ID: 902888425

View in Genome Browser
Species Human (GRCh38)
Location 1:19423808-19423830
Sequence GTGGCCCCCCAGCTACTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 366}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902888425_902888432 14 Left 902888425 1:19423808-19423830 CCTCCAAGTAGCTGGGGGGCCAC 0: 1
1: 0
2: 0
3: 28
4: 366
Right 902888432 1:19423845-19423867 TTTTTGTAGTTTGGTAGAGATGG 0: 3
1: 253
2: 7301
3: 7604
4: 13894
902888425_902888433 15 Left 902888425 1:19423808-19423830 CCTCCAAGTAGCTGGGGGGCCAC 0: 1
1: 0
2: 0
3: 28
4: 366
Right 902888433 1:19423846-19423868 TTTTGTAGTTTGGTAGAGATGGG 0: 2
1: 175
2: 4345
3: 11126
4: 15719
902888425_902888434 16 Left 902888425 1:19423808-19423830 CCTCCAAGTAGCTGGGGGGCCAC 0: 1
1: 0
2: 0
3: 28
4: 366
Right 902888434 1:19423847-19423869 TTTGTAGTTTGGTAGAGATGGGG 0: 3
1: 165
2: 4096
3: 8365
4: 16608
902888425_902888431 5 Left 902888425 1:19423808-19423830 CCTCCAAGTAGCTGGGGGGCCAC 0: 1
1: 0
2: 0
3: 28
4: 366
Right 902888431 1:19423836-19423858 CTGGCTAATTTTTTGTAGTTTGG 0: 2
1: 60
2: 118
3: 288
4: 970

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902888425 Original CRISPR GTGGCCCCCCAGCTACTTGG AGG (reversed) Intronic
900127391 1:1074585-1074607 GTGGCCCCTGAGCTCCTGGGTGG + Intergenic
900781538 1:4621534-4621556 CTGTAGCCCCAGCTACTTGGGGG - Intergenic
901604167 1:10446277-10446299 CTGTGGCCCCAGCTACTTGGGGG - Intronic
901889157 1:12247288-12247310 GTGTCGTCCCAGCTACTTGGTGG + Intronic
902662998 1:17918392-17918414 CTGGGCACCCAGCTACTGGGAGG - Intergenic
902810826 1:18886837-18886859 GGGGCCCCACAGCTAGTAGGTGG - Intronic
902888425 1:19423808-19423830 GTGGCCCCCCAGCTACTTGGAGG - Intronic
903894305 1:26593382-26593404 GTGGTCCCCCAGCTCCCAGGAGG + Intergenic
904232741 1:29090139-29090161 CTGTAACCCCAGCTACTTGGAGG + Intronic
907034153 1:51201349-51201371 CTGTCATCCCAGCTACTTGGGGG + Intergenic
907081909 1:51631417-51631439 CTGTGGCCCCAGCTACTTGGAGG + Intronic
907710973 1:56881122-56881144 GTGGCCCATAAGCTTCTTGGAGG + Intronic
909522446 1:76585261-76585283 CTGTCATCCCAGCTACTTGGGGG + Intronic
910258953 1:85277408-85277430 CTGGACTCCCAGCTGCTTGGTGG - Intergenic
910630361 1:89347276-89347298 GTGATCAGCCAGCTACTTGGTGG + Intergenic
910916226 1:92292531-92292553 CTGTAGCCCCAGCTACTTGGGGG - Intronic
911567748 1:99483509-99483531 CTGTACTCCCAGCTACTTGGAGG + Intergenic
911577256 1:99593216-99593238 CTGTAGCCCCAGCTACTTGGGGG + Intergenic
913559302 1:120001594-120001616 GTGATCAGCCAGCTACTTGGTGG + Intronic
913638560 1:120788948-120788970 GTGATCAGCCAGCTACTTGGTGG - Intergenic
914279898 1:146161037-146161059 GTGATCAGCCAGCTACTTGGTGG + Intronic
914625704 1:149459291-149459313 GTGATCAGCCAGCTACTTGGTGG - Intergenic
915114430 1:153587278-153587300 CTGTACCCCCAGCTACTTGGGGG + Intergenic
915408419 1:155680687-155680709 CTGTTGCCCCAGCTACTTGGAGG - Intronic
915634616 1:157177543-157177565 GTGGTGCCTCAGTTACTTGGCGG + Intergenic
915928792 1:160044889-160044911 CTGTACTCCCAGCTACTTGGAGG + Intronic
916118390 1:161507239-161507261 CTGGAGTCCCAGCTACTTGGGGG - Intronic
916381013 1:164210557-164210579 GTTGCCAGCCAGCTACCTGGTGG + Intergenic
916722319 1:167493753-167493775 GAGGCCCCACAGCTAGTTAGGGG + Intronic
917462850 1:175247169-175247191 GTGGTCAGCCAGCTACCTGGTGG + Intergenic
917605442 1:176623961-176623983 CTGTAGCCCCAGCTACTTGGGGG - Intronic
919124232 1:193376955-193376977 GTGGTCAGCCAGCTACTTGGTGG - Intergenic
919328169 1:196135777-196135799 GTGGCCCCACAGCTCCTGGCTGG - Intergenic
920959683 1:210653397-210653419 CTGTGCTCCCAGCTACTTGGGGG + Intronic
922287158 1:224180645-224180667 CTGTAGCCCCAGCTACTTGGGGG - Intronic
922557429 1:226543138-226543160 TTGACCCAGCAGCTACTTGGAGG + Intergenic
923087925 1:230715342-230715364 GGGGCCCCACAGCGACTTAGAGG + Intergenic
923757628 1:236807294-236807316 CTGTAGCCCCAGCTACTTGGAGG - Intronic
924231649 1:241967025-241967047 CTGTACTCCCAGCTACTTGGGGG - Intergenic
924764955 1:247023893-247023915 CTGTCATCCCAGCTACTTGGGGG - Intergenic
924846998 1:247784132-247784154 GTGAACAGCCAGCTACTTGGTGG - Intergenic
1063008041 10:1993645-1993667 GTGGTCCCACAGCTGCATGGTGG - Intergenic
1063117040 10:3079031-3079053 GGGGCAGCCCAGCTACATGGGGG + Intronic
1064053123 10:12075299-12075321 CTGCAACCCCAGCTACTTGGAGG - Intronic
1066166880 10:32798216-32798238 GTGATCAGCCAGCTACTTGGTGG - Intronic
1067023941 10:42827390-42827412 GTGGCCCACCGGCCACTAGGTGG + Intronic
1067029426 10:42870390-42870412 GTGGCCCCCGAGCACGTTGGAGG + Intergenic
1070199177 10:74186400-74186422 CTGTAGCCCCAGCTACTTGGGGG - Intronic
1071736820 10:88310092-88310114 CTGTAGCCCCAGCTACTTGGGGG + Intronic
1072115417 10:92365884-92365906 CTGTAACCCCAGCTACTTGGGGG - Intergenic
1072363571 10:94685154-94685176 CTGTAGCCCCAGCTACTTGGGGG - Intronic
1073281411 10:102357110-102357132 GTGGCCTCCCAGTTTCTTTGTGG - Intronic
1073656536 10:105423480-105423502 GTGATCAGCCAGCTACTTGGTGG - Intergenic
1074101636 10:110358690-110358712 GTGACCACACAGCTACTAGGTGG + Intergenic
1074879258 10:117640867-117640889 CTGTCGCCCCAGCTACTTGGGGG - Intergenic
1075519409 10:123135167-123135189 GTGGCTCTCCAGCTGCGTGGGGG + Intergenic
1075694672 10:124424869-124424891 CTGTAACCCCAGCTACTTGGGGG + Intergenic
1075695225 10:124429570-124429592 CTGTAGCCCCAGCTACTTGGGGG - Intergenic
1075703712 10:124485721-124485743 CTGTAACCCCAGCTACTTGGGGG - Intronic
1075753814 10:124794559-124794581 CTGTACTCCCAGCTACTTGGTGG + Intergenic
1076185664 10:128446569-128446591 GAAGCCCCGCAGCTTCTTGGGGG - Intergenic
1076699603 10:132264591-132264613 CTGGCCCCTCAGCTCCCTGGTGG - Intronic
1076772476 10:132673826-132673848 GTGGTCAGCCAGCTACCTGGTGG - Intronic
1076927261 10:133498204-133498226 GTGGTCAGCCAGCTACCTGGTGG - Intergenic
1078310925 11:10241228-10241250 CTGTACTCCCAGCTACTTGGGGG + Intronic
1078687115 11:13543702-13543724 CTGTAGCCCCAGCTACTTGGGGG + Intergenic
1079077492 11:17393198-17393220 GTGGCCCTCCTGCGGCTTGGAGG + Intronic
1082085657 11:48047623-48047645 CTGTCGTCCCAGCTACTTGGGGG - Intronic
1083137715 11:60694653-60694675 GTGTCATCCCAGCTACTTGAAGG + Intergenic
1083243407 11:61406864-61406886 GAGGAGTCCCAGCTACTTGGGGG - Intronic
1084206914 11:67600457-67600479 TTGGCCCCTCAGCTGCTGGGAGG - Intergenic
1084581813 11:70028902-70028924 CTGTCTTCCCAGCTACTTGGAGG - Intergenic
1084832731 11:71782290-71782312 GTGTAGTCCCAGCTACTTGGAGG + Intergenic
1088097351 11:106116142-106116164 GTGATCAGCCAGCTACTTGGTGG + Intergenic
1088639421 11:111856982-111857004 CTGTAGCCCCAGCTACTTGGGGG + Intronic
1089746788 11:120623262-120623284 GTGTAGCCCCAGCTACTTGGAGG - Intronic
1090327886 11:125904585-125904607 GTGGCCCCCCGGCTCGGTGGCGG - Intronic
1090806336 11:130204687-130204709 CTGCACTCCCAGCTACTTGGGGG + Intronic
1090980257 11:131713965-131713987 GTGGCCTGCCAGCTCCTGGGAGG + Intronic
1091900399 12:4140009-4140031 CTGTGGCCCCAGCTACTTGGAGG + Intergenic
1092318127 12:7440747-7440769 CTGTAACCCCAGCTACTTGGGGG - Intronic
1093674987 12:21928095-21928117 CTGTGACCCCAGCTACTTGGGGG + Intronic
1094713033 12:32984548-32984570 GTGTAGTCCCAGCTACTTGGAGG - Intergenic
1096008077 12:48188119-48188141 TTGTCATCCCAGCTACTTGGGGG + Intergenic
1096457317 12:51798460-51798482 GTGATCAGCCAGCTACTTGGTGG - Intronic
1097218022 12:57429588-57429610 CTGTACTCCCAGCTACTTGGGGG + Intronic
1097261911 12:57725249-57725271 ATGCCCCCCCATCTCCTTGGAGG - Intronic
1098070453 12:66668803-66668825 GTGGGGTCCTAGCTACTTGGGGG + Intronic
1098745814 12:74235571-74235593 GTGACCAACCAGCTACCTGGTGG + Intergenic
1099298900 12:80867072-80867094 CTGTAACCCCAGCTACTTGGGGG - Intronic
1099401068 12:82204381-82204403 GTGATCACCCTGCTACTTGGTGG - Intergenic
1102138992 12:110598963-110598985 CTGTACTCCCAGCTACTTGGGGG + Intergenic
1102141252 12:110616958-110616980 GGGGCTCAACAGCTACTTGGTGG + Intronic
1102687166 12:114734214-114734236 GTGGCCCCAGAGCTATCTGGAGG + Intergenic
1103387369 12:120543675-120543697 CTGGAGTCCCAGCTACTTGGGGG + Intronic
1103929151 12:124440060-124440082 GTGGCCCCCCAGGCCCTGGGAGG - Intronic
1104147937 12:126053650-126053672 GTGATCAACCAGCTACTTGGTGG + Intergenic
1104514201 12:129409053-129409075 GTGTAATCCCAGCTACTTGGGGG - Intronic
1107505303 13:41027559-41027581 GTGATCCGCCAGCTACCTGGTGG + Intronic
1108379380 13:49841715-49841737 GTGGGCACCCAGCTACTCAGGGG + Intergenic
1109583179 13:64367155-64367177 GTGGTCAGCCAGCTACCTGGTGG + Intergenic
1110505527 13:76281553-76281575 CTGTCATCCCAGCTACTTGGGGG + Intergenic
1111205025 13:84995987-84996009 CTGTACTCCCAGCTACTTGGAGG - Intergenic
1111432135 13:88158789-88158811 GTGATCACCCAGCTACCTGGTGG - Intergenic
1112388544 13:98961905-98961927 GTGGCCCCAGGACTACTTGGCGG + Intronic
1113399620 13:109978985-109979007 CTGTATCCCCAGCTACTTGGGGG - Intergenic
1114473253 14:22978031-22978053 CTGGCCCTCCAGCTTCTTGGTGG - Intronic
1114758112 14:25282892-25282914 GTGATCCGCCAGCTACCTGGTGG - Intergenic
1115605999 14:35002866-35002888 CTGTAGCCCCAGCTACTTGGGGG - Intronic
1116059039 14:39897914-39897936 GTGGTCAGCCAGCTACCTGGTGG + Intergenic
1116249185 14:42458622-42458644 GTGATCATCCAGCTACTTGGTGG + Intergenic
1117701406 14:58417380-58417402 CTATACCCCCAGCTACTTGGAGG + Intronic
1118945737 14:70385477-70385499 GTAGTCCCCCAGCTACTCAGGGG - Intronic
1119292291 14:73505051-73505073 CTGTCATCCCAGCTACTTGGAGG - Intronic
1119470530 14:74895102-74895124 CTGTAGCCCCAGCTACTTGGGGG + Intronic
1121999632 14:98636168-98636190 CTGTACTCCCAGCTACTTGGTGG + Intergenic
1122549463 14:102542122-102542144 CTGGACTCCCAGCTACTCGGGGG - Intergenic
1123489400 15:20768893-20768915 CTGTAACCCCAGCTACTTGGAGG + Intergenic
1123545899 15:21337980-21338002 CTGTAACCCCAGCTACTTGGAGG + Intergenic
1125665650 15:41428132-41428154 GTGTCACCCAAGCTACATGGTGG + Intronic
1126018664 15:44377491-44377513 CTGTAACCCCAGCTACTTGGGGG - Intronic
1126816203 15:52457306-52457328 GTGTAGTCCCAGCTACTTGGGGG + Intronic
1127413654 15:58734575-58734597 CTGTCATCCCAGCTACTTGGGGG + Intronic
1127599174 15:60518119-60518141 TTGGAATCCCAGCTACTTGGGGG - Intronic
1128293694 15:66498716-66498738 CTGTAACCCCAGCTACTTGGAGG - Exonic
1128314531 15:66652359-66652381 CTGGCCTGCCAGTTACTTGGTGG - Intronic
1128477640 15:68010853-68010875 GTGTAATCCCAGCTACTTGGGGG + Intergenic
1129454917 15:75671581-75671603 GTGGCCACCAAGATAATTGGTGG - Intergenic
1129792462 15:78350447-78350469 GTTGCCCCACAGCTTCTTAGAGG + Intergenic
1129971493 15:79781229-79781251 GTGGACCCCCAGCAAACTGGAGG + Intergenic
1130562792 15:84971770-84971792 CTGGCGTCCCAGCTACTTGAGGG - Intergenic
1131523420 15:93134081-93134103 GTGTAGTCCCAGCTACTTGGCGG + Intergenic
1202954242 15_KI270727v1_random:65251-65273 CTGTAACCCCAGCTACTTGGAGG + Intergenic
1133160116 16:3905732-3905754 CTGTAGCCCCAGCTACTTGGGGG - Intergenic
1133351385 16:5102979-5103001 GTGTAGTCCCAGCTACTTGGAGG - Intergenic
1133522145 16:6568893-6568915 CTGTACTCCCAGCTACTTGGGGG - Intronic
1134129550 16:11639895-11639917 CTGTACTCCCAGCTACTTGGGGG - Intergenic
1134586089 16:15412304-15412326 CTGTCCTCCCAGCTACTTGGGGG + Intronic
1135314293 16:21431201-21431223 CTGTCCTCCCAGCTACTTGGGGG + Intronic
1135334731 16:21591724-21591746 CTGTAGCCCCAGCTACTTGGGGG + Intergenic
1135367216 16:21863479-21863501 CTGTCCTCCCAGCTACTTGGGGG + Intronic
1135444598 16:22507681-22507703 CTGTCCTCCCAGCTACTTGGGGG - Intronic
1135707075 16:24684280-24684302 GTGGGGTCCCAGCTACTTGGGGG + Intergenic
1136251085 16:29005556-29005578 GTGACCAGTCAGCTACTTGGTGG + Intergenic
1136324405 16:29511686-29511708 CTGTCCTCCCAGCTACTTGGGGG + Intergenic
1136439090 16:30251668-30251690 CTGTCCTCCCAGCTACTTGGGGG + Intronic
1138395421 16:56700729-56700751 CTGGAGTCCCAGCTACTTGGAGG + Intronic
1140106471 16:71964967-71964989 CTGTACTCCCAGCTACTTGGGGG - Intronic
1140388138 16:74560722-74560744 CTGTAACCCCAGCTACTTGGAGG + Intronic
1140438836 16:74970926-74970948 TTGTACTCCCAGCTACTTGGGGG + Intronic
1141121167 16:81358211-81358233 GTGGCCCTACAGCTACTTAGTGG - Intronic
1141560750 16:84866356-84866378 CTGTCATCCCAGCTACTTGGGGG - Intronic
1142141948 16:88476432-88476454 ATGGCCGCCCTGCCACTTGGCGG - Intronic
1142223154 16:88865090-88865112 GTGGGCCTCCAGCTCCTCGGCGG + Exonic
1142477771 17:199821-199843 CTGGCCCCCTAGATAATTGGAGG + Intergenic
1143978215 17:10845846-10845868 GTGTAGTCCCAGCTACTTGGGGG + Intergenic
1144941462 17:18944963-18944985 GTGTGGTCCCAGCTACTTGGTGG + Intergenic
1146032425 17:29377511-29377533 GTGTAGTCCCAGCTACTTGGGGG + Intergenic
1148030106 17:44613811-44613833 GTGGTGTCCCAGCTACATGGTGG + Intergenic
1148591743 17:48821362-48821384 CTGGAGCCCCAGCTACTTGGAGG + Intergenic
1148756908 17:49977992-49978014 GTGTCCCGTCAGCTCCTTGGTGG - Intergenic
1149329736 17:55568341-55568363 GTGTAGTCCCAGCTACTTGGGGG + Intergenic
1149484946 17:57035310-57035332 CTGTACTCCCAGCTACTTGGGGG - Intergenic
1149706657 17:58701018-58701040 CTGTAGCCCCAGCTACTTGGGGG - Intronic
1150113300 17:62521042-62521064 CTGTGGCCCCAGCTACTTGGAGG + Intronic
1150661711 17:67086456-67086478 CTGTAACCCCAGCTACTTGGGGG + Intronic
1152399431 17:80056502-80056524 CTGGAGTCCCAGCTACTTGGGGG + Intronic
1153216088 18:2822243-2822265 ATGGTCAGCCAGCTACTTGGTGG - Intergenic
1153950791 18:10056164-10056186 GTGGCCCCCAAGCTTCTCTGAGG - Intergenic
1154252417 18:12755699-12755721 GTGACCAGCCAGCTACCTGGTGG - Intergenic
1155017447 18:21859270-21859292 GTGACCTCCCAACTACTTGGAGG + Intronic
1156546363 18:37967522-37967544 GTGACCAGCCAGCTACCTGGAGG + Intergenic
1158719488 18:59911399-59911421 CTGTAGCCCCAGCTACTTGGTGG + Intergenic
1159151103 18:64524523-64524545 GTGGTCCCACAGCTACTATGTGG + Intergenic
1159711427 18:71765104-71765126 GTGACCAGCCAGCTACTTGGTGG + Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160578423 18:79870029-79870051 CTGGGCCCCCAGCCACCTGGGGG + Intronic
1160668166 19:343334-343356 GTGGCCCTGCAGCGACGTGGTGG - Intronic
1160763036 19:795404-795426 GTGGCCGCCGAGCTCCATGGAGG - Intergenic
1161158000 19:2744243-2744265 CTGTCACCCCAGCTACTGGGAGG + Intergenic
1161569717 19:5023883-5023905 GTGCACACCCAGCTACTTAGAGG - Intronic
1161968042 19:7559719-7559741 CTGTCACCCCAGCTACTTAGGGG + Intronic
1162224897 19:9212873-9212895 CTGTCTTCCCAGCTACTTGGAGG - Intergenic
1162307403 19:9883546-9883568 GTGGCCCCCCAGCTTCTCCAGGG + Intronic
1162995166 19:14330183-14330205 CTGTCATCCCAGCTACTTGGAGG - Intergenic
1163313722 19:16529152-16529174 CTGTCGTCCCAGCTACTTGGGGG - Intronic
1163360409 19:16842527-16842549 CTGTACTCCCAGCTACTTGGAGG - Intronic
1165165871 19:33855645-33855667 CTGTCATCCCAGCTACTTGGGGG + Intergenic
1165202668 19:34158029-34158051 GTGTAGTCCCAGCTACTTGGGGG - Intergenic
1165464051 19:35961654-35961676 CTGTAACCCCAGCTACTTGGGGG - Intergenic
1166815169 19:45540436-45540458 CTGTAGCCCCAGCTACTTGGGGG + Intronic
1168454275 19:56493880-56493902 GTGGTGGCACAGCTACTTGGTGG - Intergenic
925709721 2:6726995-6727017 GTGGGCCCCCAACTGCTGGGAGG - Intergenic
925772605 2:7298031-7298053 GTGATCAGCCAGCTACTTGGTGG - Intergenic
929269687 2:39959813-39959835 GTGATCAGCCAGCTACTTGGTGG - Intergenic
929746685 2:44666730-44666752 CTGTACTCCCAGCTACTTGGAGG - Intronic
930742580 2:54847028-54847050 CTGTAGCCCCAGCTACTTGGGGG - Intronic
930775022 2:55162721-55162743 GTGACCCTCCAGCGATTTGGGGG - Intergenic
931056520 2:58478241-58478263 CTGTACTCCCAGCTACTTGGGGG + Intergenic
931275353 2:60739416-60739438 CTGTGCTCCCAGCTACTTGGTGG - Intergenic
931469327 2:62521873-62521895 CTGTAGCCCCAGCTACTTGGGGG - Intergenic
932208230 2:69903066-69903088 CTGTACTCCCAGCTACTTGGCGG - Intronic
935184087 2:100715882-100715904 GTGATCAGCCAGCTACTTGGTGG + Intergenic
936881883 2:117262846-117262868 GTGGCACCCAGGCAACTTGGTGG + Intergenic
937163061 2:119784338-119784360 CTGTAGCCCCAGCTACTTGGTGG - Intronic
937396488 2:121540663-121540685 CTGTCATCCCAGCTACTTGGAGG + Intronic
937765774 2:125658969-125658991 GTGATCATCCAGCTACTTGGTGG + Intergenic
938232079 2:129669712-129669734 GTGGGCCCCCAGCATCTAGGGGG + Intergenic
938396129 2:130949769-130949791 CTGTAACCCCAGCTACTTGGGGG - Intronic
939069223 2:137518871-137518893 GTGATCGGCCAGCTACTTGGTGG + Intronic
939342725 2:140920055-140920077 TAGGCCCTCCAGCTACTTGTAGG - Intronic
939806376 2:146779454-146779476 GTGATCAGCCAGCTACTTGGTGG + Intergenic
941552286 2:166932337-166932359 CTGTAGCCCCAGCTACTTGGGGG - Intronic
941987129 2:171520929-171520951 CTGTAGCCCCAGCTACTTGGGGG - Intergenic
942442189 2:176048132-176048154 GTGTAGTCCCAGCTACTTGGGGG + Intergenic
942477167 2:176339570-176339592 CTGGACTCCCAGCTACATGGAGG - Intergenic
943182231 2:184559608-184559630 GTGATCAGCCAGCTACTTGGTGG + Intergenic
943735403 2:191348525-191348547 TTGGTCCCCCACCTTCTTGGAGG + Intronic
943800008 2:192045762-192045784 GTGGCCAGCCAGCTCCTGGGTGG + Intronic
945727135 2:213485115-213485137 CTGTACTCCCAGCTACTTGGGGG - Intronic
945848110 2:214972528-214972550 GTGTAGTCCCAGCTACTTGGTGG - Intronic
946678320 2:222186191-222186213 CTGTAACCCCAGCTACTTGGAGG + Intergenic
946687534 2:222286058-222286080 CTGTAACCCCAGCTACTTGGGGG - Intronic
947208464 2:227683919-227683941 CTGGACTCCCAGCTACTTGAGGG - Intergenic
947529123 2:230897537-230897559 TTGTCATCCCAGCTACTTGGGGG - Intergenic
948073496 2:235146661-235146683 CTGTCATCCCAGCTACTTGGGGG + Intergenic
948117398 2:235503718-235503740 CTGGAGTCCCAGCTACTTGGCGG - Intronic
1169090454 20:2858215-2858237 GTAGCATGCCAGCTACTTGGGGG - Intronic
1172308640 20:33899933-33899955 CTGTAACCCCAGCTACTTGGGGG + Intergenic
1172328296 20:34054701-34054723 CTGGCATCCCAGCTACTTGGGGG + Intronic
1172620073 20:36312957-36312979 CTGGGCCTCCATCTACTTGGTGG + Intronic
1172679402 20:36700894-36700916 GTGTGCTCCAAGCTACTTGGGGG - Intronic
1175522366 20:59610130-59610152 CTGTCGTCCCAGCTACTTGGGGG + Intronic
1175848571 20:62073540-62073562 GTGATCAGCCAGCTACTTGGTGG + Intergenic
1175893424 20:62325327-62325349 GTGCCCCGCCAGCTACCGGGGGG - Exonic
1176998307 21:15581252-15581274 GTGATCAGCCAGCTACTTGGTGG + Intergenic
1177656449 21:24022557-24022579 CTGTTGCCCCAGCTACTTGGGGG - Intergenic
1178028220 21:28492623-28492645 CTGTACTCCCAGCTACTTGGGGG + Intergenic
1179731506 21:43370491-43370513 ATGGCCCCTCAGCGACATGGTGG - Intergenic
1179887231 21:44319393-44319415 GAGGCCACCCAGCTCCGTGGTGG + Exonic
1180994472 22:19958766-19958788 CTGTCGTCCCAGCTACTTGGGGG + Intronic
1181275278 22:21684082-21684104 CTGTAGCCCCAGCTACTTGGGGG + Intronic
1181643433 22:24216992-24217014 CTGTACTCCCAGCTACTTGGGGG + Intergenic
1182035301 22:27193699-27193721 GTGGACCACCAGCTCCTTGAGGG - Intergenic
1182228795 22:28820744-28820766 CTGTAACCCCAGCTACTTGGGGG + Intergenic
1182425779 22:30271305-30271327 GTGGCCCCCAATCTGCTGGGTGG + Intergenic
1182513902 22:30841040-30841062 CTGTAACCCCAGCTACTTGGGGG + Intronic
1183167075 22:36156012-36156034 GAGGCCCCACAGCCACTTGCAGG - Intronic
1183173057 22:36202030-36202052 GAGGCCCCGCAGCGACATGGAGG - Exonic
1183241530 22:36661255-36661277 GTTGCTCCCCAGGTGCTTGGAGG - Intronic
1183271548 22:36865527-36865549 GAGGCCACCCAGCTTCCTGGCGG - Intronic
1183859922 22:40662382-40662404 GTGGTCAGCCAGCTACGTGGTGG + Intergenic
949125524 3:442127-442149 GTGATCAGCCAGCTACTTGGCGG - Intergenic
950563754 3:13751548-13751570 CTGTACCCCCAGCTACTTAGGGG - Intergenic
950678668 3:14569840-14569862 GTGGTCCCACAGCTAGTTTGTGG + Intergenic
950828556 3:15851419-15851441 CTGTACTCCCAGCTACTTGGGGG + Intronic
951892089 3:27576900-27576922 ATAGTCCCCCAGCTACTTGGGGG - Intergenic
953840455 3:46386032-46386054 CTGTCCTCCCAGCTACTTGGGGG - Intergenic
953934571 3:47029183-47029205 GTGTAGTCCCAGCTACTTGGAGG - Intronic
954328607 3:49877276-49877298 AGGGCCCCCCACCTTCTTGGTGG + Intergenic
955921032 3:63955465-63955487 GTGACACCCCACTTACTTGGAGG + Intronic
956047783 3:65214851-65214873 GTGATCAACCAGCTACTTGGTGG + Intergenic
956142208 3:66157110-66157132 CTGCCGCCCCAGCTGCTTGGAGG + Intronic
957543319 3:81604407-81604429 CTGTCATCCCAGCTACTTGGGGG - Intronic
958612736 3:96448323-96448345 TTGTCACCCCAGCTACTCGGGGG + Intergenic
961299193 3:125911346-125911368 GTGTAGTCCCAGCTACTTGGAGG + Intergenic
961545014 3:127627193-127627215 CTGGAATCCCAGCTACTTGGGGG - Intergenic
966898916 3:184466395-184466417 GAGGCCCCCCAGATCCCTGGGGG + Intronic
968960530 4:3740989-3741011 CTGGGCTCCCAGCCACTTGGAGG + Intergenic
969710579 4:8840839-8840861 GTGGCCCCCCATCTACAGAGGGG + Intergenic
969815889 4:9687200-9687222 GTGTAGTCCCAGCTACTTGGAGG + Intergenic
970586939 4:17523335-17523357 CTGTACTCCCAGCTACTTGGGGG - Intronic
970629427 4:17924487-17924509 GTGATCAGCCAGCTACTTGGTGG + Intronic
971153913 4:24062562-24062584 GGGGCCCCCAGGCTAGTTGGAGG - Intergenic
971365592 4:25974436-25974458 CTGTAGCCCCAGCTACTTGGTGG - Intergenic
971856368 4:32049454-32049476 GTGGCCCAACAGCTTCTTGGTGG + Intergenic
971857522 4:32061870-32061892 GTGATCAGCCAGCTACTTGGTGG - Intergenic
972747900 4:41958131-41958153 CTGTAACCCCAGCTACTTGGAGG - Exonic
973262555 4:48179509-48179531 CTGGAATCCCAGCTACTTGGGGG - Intronic
974478916 4:62419907-62419929 GTGATCAGCCAGCTACTTGGTGG - Intergenic
974862336 4:67537668-67537690 CTGTAACCCCAGCTACTTGGGGG + Intronic
975908337 4:79242226-79242248 GTGGCCCACCTGCACCTTGGAGG + Intronic
976181186 4:82400161-82400183 GTGTAATCCCAGCTACTTGGGGG + Intergenic
976296202 4:83474590-83474612 CTGGAGTCCCAGCTACTTGGAGG + Intronic
977095295 4:92734899-92734921 CTGTACTCCCAGCTACTTGGAGG - Intronic
978729334 4:112006628-112006650 GTAGTCCCACAGCTACTCGGCGG + Intergenic
979898276 4:126188082-126188104 GTGATCAGCCAGCTACTTGGTGG - Intergenic
980385658 4:132086075-132086097 GTGATCACCCAGCTACTTGGTGG - Intergenic
980757047 4:137178223-137178245 CTGTGCTCCCAGCTACTTGGGGG + Intergenic
985231358 4:187821352-187821374 GGGGTCCCCCAGTGACTTGGAGG + Intergenic
985784868 5:1888131-1888153 GGGGCCCCCCAGCTCCCTGAGGG - Intergenic
986938201 5:12917767-12917789 GTGATCAGCCAGCTACTTGGAGG - Intergenic
987706009 5:21462715-21462737 CTGTCGTCCCAGCTACTTGGGGG - Intergenic
988092566 5:26562269-26562291 GTTGTCCGCCAGGTACTTGGTGG + Intergenic
989016631 5:36942616-36942638 CTGTAGCCCCAGCTACTTGGGGG + Intronic
991330599 5:65488697-65488719 GTGATCAGCCAGCTACTTGGTGG - Intergenic
992876581 5:81061807-81061829 CTGTAGCCCCAGCTACTTGGGGG - Intronic
994477141 5:100285929-100285951 TTGGGGTCCCAGCTACTTGGGGG - Intergenic
994839086 5:104897971-104897993 CTGTCATCCCAGCTACTTGGGGG + Intergenic
995427596 5:112042765-112042787 GTGATCAGCCAGCTACTTGGTGG - Intergenic
995650205 5:114361493-114361515 GTGCCCCCGCAGTTACTTGGCGG + Intronic
996018699 5:118568855-118568877 GTGATCAGCCAGCTACTTGGTGG + Intergenic
996392065 5:122972805-122972827 GTGATCAGCCAGCTACTTGGTGG - Intronic
996563810 5:124858511-124858533 GTGTAATCCCAGCTACTTGGGGG + Intergenic
997436919 5:133882229-133882251 GTGGCTGCGCATCTACTTGGTGG + Intergenic
997863290 5:137439012-137439034 GTGGCCACAGAGCTATTTGGTGG - Intronic
997982563 5:138478018-138478040 CTGTAACCCCAGCTACTTGGGGG + Intergenic
1000363862 5:160472955-160472977 GGTGCCCGCCAGCTACTCGGTGG - Intergenic
1001173748 5:169445625-169445647 GTGATCAGCCAGCTACTTGGTGG + Intergenic
1001389923 5:171370587-171370609 CTAGCTACCCAGCTACTTGGAGG - Intergenic
1003578480 6:7318357-7318379 TTGGCCACACAGTTACTTGGTGG - Intronic
1004032015 6:11879881-11879903 CTGGCCCCATACCTACTTGGTGG - Intergenic
1005091739 6:22063736-22063758 TTGTTCTCCCAGCTACTTGGAGG + Intergenic
1005992738 6:30913721-30913743 GAATCCCCCCAGCTCCTTGGTGG - Intronic
1006116888 6:31780354-31780376 CTGTCCCCCCAGCTACATGGAGG + Intronic
1006314750 6:33283774-33283796 TTGTACTCCCAGCTACTTGGAGG + Intronic
1006912621 6:37573307-37573329 CTGCACACCCAGCTACTTGGGGG - Intergenic
1007362149 6:41366683-41366705 CTGTAACCCCAGCTACTTGGGGG + Intergenic
1008079246 6:47177584-47177606 GTGACCAGCCAGCTACTTGGTGG - Intergenic
1009022274 6:57958164-57958186 CTGTCGTCCCAGCTACTTGGAGG + Intergenic
1009806629 6:68607929-68607951 GTGGTCAGCCAGCTACTTAGTGG + Intergenic
1010107806 6:72189586-72189608 GTGATCAGCCAGCTACTTGGTGG - Intronic
1014617184 6:123617858-123617880 CTGTCATCCCAGCTACTTGGAGG - Intronic
1015475893 6:133658467-133658489 GTGGTCAGCCAGCTACCTGGTGG + Intergenic
1015579248 6:134705432-134705454 GTGTACTCCCAGCTGCTTGGGGG - Intergenic
1016715009 6:147215501-147215523 CTGGAGTCCCAGCTACTTGGGGG - Intronic
1017227667 6:152040102-152040124 GTGATCAGCCAGCTACTTGGTGG - Intronic
1017417124 6:154233089-154233111 CTGTAACCCCAGCTACTTGGGGG - Intronic
1018534892 6:164809520-164809542 GTGATCACTCAGCTACTTGGTGG - Intergenic
1018698884 6:166411939-166411961 GTGGCCACACAGCTATCTGGAGG - Exonic
1019597003 7:1862871-1862893 CTGGGCCCACAGCTACTTGCCGG + Intronic
1022034191 7:26518551-26518573 GGGGCCCCTCAGCTAGTGGGTGG + Intergenic
1026997238 7:74625787-74625809 GTGTAATCCCAGCTACTTGGAGG - Intergenic
1027127136 7:75564715-75564737 CTGTACTCCCAGCTACTTGGAGG - Intronic
1027685939 7:81278939-81278961 GTGATCAGCCAGCTACTTGGTGG + Intergenic
1030246993 7:107393558-107393580 GTGGGCCCACAGCTGCTTGGTGG + Intronic
1030302807 7:107991462-107991484 GTGTAATCCCAGCTACTTGGGGG + Intronic
1030457316 7:109792061-109792083 GTGGTCAGCCAGCTACCTGGTGG - Intergenic
1031236997 7:119189235-119189257 GTGATCAGCCAGCTACTTGGTGG + Intergenic
1031377732 7:121048659-121048681 GTGTAATCCCAGCTACTTGGTGG - Intronic
1031615170 7:123871311-123871333 GTGTAACCTCAGCTACTTGGAGG - Intronic
1031676683 7:124619270-124619292 GTGATCAGCCAGCTACTTGGTGG + Intergenic
1032042515 7:128574990-128575012 CTGTGGCCCCAGCTACTTGGAGG + Intergenic
1032808125 7:135378860-135378882 ATGTAGCCCCAGCTACTTGGAGG + Intronic
1032815718 7:135472048-135472070 CTGTAGCCCCAGCTACTTGGGGG + Intronic
1033798552 7:144875222-144875244 GTGGGCCCACATCTGCTTGGTGG + Intergenic
1036084100 8:5594510-5594532 CTGTCATCCCAGCTACTTGGGGG - Intergenic
1037842835 8:22257458-22257480 CTGTACTCCCAGCTACTTGGGGG + Intergenic
1037862519 8:22415962-22415984 GTGGGCCACCAGCTGCTTGGTGG + Intronic
1038734865 8:30159882-30159904 CTGTACTCCCAGCTACTTGGGGG - Intronic
1043069163 8:75617208-75617230 GTGGGCCCCCAGCCTGTTGGGGG + Intergenic
1045466745 8:102477127-102477149 CTGTCGTCCCAGCTACTTGGGGG + Intergenic
1047252809 8:123193334-123193356 GTGGCCTGGCAGTTACTTGGAGG - Intronic
1047259390 8:123242090-123242112 CTGTAGCCCCAGCTACTTGGGGG - Intronic
1047327329 8:123852327-123852349 GTGACCAGCCAGCTACCTGGAGG - Intronic
1047740771 8:127804660-127804682 GTGGCATCCCAGCTACTCGGAGG - Intergenic
1048204053 8:132401496-132401518 CTGTCATCCCAGCTACTTGGGGG - Intronic
1049262723 8:141648461-141648483 GTGGCCACACAGCTACATAGAGG - Intergenic
1051627654 9:19113694-19113716 CTGTAACCCCAGCTACTTGGGGG - Intronic
1052227720 9:26109357-26109379 GTGATCAGCCAGCTACTTGGTGG + Intronic
1052267276 9:26589516-26589538 CTGTGGCCCCAGCTACTTGGAGG - Intergenic
1052561433 9:30089015-30089037 GTGATCAGCCAGCTACTTGGTGG - Intergenic
1054825246 9:69566759-69566781 CTGGCTCCCCAGCTACATGCAGG + Intronic
1055903798 9:81270210-81270232 GTGATCAGCCAGCTACTTGGCGG - Intergenic
1056790573 9:89622803-89622825 GAGGCCCCATGGCTACTTGGGGG - Intergenic
1057004809 9:91547816-91547838 GTGATCCGCCAGCTACCTGGTGG - Intergenic
1057633873 9:96744729-96744751 CTGGGGTCCCAGCTACTTGGGGG + Intergenic
1058149480 9:101448601-101448623 CTGTAGCCCCAGCTACTTGGAGG + Intergenic
1058792560 9:108465284-108465306 CTGGACCCCCAGCTAGTTTGTGG - Intergenic
1059735850 9:117098983-117099005 GTGTAATCCCAGCTACTTGGAGG + Intronic
1060621492 9:125071103-125071125 GAGGCCTCCTAGCTACATGGAGG + Intronic
1060804993 9:126569727-126569749 GTGAACAGCCAGCTACTTGGTGG - Intergenic
1060868400 9:127018509-127018531 CTGGAGTCCCAGCTACTTGGAGG + Intronic
1061175013 9:128989992-128990014 GTGGCCCTCCAAGTACTTGAGGG + Intronic
1061209916 9:129185174-129185196 GTGTCCACCCAGCCCCTTGGGGG + Intergenic
1061988545 9:134144715-134144737 GTGTGGTCCCAGCTACTTGGAGG + Intronic
1062364493 9:136202394-136202416 CAGGCCCCCCAGCTTCCTGGTGG - Intronic
1062593175 9:137283863-137283885 CTGTCATCCCAGCTACTTGGGGG + Intergenic
1187920259 X:24194867-24194889 GTGTAGTCCCAGCTACTTGGGGG - Intronic
1187990115 X:24861253-24861275 CTGTAGCCCCAGCTACTTGGGGG - Intronic
1190022129 X:46888749-46888771 GTGTAGTCCCAGCTACTTGGGGG - Intronic
1190839650 X:54132176-54132198 GTGTAGTCCCAGCTACTTGGGGG - Intronic
1191133908 X:57043536-57043558 GTGATCAGCCAGCTACTTGGTGG - Intergenic
1192661437 X:73046803-73046825 GTGATCAGCCAGCTACTTGGTGG - Intergenic
1192996316 X:76516559-76516581 GTGATCAGCCAGCTACTTGGTGG + Intergenic
1193914680 X:87350963-87350985 GTGATCAGCCAGCTACTTGGTGG - Intergenic
1194232991 X:91347267-91347289 GTGATCAGCCAGCTACTTGGTGG + Intergenic
1195782212 X:108478892-108478914 GTGACCAGCCAGCTACCTGGTGG - Intronic
1197405182 X:126039924-126039946 GTGATCACCCAGCTACCTGGTGG + Intergenic
1198470198 X:136939306-136939328 CTGTAGCCCCAGCTACTTGGGGG - Intergenic
1198531378 X:137551732-137551754 GAGGCACCCCAGCCACATGGTGG - Intergenic
1198695752 X:139335536-139335558 CTGTACTCCCAGCTACTTGGGGG - Intergenic
1200284333 X:154805693-154805715 GGGGGCCCCCAGCTTCTGGGTGG + Intronic
1201413317 Y:13722684-13722706 GTGTCCACACAGCTACTCGGGGG - Intergenic
1201895949 Y:18993017-18993039 GCGGCTCCCCAGCTCCTGGGAGG - Intergenic