ID: 902890230

View in Genome Browser
Species Human (GRCh38)
Location 1:19438031-19438053
Sequence ATGGATGGATTCCTCGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890230_902890248 30 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
902890230_902890237 17 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890230_902890247 29 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890247 1:19438083-19438105 CCTACGTCAGGGGAGGGGACCGG 0: 1
1: 0
2: 2
3: 29
4: 309
902890230_902890242 22 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890242 1:19438076-19438098 ACTACCTCCTACGTCAGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 68
902890230_902890243 23 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890243 1:19438077-19438099 CTACCTCCTACGTCAGGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 76
902890230_902890238 18 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890230_902890240 19 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73
902890230_902890244 24 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890244 1:19438078-19438100 TACCTCCTACGTCAGGGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890230 Original CRISPR ATGGATGGATTCCTCGTCTG GGG (reversed) Intronic
902890230 1:19438031-19438053 ATGGATGGATTCCTCGTCTGGGG - Intronic
904003973 1:27353738-27353760 CTGGATGGATTCCACACCTGAGG + Exonic
905495756 1:38384542-38384564 AAGGATGGATTCCTTGGCTAAGG - Intergenic
908506215 1:64803002-64803024 ATGGATGGATTCATCAGATGTGG - Exonic
910084814 1:83387590-83387612 ATGGATGGATTAATAATCTGTGG + Intergenic
912198876 1:107432973-107432995 ATGGATTGTTTTCTAGTCTGTGG - Intronic
914839517 1:151236700-151236722 CTGGATGGATTCCATGGCTGTGG - Exonic
915744260 1:158144011-158144033 ATTAATGGATTCCTTGTATGGGG - Intergenic
916709374 1:167389828-167389850 ATTCATGGATTCCACATCTGTGG + Intronic
916806487 1:168265958-168265980 AGGGAAGGAATCCTCCTCTGGGG - Intergenic
919362817 1:196616196-196616218 ATCCATGGATTCCTCATCTGAGG + Intergenic
919983684 1:202658361-202658383 CTGGCTGGCTTCCTGGTCTGTGG - Intronic
923715738 1:236423483-236423505 ATGGATGAGATCCTCCTCTGAGG - Intronic
1062962617 10:1584705-1584727 GTGAATGGATACATCGTCTGTGG + Intronic
1064800606 10:19066273-19066295 ATCTATGGATTCCTCATCTTTGG - Intronic
1065714588 10:28553702-28553724 ATCCATGGATTCCACATCTGTGG + Intronic
1071438889 10:85672326-85672348 TTGGATGGAGTCTTCCTCTGTGG + Intronic
1072290497 10:93960452-93960474 CTGGATGGATTCCATGGCTGTGG + Intergenic
1074632444 10:115273497-115273519 ATGTATGGATTCATGGGCTGTGG - Intronic
1074801233 10:117003768-117003790 ATGGAAGGATCCCTGCTCTGTGG - Intronic
1084470932 11:69358599-69358621 ATGGGTGGGTTGCTCTTCTGGGG + Intronic
1087366674 11:97228684-97228706 ATCCATGGATTCCACATCTGTGG + Intergenic
1087752827 11:102024351-102024373 ACTGATGGAATCCTGGTCTGTGG - Intergenic
1091483106 12:855001-855023 ATTCATGGTTTCCACGTCTGTGG - Intronic
1097746688 12:63311020-63311042 GTGGCTGGAGTCATCGTCTGAGG + Intergenic
1098227774 12:68342499-68342521 AGGGATGCATTCCTACTCTGGGG + Intergenic
1098655927 12:73028978-73029000 ATGGATTCATTCCTCGTCCTGGG - Intergenic
1105206768 13:18232371-18232393 ATGGACGGCGTCCTCGTCGGTGG - Intergenic
1106532211 13:30603943-30603965 ATCCATGGATTCCACATCTGTGG - Intronic
1108349478 13:49578376-49578398 ATCCATGGATTCCACATCTGTGG - Intronic
1108749595 13:53434582-53434604 ATGAAGGGATTCCTCGTATGAGG + Intergenic
1109587552 13:64426492-64426514 ATGGATGGAGTCCTTTTCTTGGG - Intergenic
1111433219 13:88171969-88171991 ATGGAGGGATTCTTCATCTAAGG + Intergenic
1117026717 14:51628131-51628153 ATGCATGGATTCTGCATCTGTGG - Intronic
1119157441 14:72424029-72424051 CTGGATGGCTTCATCCTCTGAGG - Intronic
1124879886 15:33632169-33632191 ATGGATTGAGCCCTGGTCTGTGG + Intronic
1133500988 16:6366492-6366514 AAGAATGGATTCGTTGTCTGAGG + Intronic
1139293815 16:65882142-65882164 ATGGATTTATTCCCAGTCTGGGG - Intergenic
1145202129 17:20955707-20955729 ATGCATGGCTTCCTCATCTAGGG - Intergenic
1150157651 17:62867804-62867826 AAGGATAGATTCCTCACCTGTGG - Intergenic
1154201122 18:12301620-12301642 ATGGAGGGAGGCCTCCTCTGGGG - Intergenic
1156551478 18:38023644-38023666 ATGGATGGTTGCCTGGCCTGAGG - Intergenic
1156795847 18:41045429-41045451 ATGCAGGGGTTCCTTGTCTGTGG + Intergenic
1157427898 18:47599881-47599903 ATGGATGGATTCCTCACATCTGG - Intergenic
1157499647 18:48180521-48180543 AGGGATGGTTTCCTTCTCTGGGG + Intronic
1157579401 18:48764670-48764692 ATGGCTGGCTTCCTCCACTGTGG - Intronic
1157640749 18:49211577-49211599 ATGAATGGATTGTTCGTTTGTGG - Intronic
1159245016 18:65794649-65794671 ATGGTTGGATTTTTCGTGTGGGG + Intronic
1160216416 18:76936277-76936299 ATGAATGGATGGCTCGACTGTGG + Intronic
1162040779 19:7969772-7969794 AAGTGTGGCTTCCTCGTCTGGGG + Intronic
1165722935 19:38092612-38092634 ATGGATGGATCCCAGGCCTGTGG - Intronic
925936818 2:8771809-8771831 ATGGCTGGATTCCTCTTCCCTGG + Intronic
931821120 2:65953403-65953425 ATGGAAGCTTTCCTCCTCTGGGG + Intergenic
935648010 2:105357752-105357774 ATCCATGGATTCCTCATCTGTGG - Intronic
937934061 2:127228445-127228467 ATTGCTGAATTCCTCGTATGTGG + Intergenic
944130125 2:196338581-196338603 ATGGATGAGATCCTAGTCTGAGG - Intronic
947836078 2:233176624-233176646 ATGGATGGATGGCTAGTCGGTGG + Intronic
948053022 2:234992501-234992523 ATGGATGCATTCCTGCTGTGTGG + Intronic
948600891 2:239106933-239106955 ATGGTGGGATTCCTGGTGTGGGG + Intronic
1178430428 21:32513876-32513898 ATCCATGGATTCCTCATCTATGG + Intronic
1179211590 21:39329536-39329558 ATTGATGGATATCTCGGCTGGGG - Intergenic
953698500 3:45178492-45178514 ATGGAGGGCTGCCTCTTCTGTGG + Intergenic
954244356 3:49318939-49318961 ATGGATGGATTCCTTGGTGGTGG - Intronic
956250741 3:67231368-67231390 AGGGATGGCTTCTCCGTCTGTGG - Intergenic
958821684 3:98981303-98981325 ATTGAAGGCTTCCTGGTCTGAGG + Intergenic
958959415 3:100494857-100494879 ATGGAGAGTTTCCTCCTCTGTGG + Intronic
966428384 3:179805590-179805612 ATCCATGGGTTCCTCATCTGTGG - Intronic
967319241 3:188179226-188179248 ATGCATGGAATCTTCGGCTGTGG + Intronic
969118354 4:4888663-4888685 ATGGATCTATTCATGGTCTGGGG + Intergenic
970093415 4:12434804-12434826 ATATATGGTTTCCTGGTCTGTGG + Intergenic
977688618 4:99877526-99877548 ATGGATTGCATCCTCTTCTGAGG + Intergenic
978814028 4:112882508-112882530 ATGGATGGAAACCTAATCTGGGG + Intronic
979199454 4:117959400-117959422 AGGGAAGGATTCCTCTTCAGAGG + Intergenic
980830461 4:138124985-138125007 ATGAATAGATACCTGGTCTGTGG + Intergenic
981815974 4:148830740-148830762 AAGGAAGGATTTCTGGTCTGTGG + Intergenic
994307220 5:98221015-98221037 ATGGATGGACTCCTAGACCGAGG - Intergenic
995438149 5:112160618-112160640 ATGTCTGGATACCTCCTCTGTGG + Intronic
997879292 5:137574969-137574991 AGGGATGGATTCCTCATGTGTGG - Intronic
1003280679 6:4688918-4688940 ATCCATGGATTCCACGTCTGTGG + Intergenic
1004006959 6:11645813-11645835 AGGGATGGGTTCCTTGTCTCTGG + Intergenic
1017360064 6:153557925-153557947 ATCCATGGACTCCTCATCTGTGG + Intergenic
1018644290 6:165933006-165933028 CTGGGTTGATTCCTGGTCTGGGG + Intronic
1018913664 6:168119279-168119301 ATGGATGGTTTCCACGGCAGTGG - Intergenic
1024997382 7:55282796-55282818 AAGGATGGCATCTTCGTCTGGGG + Intergenic
1030581037 7:111356232-111356254 ATCCATGGGTTCCTCATCTGTGG + Intronic
1031074462 7:117199393-117199415 ATGGACGAATTCCTCTTCTGAGG - Intronic
1032441476 7:131945819-131945841 TTGGATGGTGTCCTCATCTGAGG + Intergenic
1037521779 8:19686779-19686801 ATGGATGGTATCCCTGTCTGGGG - Intronic
1037768209 8:21784572-21784594 GTGGATGGATTCCTGTTCTCTGG - Intronic
1039442210 8:37602923-37602945 ATGACTGGATTCCTGGCCTGTGG - Intergenic
1045057889 8:98384993-98385015 ATGGATGGATGCCTGCTGTGTGG - Intergenic
1045211121 8:100100626-100100648 ATCCATGGATTCCACATCTGTGG - Intronic
1057450152 9:95151194-95151216 ATGGTTCGCTTCCTCCTCTGAGG + Intronic
1059326931 9:113509473-113509495 CTGGATGGATTCTTCTTCTTTGG + Intronic
1062623894 9:137434456-137434478 ATGGATGGAGTCCAGGCCTGGGG - Exonic