ID: 902888860

View in Genome Browser
Species Human (GRCh38)
Location 1:19426759-19426781
Sequence CTGTGGGTCAGGAGTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 2, 2: 18, 3: 63, 4: 452}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902888860_902888869 30 Left 902888860 1:19426759-19426781 CCTCCTGAACTCCTGACCCACAG 0: 1
1: 2
2: 18
3: 63
4: 452
Right 902888869 1:19426812-19426834 CCTTTAAGTCACTAGGTTTCGGG 0: 1
1: 2
2: 0
3: 45
4: 495
902888860_902888866 23 Left 902888860 1:19426759-19426781 CCTCCTGAACTCCTGACCCACAG 0: 1
1: 2
2: 18
3: 63
4: 452
Right 902888866 1:19426805-19426827 AATTGTTCCTTTAAGTCACTAGG 0: 1
1: 0
2: 4
3: 29
4: 260
902888860_902888867 29 Left 902888860 1:19426759-19426781 CCTCCTGAACTCCTGACCCACAG 0: 1
1: 2
2: 18
3: 63
4: 452
Right 902888867 1:19426811-19426833 TCCTTTAAGTCACTAGGTTTCGG 0: 1
1: 0
2: 10
3: 177
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902888860 Original CRISPR CTGTGGGTCAGGAGTTCAGG AGG (reversed) Intronic
900230559 1:1554861-1554883 CTGAGGGCCAGGAGCTGAGGTGG - Intronic
900571699 1:3361828-3361850 CTGTGGCCCAGGAGGGCAGGTGG + Intronic
901295405 1:8157266-8157288 CAGTCGGTCAGAAGTGCAGGTGG + Intergenic
901752627 1:11420727-11420749 GTGTAAGTCTGGAGTTCAGGAGG - Intergenic
901796636 1:11683263-11683285 CTGTGTGTCAGGAGTTCTACGGG - Intronic
901842213 1:11960842-11960864 CTGAGTGACAGGAGTTCAGAAGG + Intronic
902127380 1:14227289-14227311 CTATGGGTCAGGAATTCAGAAGG + Intergenic
902263023 1:15241096-15241118 CTGTGGGTCAGGAATTGGGCAGG - Intergenic
902330572 1:15729257-15729279 CTGGGGGTCAGGGGTGGAGGTGG + Intronic
902564785 1:17304357-17304379 CTCTGGGACAGGAGCTCAGGTGG + Intergenic
902706397 1:18208233-18208255 CTCTGGGCAAGGAGATCAGGTGG - Intronic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
903288792 1:22294218-22294240 TTGTTGGTCAGAAGTACAGGAGG + Intergenic
903303165 1:22393243-22393265 GTGGGGGTCAGGAGTCCAGCAGG + Intergenic
903519072 1:23933823-23933845 CAGTCGGTCAGAAGTTCTGGAGG - Intergenic
903551767 1:24162094-24162116 CTCTAGGTCAGAAGTCCAGGTGG + Intronic
903795714 1:25927556-25927578 CTGGGAGTCAGGGGGTCAGGGGG + Intergenic
904624693 1:31795853-31795875 CTGTGGGTCAGATGTTCACCTGG - Intronic
904839391 1:33362307-33362329 CTGTGAGTCTGGGGTGCAGGAGG + Intronic
905478613 1:38246157-38246179 CTCTGGCTCAGGAGATTAGGAGG - Intergenic
905952201 1:41961299-41961321 ATGTGGGTCAGGGATTCAGGTGG - Intronic
906243039 1:44253918-44253940 CTGTGACTGAGGAATTCAGGAGG - Intronic
908353441 1:63308746-63308768 CTGTGGATCGGGAATTCAGAAGG - Intergenic
909701187 1:78525286-78525308 CAGTTTGTCAGAAGTTCAGGTGG - Intronic
912740273 1:112188295-112188317 TTTTGGGTCAGGACTACAGGAGG + Intergenic
912861468 1:113217626-113217648 GTCTGGGTCAGGAGCACAGGAGG + Intergenic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
915183458 1:154083470-154083492 CAGTTGGTCAGAAGTTCTGGAGG + Intronic
915972636 1:160365426-160365448 CTGGGGGGCAGGGGATCAGGTGG - Intergenic
916571154 1:166028944-166028966 CTGTCGGTCAGGAATTTGGGAGG + Intergenic
916854941 1:168739569-168739591 CTTGAGGTCAGGAGTTCAAGAGG + Intergenic
917664008 1:177206263-177206285 CTGTGGGTCAGAAATTTGGGTGG - Intronic
918279782 1:182993129-182993151 CTGTAGGTCAGGTATTCAAGTGG + Intergenic
918632909 1:186740139-186740161 ATGTGGGTTTGGAGTTCAGGAGG - Intergenic
919464051 1:197910935-197910957 TTGTGGGTCAGGCGTGGAGGCGG + Intergenic
919540168 1:198835900-198835922 ATGTAGGTCAGAAGTCCAGGAGG + Intergenic
920055350 1:203186885-203186907 CTTTGGGTCAGGTCTTCATGAGG + Intergenic
920570523 1:207013489-207013511 CTGCGGGTCTGCAGTTCATGGGG - Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921629040 1:217412043-217412065 CTGTGTGACAGGAGTGGAGGTGG + Intergenic
922606217 1:226891445-226891467 CTGAGAGGCATGAGTTCAGGAGG + Intronic
923301296 1:232643023-232643045 CAGTTGGTCAGAAGTTCTGGAGG + Intergenic
923332324 1:232936550-232936572 CTTGAGGTCAGGAGTTCAAGAGG + Intergenic
924106892 1:240658196-240658218 CTGTGAGTCAGGAATTCAGGAGG + Intergenic
924133735 1:240940372-240940394 CTGTGGATCTGGAGACCAGGTGG - Intronic
924274720 1:242374227-242374249 CTGTGTTTTAGGAGTTCAGGTGG - Intronic
1064185819 10:13161281-13161303 CAGAGCGTCAGGAGTTGAGGTGG + Intergenic
1064247288 10:13679195-13679217 AGGTGGGTCACGAGGTCAGGAGG + Intronic
1064655522 10:17551784-17551806 CGGTCGGTCAGAAGTTCTGGAGG + Intergenic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1065053639 10:21820698-21820720 CAGTTGGTCAGAAGTTCTGGAGG - Intronic
1065072892 10:22045710-22045732 CTGTGGGTCAGGAATCCAGAAGG - Intergenic
1065111200 10:22441834-22441856 CTTTGGGTTAGGAATACAGGCGG + Intronic
1065255428 10:23861886-23861908 CTGTAGGTCAGAAGTCCTGGTGG - Intronic
1065902962 10:30224540-30224562 CAGAGGGCCAGGAGTTCAGCGGG - Intergenic
1067077733 10:43197678-43197700 CTGTGGGATTGGAGGTCAGGAGG - Intronic
1067205450 10:44208406-44208428 ATATGGGTCAGGAGCTCAGGAGG - Intergenic
1067452891 10:46393185-46393207 CTGTGGGTCAGCAGTTCTGGAGG + Intergenic
1067535328 10:47105197-47105219 CTGTGGACCAGGAGTTCAGCTGG - Intergenic
1067584341 10:47466574-47466596 CTGTGGGTCAGCAGTTCTGGAGG - Intronic
1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG + Intronic
1067946594 10:50693231-50693253 CAGGGGGTCAGGGGGTCAGGGGG - Intergenic
1069175543 10:65285003-65285025 TGGTTGGTCAGAAGTTCAGGGGG + Intergenic
1069663254 10:70137875-70137897 CAGTTGGTCAGAAGTTCTGGAGG - Intergenic
1069931351 10:71884022-71884044 CCTGAGGTCAGGAGTTCAGGTGG - Intergenic
1070318483 10:75336616-75336638 CTGTGGGTCAGATGTCCAGGTGG + Intergenic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1070363950 10:75717583-75717605 CTGTGGGCCAGGAGGCAAGGAGG + Intronic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1072301084 10:94063066-94063088 ATGTGGGAGAGGAGTCCAGGTGG - Intronic
1072611018 10:97017722-97017744 CTGTGTCTCAGGGGCTCAGGGGG + Intronic
1073073105 10:100807281-100807303 CTGTGGGTGAGGGGAGCAGGTGG - Intronic
1073299814 10:102464192-102464214 CTGTGAGCCAGCACTTCAGGAGG + Intronic
1074419527 10:113296750-113296772 AGGTGGATCACGAGTTCAGGAGG - Intergenic
1075686074 10:124366062-124366084 CTGTTGGTCAGGAGCTCATCTGG + Intergenic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077423687 11:2464619-2464641 CTGGGGGACAGGAGTTGGGGGGG + Intronic
1077460194 11:2705257-2705279 TGGGGGGTCTGGAGTTCAGGCGG + Intronic
1077473208 11:2774520-2774542 CTGGGCCTCAGAAGTTCAGGGGG - Intronic
1077838448 11:5946052-5946074 GTGTAGGTCAGGTCTTCAGGGGG - Intergenic
1078235940 11:9484710-9484732 CTGGAGGTCAGGAGTTCAACTGG - Intronic
1078576216 11:12504740-12504762 CTGTGTGTCATGGGGTCAGGAGG + Intronic
1079121868 11:17691584-17691606 CTGTAGGTCAGGAGTCTGGGAGG + Intergenic
1080457205 11:32428416-32428438 CTGTGGGTTAGGAATTCCTGGGG + Intronic
1080541060 11:33265857-33265879 GGGTGGGTCATGAGGTCAGGAGG + Intronic
1080956991 11:37109465-37109487 ATGTTGTTTAGGAGTTCAGGAGG - Intergenic
1080998880 11:37642518-37642540 CTGAGGATCAGGCCTTCAGGAGG - Intergenic
1082141873 11:48618317-48618339 TTGTGAGCCAGGAATTCAGGTGG + Intergenic
1082877316 11:58001433-58001455 CTGTGGTTCAGGAAAACAGGAGG - Intergenic
1083286463 11:61662325-61662347 CAGTCGGTCAGAAGTTCTGGAGG + Intergenic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1083994710 11:66266262-66266284 CTCTGGGTCAGGAGCTCATCCGG - Intronic
1084032593 11:66489661-66489683 CTCTGGGTCAGGAATGCAGGTGG + Intronic
1084500078 11:69530231-69530253 CTCTGAGTCTGGAGTCCAGGAGG + Intergenic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084888734 11:72226084-72226106 CAGTGGGACAGGAGTTTGGGAGG - Intronic
1084945159 11:72634374-72634396 CTGAGGGGCAGGAGTGGAGGTGG - Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1086170922 11:83835701-83835723 CTGTAGGTCAGGAGTCTGGGTGG + Intronic
1086364213 11:86091836-86091858 ATGTTGGTCAGGACTTCTGGAGG - Intergenic
1087203641 11:95371313-95371335 CTTTGGGTCAAGACTCCAGGGGG - Intergenic
1088717121 11:112558681-112558703 CTGTGGGTCAGGAAGCCAAGTGG + Intergenic
1089569103 11:119390800-119390822 CTGTAGGTCAGAAGTCCTGGTGG + Intergenic
1089636240 11:119814281-119814303 CTGTGGGTGAGGAATGCAGCAGG - Intergenic
1089748931 11:120636613-120636635 CGGTGGATCATGAGATCAGGAGG + Intronic
1089783568 11:120892093-120892115 CTGGGGGGCAGGGGTTCATGTGG + Intronic
1090447707 11:126778107-126778129 CTCTGGGTGGGGAGGTCAGGGGG - Intronic
1090879455 11:130820873-130820895 CTGAGGGTGAGGAGGTCAGCTGG - Intergenic
1091186834 11:133655022-133655044 CTGTGTGTCAGGAAATGAGGAGG - Intergenic
1091307044 11:134542940-134542962 CTGTGGGTCAGAGGGTAAGGGGG + Intergenic
1091444746 12:537868-537890 CTCTGGGGCAGGAGTGAAGGAGG + Intronic
1093053501 12:14532088-14532110 CCGTGGGTGAGGAGTGAAGGTGG - Intronic
1095579804 12:43784464-43784486 CAGTTGGTCAGAAGTTCTGGAGG - Intronic
1096812390 12:54179701-54179723 CAGTTGGTCAGAAGTGCAGGTGG - Intronic
1096965593 12:55624822-55624844 CTGTGTATGAGGAGTTGAGGAGG - Intergenic
1097222828 12:57460853-57460875 CTGTGGGCAAGGAGCTCAGGAGG + Intronic
1097650906 12:62296303-62296325 CTGTGGGTCAGTAGTTAAGGAGG - Intronic
1099942127 12:89200792-89200814 GTGAGGGACAGGAGTTGAGGAGG + Intergenic
1100976055 12:100123626-100123648 CTGTCCGTCAGAAGTTCTGGAGG - Intronic
1101173395 12:102122986-102123008 CTGTGGATCAGCAGTTTGGGTGG + Intronic
1101463535 12:104923134-104923156 GTGTGGGTCACGAGGTCAGGAGG + Intronic
1102202892 12:111069839-111069861 CTGGGGGTTAGGACTTCAGTTGG + Intronic
1102727363 12:115077498-115077520 CTGTGGGTCAGGAATTTGGATGG - Intergenic
1103145752 12:118594512-118594534 CTGGGTGTCAGGGGTACAGGAGG + Intergenic
1104278978 12:127356411-127356433 CTGTAGGTCAGGAGTTTAAAAGG + Intergenic
1105462490 13:20605711-20605733 AGGTCAGTCAGGAGTTCAGGAGG - Intronic
1105825428 13:24118576-24118598 CACTGGGTCAGAAATTCAGGGGG - Intronic
1105997591 13:25687147-25687169 GCCGGGGTCAGGAGTTCAGGAGG + Intronic
1106473624 13:30078915-30078937 CTGTGGCCCAGCACTTCAGGAGG + Intergenic
1106860871 13:33906911-33906933 CTCTGTGTCCCGAGTTCAGGTGG + Intronic
1107332552 13:39317327-39317349 CAGTTGGTCAGAAGTGCAGGAGG + Intergenic
1107738526 13:43424013-43424035 CTCTGGGACAAGATTTCAGGTGG + Intronic
1108239127 13:48444137-48444159 CAGTAGGTCAGAAGTTCTGGAGG - Intronic
1108602614 13:52007728-52007750 CAGTTGGTCAGGAGTACAGATGG - Intronic
1109041166 13:57338835-57338857 CAGTTGGTCAGAAGTTCCGGAGG + Intergenic
1109459569 13:62638444-62638466 CAGTGGGTCAGAAGTTCCAGAGG - Intergenic
1110037465 13:70706678-70706700 TTGTGGGTCAGGAGGTTGGGTGG + Intergenic
1110133038 13:72030335-72030357 TTTTGAGTCAGGAGTTCAAGAGG + Intergenic
1110358261 13:74594562-74594584 CTGCGCGTCAGGAATCCAGGAGG - Intergenic
1111180387 13:84655674-84655696 TTGTAGGTCAGAAGTTTAGGTGG + Intergenic
1111706882 13:91761511-91761533 CAGTTGGTCAGAAGTTCTGGAGG - Intronic
1111971706 13:94923693-94923715 TTGTGGGTCAGGAATTCAGATGG - Intergenic
1114393562 14:22336462-22336484 CTCTGGGTCAGAAATTGAGGTGG - Intergenic
1115282336 14:31678077-31678099 CTGTGGGTCTGTAGTGCTGGTGG - Intronic
1116410574 14:44617380-44617402 CTGTAGTTCAGAAGTCCAGGTGG + Intergenic
1116800434 14:49437986-49438008 CTGTGGACCAGGAATCCAGGAGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117777583 14:59198445-59198467 CATGAGGTCAGGAGTTCAGGCGG - Intronic
1117928516 14:60812343-60812365 CTGTGGGTTAGGAATTTAAGTGG + Intronic
1118154804 14:63229363-63229385 CTGTAGGTCAGAAGTCCAGCAGG + Intronic
1119258180 14:73218002-73218024 CTTGAGGTCAGGAGTTCAAGAGG - Intronic
1119853244 14:77881152-77881174 CTTTGGGTCAGGAATTTGGGAGG + Intronic
1120280924 14:82436812-82436834 CTGTAGGTCATGAGTCCAGGTGG - Intergenic
1121014474 14:90539953-90539975 CTGTGGCCCATGAGTGCAGGAGG + Exonic
1121090018 14:91174741-91174763 CAGTTGGTCAGAAGTTCTGGAGG + Intronic
1121381360 14:93471504-93471526 CTGTGGGAAAGAATTTCAGGTGG + Intronic
1122393376 14:101406169-101406191 GTGCAGGTCAGGAGGTCAGGAGG + Intergenic
1123034274 14:105465518-105465540 CTGAGGGTCTGGGGTTTAGGTGG + Intronic
1124395617 15:29299289-29299311 CTGTGGGTCAGGAATTCTCCAGG + Intronic
1124435566 15:29646237-29646259 CTGGAGGTCAGAAGTCCAGGTGG + Intergenic
1125141488 15:36413124-36413146 GTGTGGATCACGAGGTCAGGAGG - Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125899124 15:43329247-43329269 TTGTGGGACTGGAGTTCAGTGGG - Exonic
1127145228 15:56016375-56016397 CATTGAGTCATGAGTTCAGGTGG + Intergenic
1127435806 15:58957195-58957217 CTGTGGGTAATAAGTTCAGGAGG + Intronic
1127533249 15:59865436-59865458 CAGTTGGTCAGAAGTTCCGGAGG + Intergenic
1128175374 15:65550687-65550709 CTGTGGGTTAGGACTTCAGGAGG + Intronic
1128571843 15:68739319-68739341 CAGTTGGTCAGAAGTACAGGTGG + Intergenic
1128828364 15:70742907-70742929 CTGTAGGTCAGAAGTTTAGGTGG + Intronic
1129989825 15:79952044-79952066 CTGTGGGTCAGGTGCCCCGGCGG + Intergenic
1130988439 15:88860162-88860184 CTGTGGGCCAGGTGCCCAGGAGG + Intronic
1131075009 15:89490069-89490091 CAGTGGTCCAGGAGCTCAGGTGG + Intronic
1131244940 15:90782722-90782744 CTGGGGGTTAGGATTTTAGGGGG + Intronic
1132575820 16:663526-663548 CTGAGGCTCAAGAGGTCAGGAGG + Intronic
1133317409 16:4893186-4893208 CTGCGGGTCAGGAGCACAGGTGG - Intronic
1133320302 16:4909379-4909401 CTGAGGGTGGGGAGGTCAGGAGG - Intronic
1133838809 16:9389846-9389868 CTGTGGGTCAGGAATCAGGGTGG - Intergenic
1133962689 16:10508370-10508392 CTTGAGGTCAGGAGTTCAAGAGG - Intergenic
1134104646 16:11477020-11477042 CTGTGGCTCAGGACTGCAGGGGG - Intronic
1134214676 16:12307874-12307896 TGGTGGGCCAGGAGTTCAGAAGG - Intronic
1134368100 16:13597928-13597950 ATTTGGGTCAGAAGTGCAGGAGG - Intergenic
1135491765 16:22915534-22915556 CCGTTGGGCAGGACTTCAGGTGG + Exonic
1135842718 16:25891341-25891363 CTGTGGGTCAGGCATTTAGGAGG + Intronic
1135970863 16:27070949-27070971 CTGGGGGTCAGCAGTGGAGGTGG - Intergenic
1135973625 16:27090267-27090289 CTGCTGGGCAGGAGGTCAGGGGG - Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137546754 16:49410160-49410182 CTGTGGGTCAGGAACACAGTGGG + Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1138282140 16:55780174-55780196 GTGGGGGTGAGGAGATCAGGAGG - Intergenic
1139187376 16:64822838-64822860 CTGTAGGTCAGAAGTCCAGGTGG + Intergenic
1139310257 16:66022079-66022101 CTCTGGTTCAGAAGGTCAGGGGG - Intergenic
1139396184 16:66640997-66641019 CTGTGTGTCAGGAATTTGGGGGG - Intronic
1139602910 16:67997707-67997729 CTGGAGGCCAGGAGATCAGGAGG + Intronic
1140746539 16:77985580-77985602 TTGTGGGTCATGATTTCAGCCGG - Intergenic
1141187354 16:81797482-81797504 CTGTGGGTCAGGACTACCGAAGG - Intronic
1141596722 16:85101454-85101476 CTGTGGGTCTGGGGTTGATGGGG - Intronic
1141610058 16:85176254-85176276 CTGTGGGTCTGCAGTTGTGGAGG + Intronic
1142282439 16:89155532-89155554 CCGTGAGGCAGGAGTTCGGGTGG - Exonic
1143023969 17:3930205-3930227 CTGAGGGTCAGGGGTCCAGGTGG - Intronic
1143336888 17:6178193-6178215 GTGTGGGTCGGGAGATGAGGTGG + Intergenic
1143593133 17:7897948-7897970 CTGTGGGGCAGGAGGCCATGGGG - Intronic
1144939736 17:18930144-18930166 CGGTGGATCATGAGGTCAGGAGG + Intronic
1144941602 17:18946142-18946164 TTGTGGGTCAGAAGTTCCAGAGG - Intergenic
1145883560 17:28368266-28368288 CTGTGGCTGAGGAGTTTAGGGGG - Intronic
1146591758 17:34133502-34133524 CTGTGGGACAGAAGCCCAGGAGG + Intronic
1147230848 17:39016682-39016704 CTGTTGGCCAGAAGTTCTGGAGG + Intergenic
1147506406 17:41021853-41021875 TTGTGGGTCAGGAGTACAGCAGG - Intergenic
1147717415 17:42517683-42517705 CTGTGGCCCAGGACTGCAGGAGG + Intronic
1147738379 17:42655407-42655429 CTGCTGGTCAGAAGTTCTGGAGG + Intergenic
1148178794 17:45588560-45588582 CTGTGGGTCAGGAATCTGGGAGG - Intergenic
1148792520 17:50181397-50181419 CTGTGGGTCAGGGCTGCAGCGGG - Intergenic
1149657503 17:58318110-58318132 CTGTGGGCGAGGCGCTCAGGTGG - Intronic
1150066883 17:62117659-62117681 CCTGAGGTCAGGAGTTCAGGAGG + Intergenic
1150107890 17:62475885-62475907 CGGTGGATCATGAGGTCAGGAGG - Intronic
1150452981 17:65284654-65284676 CGGTGGATCACGAGGTCAGGAGG + Intergenic
1151076947 17:71284732-71284754 CTGGGGGTCAGGAATTCAAATGG - Intergenic
1152041265 17:77905402-77905424 CTGGGAGTCAGGAGTCTAGGAGG + Intergenic
1152051288 17:77980686-77980708 TAGTGGGTCAGAAGTTCTGGAGG - Intergenic
1153827697 18:8891603-8891625 CAGTTGGTCAGGAGTGAAGGTGG + Intergenic
1155066446 18:22273339-22273361 CTGTGGGTCAGGAGTCAAAGTGG + Intergenic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156454717 18:37286549-37286571 CTGTGGGTCAGAGGGGCAGGGGG - Intronic
1157888706 18:51394120-51394142 CTGTGGGTCAGGAATTTGGGAGG + Intergenic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1158603010 18:58870937-58870959 CTGTGAGTCTGGAATTTAGGAGG + Intronic
1158901531 18:61966417-61966439 TTGTGGGTCAGAAGATAAGGAGG + Intergenic
1159274065 18:66192852-66192874 CTTTGGGACAGGATTTCAGAAGG + Intergenic
1160537560 18:79603195-79603217 CTGTGGGCCAGAAGTTCCGAAGG + Intergenic
1161959711 19:7516625-7516647 CCTGGGGTCTGGAGTTCAGGAGG + Intronic
1162360485 19:10217107-10217129 CTGTGGGCAAGGGGTACAGGTGG + Intronic
1162661611 19:12173727-12173749 CTGTTGGTCAGAAGTTCCAGAGG + Intronic
1162885265 19:13692373-13692395 CTGTGACTCAGGAGGGCAGGTGG + Intergenic
1163255716 19:16154529-16154551 CTGAGGGGCAGGAGTGGAGGTGG + Intronic
1163307010 19:16486781-16486803 CTGAGGGTGAGGGGTTAAGGAGG - Intronic
1163389783 19:17023336-17023358 CTGGGAGACAGGAGCTCAGGTGG - Intronic
1163622646 19:18369971-18369993 TTGTGGGGCTGGAGTTCAGCTGG + Intergenic
1164457358 19:28419944-28419966 CTGTGGGTCAGGTGTTCTCACGG - Intergenic
1164717593 19:30404878-30404900 CTGTTGGTCAGAAGTTCGTGAGG - Intronic
1164718002 19:30407548-30407570 CTGTTGGTCAGAAGTTCGTGAGG - Intronic
1164785669 19:30928471-30928493 CTGTGAGTCATGGGTCCAGGTGG - Intergenic
1165985901 19:39768672-39768694 CAGTTGGTCAGAAGTGCAGGTGG - Intergenic
1166103451 19:40585226-40585248 CTGTGGTTCTGCTGTTCAGGAGG - Intronic
1167031967 19:46968363-46968385 CTGTGGGTCAGCAGAGCAGGAGG + Intronic
1167599109 19:50443688-50443710 CTGTGGGGCAGGGGGACAGGAGG - Intronic
926007559 2:9384517-9384539 CGGTTGGTCAGAAGTTCTGGAGG - Intronic
926022981 2:9513425-9513447 CAGTTGGTCAGAAGTTCTGGAGG + Intronic
926059342 2:9795422-9795444 TTGTGGGTTAGGAATTCAGTGGG + Intergenic
926530075 2:14033225-14033247 CTGTGGGTCAGAAATTAGGGAGG - Intergenic
927164040 2:20299134-20299156 CAGTCGGTCAGAAGTTCTGGAGG + Intronic
927666854 2:25038880-25038902 CAGTTGGTCAGAAGTTCTGGAGG - Intergenic
927672346 2:25079266-25079288 CTGGGTGGCAGGTGTTCAGGAGG + Intronic
928624507 2:33125895-33125917 CTGTGGTTCAGGAATTTAGAGGG + Intronic
928812980 2:35252223-35252245 CTGTGCTTCAAGATTTCAGGAGG - Intergenic
929025049 2:37592539-37592561 AGGTGGATCAGGAGGTCAGGAGG + Intergenic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929825479 2:45306471-45306493 TCGTGGGTCAGAAGTACAGGTGG - Intergenic
930209339 2:48618064-48618086 CTGAGGGCCAGTAGTTCAGCAGG + Intronic
930316389 2:49801528-49801550 GGGTGGGTCACGAGCTCAGGAGG - Intergenic
932609173 2:73186142-73186164 CTGGGGGTCAGGAATTTGGGCGG + Intergenic
933586230 2:84182198-84182220 CTGTAGGTCAGAAGTCCAGCTGG - Intergenic
933725850 2:85426812-85426834 CAGTTGGTCAGAAGTTCTGGAGG + Intronic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935202118 2:100866162-100866184 CTGTGGCAGAGGAGTTGAGGGGG + Intronic
936229444 2:110687263-110687285 CAGTTGGTCAGAAGTGCAGGTGG - Intergenic
936715392 2:115181353-115181375 CTGTTGGTCAGGAGTTCAGGTGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937069805 2:119054426-119054448 TTGTGGGTTGGGATTTCAGGAGG + Intergenic
937712101 2:124989923-124989945 CTGTGAGGTAGGAGTTCAGCAGG + Intergenic
938116646 2:128606961-128606983 ACCTGGGGCAGGAGTTCAGGTGG + Intergenic
938388001 2:130881698-130881720 CTGTGGCTCAGAAGTGCTGGAGG + Intronic
938707325 2:133943840-133943862 CTGAGGGTCAGGAATCCTGGAGG + Intergenic
938711474 2:133979321-133979343 CTGTGGCTCAGTGGTGCAGGTGG + Intergenic
938901151 2:135799424-135799446 TTGTCAGTCAGGGGTTCAGGTGG + Intronic
940320409 2:152370857-152370879 CTATGGGTCAGGAATTTGGGTGG + Intronic
942191616 2:173476174-173476196 CTGTGGGTCAGAAATTCATGAGG - Intergenic
942249969 2:174039197-174039219 GGGTGGATCACGAGTTCAGGAGG + Intergenic
944566384 2:200995776-200995798 TTGTGGGTCAGGAATCCAGATGG - Intronic
946223550 2:218249513-218249535 CTTTCTGTCAGGAGTTCTGGTGG - Intronic
946880477 2:224172101-224172123 CTTTGAGCCAGGAGTTCATGTGG + Intergenic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
947335904 2:229082841-229082863 CTATAGGTCAGAAGTTCTGGTGG - Intronic
948430281 2:237914158-237914180 CTTTGTGTCATGAGTGCAGGTGG - Intergenic
949054751 2:241921768-241921790 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
949054845 2:241922089-241922111 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
1169647405 20:7827959-7827981 TTATGGGTCAGGAATTCAGAAGG - Intergenic
1169843415 20:9964463-9964485 CTGTGCATTATGAGTTCAGGTGG + Intergenic
1169967313 20:11232305-11232327 CTGAGGGTGGGGAGTTCAGATGG - Intergenic
1170114580 20:12843583-12843605 CCTTAGGTCAGGAGTTCAGTTGG + Intergenic
1170455680 20:16530644-16530666 CTGTGGGTCAGGAATCTGGGTGG - Intronic
1170512836 20:17096685-17096707 CTGTGGGTCAGGGGTTTGGATGG - Intergenic
1170852870 20:20020197-20020219 GTGTGGGCCAGGATTTGAGGGGG - Intronic
1170949290 20:20921490-20921512 GTTTGGGTCAGAAGTTCAGCAGG - Intergenic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1171979785 20:31619532-31619554 CTGTGGGTCAGGGATTAAAGTGG - Intergenic
1172809859 20:37639667-37639689 CTGTGGATCAGGGATTCAGAAGG + Intergenic
1172973239 20:38888574-38888596 CCGTGGATGAGGAGTCCAGGGGG - Intronic
1173363095 20:42361802-42361824 CTGTGGGTCAGGAATGCAAGAGG - Intronic
1173745494 20:45433617-45433639 CTGTAGGTCTGGAATTCAGGCGG - Intergenic
1173760416 20:45554800-45554822 CAGTTGGTCAGGAGTAGAGGTGG - Intronic
1173821197 20:46021809-46021831 CTCTGGGTCAGGGCTTCTGGCGG - Exonic
1174337260 20:49871774-49871796 CAGTGGGTCAGGTGCACAGGTGG + Intronic
1174517447 20:51103420-51103442 CTGTAGGTCAGAAGTCCAGGAGG - Intergenic
1174711598 20:52711767-52711789 CTGTAAGTCAGAAGTCCAGGTGG + Intergenic
1174916448 20:54659069-54659091 ATGTGGATCAGGAGATGAGGGGG + Intergenic
1175093989 20:56527510-56527532 CTGTGGGCCTGCAGTTCATGTGG - Intergenic
1175331740 20:58169303-58169325 CTGTGGGTCAGAAATCCAGATGG - Intergenic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1175693682 20:61085003-61085025 CTGTGGATCAGGGATCCAGGTGG - Intergenic
1175809343 20:61849426-61849448 CTGTAGGTCAGAAGTCCAGATGG + Intronic
1175862138 20:62156232-62156254 CTGGGGGTTAGGAGTCAAGGAGG + Intronic
1175950527 20:62581039-62581061 CTCAGGGTCAGGGGTTGAGGAGG - Intergenic
1178257181 21:31064825-31064847 CTGTGGGTCAGGAATTCACAAGG - Intergenic
1179258380 21:39737475-39737497 CGGTCGGTCAGAAGTTCTGGAGG - Intergenic
1180572039 22:16734219-16734241 CTGAGGGTCAGGAGTATAGATGG + Intergenic
1180878820 22:19189127-19189149 GTGTGGATCATGAGGTCAGGAGG - Intronic
1181102331 22:20549791-20549813 CTGTGGGTCAGGAGTGGTGCTGG + Intronic
1181488047 22:23244009-23244031 CAGTAGGTCAGAAGTACAGGTGG + Intronic
1182534974 22:30994208-30994230 CTGTGGGTCAGGAATTGGGCAGG + Intergenic
1182803880 22:33054233-33054255 CTGTGAGTCTGGAGTCGAGGAGG - Intronic
1182953737 22:34401486-34401508 CAGTGCCACAGGAGTTCAGGAGG + Intergenic
1183302470 22:37065107-37065129 CTGGGGGTTAGGAGTGGAGGTGG - Intergenic
1183340925 22:37280972-37280994 CTATGGGTCAGCAGTTTGGGTGG + Intergenic
1183397861 22:37583177-37583199 CTTTGGGGCAGGAATCCAGGTGG - Intergenic
1184690968 22:46117080-46117102 CTGAAGGCCGGGAGTTCAGGTGG + Intergenic
1184879162 22:47294254-47294276 CTGTAGGTCAGAAGTCCAGCAGG - Intergenic
1185399310 22:50607761-50607783 CCATGGGTCTGGAGTTTAGGAGG + Intronic
950714474 3:14837974-14837996 CTGTGGGTCAGCAGTCTAGTGGG + Intronic
950883769 3:16345216-16345238 CTGTGGGCCAGAAATCCAGGTGG - Intronic
952039219 3:29241378-29241400 CGGTGGGAGAGGAGTTCAGCTGG - Intergenic
953920085 3:46945469-46945491 CTTTGAGGCAGGATTTCAGGGGG + Intronic
954363636 3:50135033-50135055 CTGGGGGTCAGGGGTGCTGGGGG + Intergenic
954879077 3:53821812-53821834 CTGTGAGTCAGGAGAACAGCTGG - Intronic
954909635 3:54092935-54092957 GTGTGAGTCAGAAGTCCAGGTGG - Intergenic
955939127 3:64131250-64131272 CTGAGGTCCAGGAGTTCAGCAGG - Intronic
955958883 3:64318815-64318837 CTGTGGGTCAGAAGTCCAAGGGG + Intronic
957106153 3:75890188-75890210 CTGAGGGTCAGGAGTGTAGATGG - Intergenic
957252713 3:77794233-77794255 CTGTGGGTCAGGAATTTAGGGGG - Intergenic
957951111 3:87128027-87128049 CTGTTGGTTGGGAGTTCAGCTGG + Intergenic
959592664 3:108097090-108097112 CTGTAGGTCAGAAGTCCAGTAGG + Intergenic
959773515 3:110128263-110128285 TTGTGGCGCAGGACTTCAGGAGG - Intergenic
961960937 3:130854549-130854571 CTGTGGCTCAGGTGATCAAGCGG + Intronic
961996989 3:131256653-131256675 CTGTAGGTCATGAATTTAGGAGG + Intronic
962271195 3:133979160-133979182 CTGAGGCTCAGGAGTACAAGTGG - Intronic
962596847 3:136954985-136955007 CTTTGGGTGAGGACTTCTGGAGG - Intronic
962719694 3:138160886-138160908 CTGTCGTTCAGGAGTGCAGTGGG - Intergenic
962769386 3:138598469-138598491 CTGTGGGTCAGGAATACAGTAGG + Intergenic
963001743 3:140688058-140688080 CTGTGGGTCAGGCCTGTAGGTGG - Exonic
963935403 3:151047060-151047082 CTGTAGGTCAGAAGTCCAGTGGG - Intergenic
964138560 3:153371522-153371544 CAGTGGGTCAGAAGTTCTGGAGG + Intergenic
965124865 3:164613045-164613067 CTGTAGGTCAGATGTTCAGGTGG - Intergenic
965551278 3:169967130-169967152 CTGTGGGCCTGGAGTTCCTGTGG + Intronic
967149176 3:186632659-186632681 TGGTGGATCAGGAGTTTAGGGGG - Intergenic
968458301 4:710159-710181 CTGTGGGTTGGGAGACCAGGTGG + Intronic
968976692 4:3825790-3825812 CTGTGGGGCAGAAATTCAGGAGG - Intergenic
969175364 4:5394909-5394931 CCGTGGCCCAGGAGTCCAGGTGG + Intronic
969203422 4:5623554-5623576 CTTGAGGTCAGGAGTTCAAGAGG - Intronic
970529946 4:16971213-16971235 CAGTGGGTCAGAAGTTCCTGAGG - Intergenic
970569615 4:17366853-17366875 CTATGGGTCAGGAACCCAGGCGG - Intergenic
971642867 4:29157996-29158018 CCATGAGTCAGGAGTCCAGGTGG + Intergenic
974374157 4:61055159-61055181 CTACGGGTAAGGAGATCAGGTGG - Intergenic
976052550 4:81026304-81026326 CTGTAGGTTAGAAGTTCAGTGGG - Intergenic
976388641 4:84486845-84486867 CTATGGGTCAGGAATCCCGGAGG + Intergenic
977718389 4:100209641-100209663 CAGTTGGTCAGAAGTTCAGGAGG + Intergenic
978344174 4:107748998-107749020 CTTTGGGTCAGGTGCTCAGTTGG + Intergenic
980091488 4:128447594-128447616 CTGTGGGTCAGAAGCTGAGGGGG + Intergenic
981039896 4:140213418-140213440 CTGTGGGTCAGGAGTCTGGGTGG + Intergenic
981675532 4:147339004-147339026 CTGTAGGTCAGGAATTTGGGAGG + Intergenic
981830988 4:149001666-149001688 CTGGAGTTCTGGAGTTCAGGGGG - Intergenic
982772984 4:159415071-159415093 CTTTTGGTCAGAAGTTCTGGAGG + Intergenic
983120667 4:163880889-163880911 CCCTGAGGCAGGAGTTCAGGTGG - Intronic
983133195 4:164047431-164047453 CAGTGGGTCAGAAGTCCATGTGG - Intronic
983176673 4:164596574-164596596 CTGAGGTTCAGGAGTTAATGTGG + Intergenic
983399628 4:167246406-167246428 CTGTGGGTCAGGAATTCAGGAGG - Intergenic
983880408 4:172925803-172925825 CTGTAGGTCAGGAGTCCATGAGG - Intronic
985122928 4:186661771-186661793 TGGTGGGTCAGGAGTTTCGGAGG + Intronic
985258172 4:188090126-188090148 CTGTGCGACAGGAGTCAAGGCGG + Intergenic
985347587 4:189022900-189022922 CTGTGGATCAGGAATTCTGGTGG - Intergenic
985695602 5:1338393-1338415 CTGTGGCGCAGGAGTTGGGGGGG + Intronic
985901291 5:2796729-2796751 CTGTGGGTCAGGATTTAGGATGG + Intergenic
986526866 5:8688445-8688467 CTGGGGGTCAGGAGCTCAGCTGG + Intergenic
986546743 5:8906012-8906034 CTGTGGGACAGCAGGTGAGGGGG - Intergenic
987053248 5:14166113-14166135 TTGTGGGGCAGGAATTTAGGGGG + Intronic
987562139 5:19538264-19538286 CTGTAGGTCAGAAGTCCAGGTGG - Intronic
987571119 5:19660859-19660881 CTGAAGGTCAGAAGTCCAGGTGG - Intronic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
990123407 5:52484193-52484215 CTGTAGGTCAGAAATGCAGGAGG - Intergenic
990550098 5:56867046-56867068 CTTGGGGCTAGGAGTTCAGGAGG - Intronic
991508361 5:67350064-67350086 CTGTGGGGAAGGAGTCCAGCTGG - Intergenic
992050566 5:72936706-72936728 CTGTAGGCCAGGAGCTCAGCTGG + Intergenic
992070495 5:73144308-73144330 CTGTGGGTCAGCAATTCTAGTGG + Intergenic
992784883 5:80160047-80160069 CAGTTGGTCAGAAGTTCTGGAGG + Intronic
993021364 5:82595458-82595480 CTATAGGCCAGGAATTCAGGTGG + Intergenic
994516533 5:100779561-100779583 CTGTGGGCAATGAGTTAAGGAGG - Intergenic
995764711 5:115602459-115602481 CTGTGAGTCAGGGGTTAATGTGG + Exonic
995786722 5:115838870-115838892 CTTGAGGTCAGGAGTTCAAGAGG + Intronic
997304779 5:132829397-132829419 ATGTGGCTCTGGAGTTCAGCAGG + Intronic
997428401 5:133820168-133820190 CTGTGGGGAAGGACTTCTGGGGG - Intergenic
997975298 5:138438501-138438523 CTGTGACTCAGGAGCTCAGGTGG + Intergenic
998078530 5:139255860-139255882 CTGAGGGTCAGGAATTCAGGAGG - Intronic
998533570 5:142908270-142908292 CTGTGGGTCACGAATTCAGGGGG + Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
999260440 5:150235254-150235276 CTGTGGGACAGAAGATCTGGGGG + Intronic
999679153 5:154039085-154039107 CTTGGGGTCGGGAGTGCAGGAGG + Exonic
1001242225 5:170079558-170079580 CTGTGTGCCAGGAGTCCAGGTGG + Intronic
1001835841 5:174831687-174831709 CAGTTGGTCAGAAGTTCTGGTGG - Intergenic
1002659765 5:180783758-180783780 CAGTTGGTCAGAAGTTCTGGAGG + Intergenic
1003166880 6:3687352-3687374 CTGTGAGTCAAGAATCCAGGAGG + Intergenic
1003992119 6:11496656-11496678 CTATGGGCCAGGAATTCAGAAGG + Intergenic
1004116612 6:12774624-12774646 AGGTGGATCAGGAGGTCAGGAGG - Intronic
1004164016 6:13239825-13239847 CTGTGTGTCAGGAGGAGAGGAGG + Intronic
1004320989 6:14631296-14631318 CTGTGGGTCAGGCATTCAGCAGG + Intergenic
1005200488 6:23339230-23339252 CTATGGGTCAGAAATCCAGGAGG + Intergenic
1005601158 6:27427635-27427657 ATGTGGGTCTTGAGCTCAGGAGG - Intergenic
1005716015 6:28549363-28549385 TGGTTGGTCAGGAGTTCTGGAGG - Intergenic
1005799024 6:29400303-29400325 CTGTGGGTCAGAAATTGGGGAGG + Intronic
1006313052 6:33274889-33274911 CTTTGGTTCATGAGTTCAGATGG + Intronic
1006421002 6:33934098-33934120 CGGTTGGTCAGAAGTACAGGTGG - Intergenic
1006881451 6:37343574-37343596 CTGTGGGTCAGGGATTCAGGTGG + Intergenic
1007308037 6:40922554-40922576 CTGTAGCTCAGAAGTCCAGGAGG + Intergenic
1008116050 6:47551673-47551695 CTGTGAGTCAAGAATTCAGATGG + Intronic
1008211112 6:48727051-48727073 AGGTAGGTCAGAAGTTCAGGAGG - Intergenic
1008738310 6:54574160-54574182 CAGTTGGTCAGAAGTTCTGGAGG + Intergenic
1008952497 6:57175911-57175933 CAGTTGGTCAGAAGTTCTGGAGG + Intronic
1009370436 6:62893999-62894021 CCGTGGGTCAGGGGTTAGGGTGG - Intergenic
1011123898 6:83985924-83985946 CTGTGGGTCTTGACTTCATGTGG - Intergenic
1011786692 6:90854421-90854443 CTGTGGTCCAGGAGAGCAGGTGG + Intergenic
1013130812 6:107230906-107230928 CTGTAGGTTAAGAATTCAGGAGG + Intronic
1014330436 6:120056952-120056974 CTGTGGTTCAAGAGTACAGTTGG - Intergenic
1014579872 6:123123786-123123808 CTGTGGTTCAGGAATTCAAATGG - Intergenic
1014595930 6:123338686-123338708 TAGTAGGTCAGGACTTCAGGAGG - Intronic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015285608 6:131483360-131483382 CTTGAGGTCAGGAGTTCAGCTGG - Intergenic
1016725231 6:147357584-147357606 CTGCGGGTGAGGAGATCAGCTGG + Intronic
1019595637 7:1857124-1857146 CTGTTGGTGAGGAGTCCTGGAGG - Intronic
1019951684 7:4378310-4378332 CTGTGGGTCATGAATTCAGGAGG + Intergenic
1020625256 7:10570088-10570110 CTTTGGGTGAGTAGTTAAGGAGG - Intergenic
1021490609 7:21216207-21216229 CTGGGTGTCAGGATTTCAGATGG + Intergenic
1021516996 7:21500423-21500445 CTCTAGGTCAGGAGTTCAAGGGG + Intronic
1021632968 7:22664911-22664933 CAGAGGGGCAGGAGTTGAGGGGG + Intergenic
1022485602 7:30775247-30775269 TAGTTGGTCAGAAGTTCAGGTGG - Intronic
1023040937 7:36172843-36172865 CAGTTGGTCAGAAGTTCTGGAGG + Intronic
1023651896 7:42379575-42379597 CATCAGGTCAGGAGTTCAGGAGG + Intergenic
1024263693 7:47590449-47590471 CGGTGGATCATGAGGTCAGGAGG + Intergenic
1024996434 7:55276161-55276183 TTGTGGGTCAGGAATTCAGGAGG - Intergenic
1026072035 7:67130445-67130467 GGGTGGATCACGAGTTCAGGAGG + Intronic
1026704869 7:72681809-72681831 GGGTGGATCACGAGTTCAGGAGG - Intronic
1028054477 7:86225569-86225591 ATGGGGGGCAGGAGGTCAGGGGG + Intergenic
1029492669 7:100880798-100880820 ATGTGGGTCTGGAGCACAGGCGG + Intronic
1029648872 7:101876828-101876850 CTTGAGGTCAGGAGTTCAAGAGG - Intronic
1031454737 7:121965172-121965194 CTGTGGGTCAGGAGCTGAGGAGG + Intronic
1031479172 7:122257560-122257582 CTGTTGGTCAGAAGTTCCAGAGG + Intergenic
1031615315 7:123872669-123872691 CTGTGGCTCAAGCTTTCAGGTGG + Intronic
1032580237 7:133097217-133097239 CTCTGGGTCAGGAGCTGATGTGG + Intergenic
1033463818 7:141572468-141572490 CTGAGGCTCAGAGGTTCAGGTGG - Intronic
1033986565 7:147233333-147233355 CTGTGAGTCAACAGTTCAGCTGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034526632 7:151667875-151667897 CTGTGGGTCAGCAATTTGGGTGG - Intronic
1034866180 7:154644456-154644478 CTGTAGGTAGTGAGTTCAGGAGG + Intronic
1035100152 7:156389651-156389673 CGGTGGATCAGAAATTCAGGAGG + Intergenic
1036098255 8:5749262-5749284 ATGTTAGTCAAGAGTTCAGGGGG + Intergenic
1037607991 8:20453633-20453655 CTGTGGATCAGGAGCACTGGCGG - Intergenic
1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG + Intronic
1038514057 8:28169345-28169367 CTGTGGGTCAGAAATTCAGCAGG + Intronic
1039331589 8:36543291-36543313 CAGTTGGTCAGGGTTTCAGGAGG - Intergenic
1040548896 8:48423312-48423334 CTGTGGGTCATGAGGTCATGAGG - Intergenic
1041016575 8:53597590-53597612 CAGTGGGACAGGAATTCTGGAGG - Intergenic
1042303220 8:67308207-67308229 CTGTGTGTCAGGAATTCAGATGG - Intronic
1042539191 8:69890828-69890850 CCTGAGGTCAGGAGTTCAGGGGG + Intergenic
1043496621 8:80808053-80808075 CTGTGTGTCAGAGGTACAGGAGG + Intronic
1043559010 8:81468935-81468957 CTGTTGGTCAGAAGTTCCAGCGG - Intergenic
1043615569 8:82120824-82120846 CCTTAGGTCAGAAGTTCAGGTGG + Intergenic
1045221192 8:100201989-100202011 CTGTTGGTGAGAAGTTCTGGAGG + Intronic
1045477654 8:102567004-102567026 CTGTAGGTCAGAAATTCAGATGG + Intergenic
1045498570 8:102728445-102728467 CTGGGGGTCAGCAGTTAAAGTGG + Intergenic
1045517390 8:102872170-102872192 CTGTAGGTCAGAAGTTCAGGAGG - Intronic
1045610624 8:103837150-103837172 CTATAGGTCAGAAGTCCAGGTGG + Intronic
1046346936 8:112942113-112942135 CTGGTTGTCAGGAGTTCAGGGGG - Intronic
1046516443 8:115267916-115267938 CTGTGGGTCAGTAATTCAGGAGG - Intergenic
1047513387 8:125532487-125532509 CTGTGGGTCAGGAATCTGGGTGG + Intergenic
1048172528 8:132121482-132121504 CTGAGGGTTAAGAGTCCAGGTGG - Exonic
1048349457 8:133604215-133604237 CAGTGGGTCATGAGGTCTGGGGG - Intergenic
1048430566 8:134366839-134366861 CTGTGGACCAGGAGGTCATGTGG - Intergenic
1048970044 8:139640329-139640351 CAGTGCGTCAGGGGCTCAGGAGG - Intronic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049312010 8:141938319-141938341 CTGAGGGTCAGGGGTCCTGGTGG - Intergenic
1049315244 8:141962663-141962685 CTGGGGCTCAGGAATGCAGGGGG + Intergenic
1049393679 8:142385854-142385876 CTGTAGGTCAGAAGTCCAGCTGG + Intronic
1050877085 9:10651819-10651841 CAGTGGGTCAGGCTTTCAGGTGG - Intergenic
1051724189 9:20071801-20071823 CTATTGGTCAGAAGTTCTGGAGG - Intergenic
1051837467 9:21357217-21357239 ATCTGGGTCAGGAGATGAGGGGG - Intergenic
1051941488 9:22510685-22510707 GTGTGGGTCAGGATTTAATGAGG + Intergenic
1052697938 9:31903000-31903022 CTTTAGGTGAGAAGTTCAGGGGG + Intergenic
1052774984 9:32724169-32724191 CTGTGGATCAGGAATGCGGGTGG + Intergenic
1055117317 9:72619539-72619561 CTGTGTGGCAGGATTACAGGTGG + Intronic
1055407450 9:75989526-75989548 CTGAGGGTCAGGAATTCAGACGG + Intronic
1055651109 9:78408007-78408029 CTTTCCTTCAGGAGTTCAGGGGG + Intergenic
1056570458 9:87810186-87810208 CTGTAGGTCAGAAGTCCAGTCGG - Intergenic
1056945211 9:90989198-90989220 CTGTAGGTCAGAAGTCCAAGTGG + Intergenic
1056966387 9:91166114-91166136 CTGCAGGTCAGAAGTCCAGGCGG + Intergenic
1057184413 9:93048875-93048897 CTCAGGGTGAGGAGTGCAGGGGG + Intergenic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057693974 9:97310763-97310785 ATGAGGGTCAGGAGTTTTGGGGG - Intronic
1058833231 9:108837887-108837909 CGGTTGGTCAGAAGTGCAGGTGG + Intergenic
1059639732 9:116204942-116204964 CTTTGGGACAGGAGTCCATGTGG - Intronic
1060104936 9:120867793-120867815 CTGAGATTCAGGACTTCAGGGGG + Intronic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1062144216 9:134979832-134979854 CTGTGGGGCAGGAGTTCTTCAGG + Intergenic
1062703116 9:137918435-137918457 CTGTGGGTCAGGAATCTGGGAGG + Intronic
1186050846 X:5593318-5593340 CTGTGGGTCAGGAAATCCAGAGG - Intergenic
1186894296 X:13990569-13990591 CTGGGGGTCAGGAGTGAAGGAGG - Intergenic
1187289426 X:17939027-17939049 CTGTGAGCCAGGTATTCAGGCGG + Intergenic
1187340736 X:18419408-18419430 CTGAGTGTCAGGAATTCAGGAGG + Intergenic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187572775 X:20521676-20521698 CAGTGGGTCAGGAATTCAGGTGG + Intergenic
1187673577 X:21692667-21692689 CTGTGGGTGAGAAGTCCAGGTGG - Intergenic
1189672334 X:43424357-43424379 CTGTGGGTCAGGGGTTCATATGG - Intergenic
1190360268 X:49642670-49642692 CTGTAAGTCAGTAGTTCAGTTGG - Intergenic
1191800836 X:65077479-65077501 TTGTGGATCAGGAGTTAAGATGG + Intergenic
1192052273 X:67735448-67735470 CTGTGGTGCAGGAGTTCACTGGG + Intergenic
1192205957 X:69096371-69096393 CTTGGGCTCAGGACTTCAGGTGG - Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1194081331 X:89468541-89468563 CTCTAAGTCAGAAGTTCAGGAGG + Intergenic
1195020039 X:100818206-100818228 CTGTAGGTCAGAAGTTTGGGTGG - Intergenic
1197006129 X:121500670-121500692 CTGCAGGTCAGAAGTCCAGGAGG - Intergenic
1197858501 X:130945262-130945284 CTGAGGGTTAGGAATTCAGGAGG + Intergenic
1198111871 X:133509263-133509285 ATGAGAGACAGGAGTTCAGGAGG + Intergenic
1199981450 X:152922791-152922813 CTGGGAGCCAGGAGCTCAGGTGG + Exonic
1200059609 X:153478411-153478433 CTGTGGGTCAGGATGACATGAGG - Intronic
1200149679 X:153944957-153944979 CTGTGGGGCAGGGGTGCAGCAGG + Intergenic
1200305133 X:155017328-155017350 CTGTGAGTTAGAAGTCCAGGTGG - Intronic
1200434003 Y:3124740-3124762 CTCTAAGTCAGAAGTTCAGGAGG + Intergenic
1201339468 Y:12917786-12917808 GTGTGGATCATGAGGTCAGGAGG - Intronic