAGGATTCTGG + Intergenic
1199351254 X:146803162-146803184 CCTATTTGGAGGCAAGGTGGTGG + Intergenic
1199352653 X:146821331-146821353 CCTATTTGGAGGCAAGGTGGTGG - Intergenic
1201722325 Y:17113194-17113216 CCTATCCTGAGGAAGGATGGAGG - Intergenic