ID: 902890231

View in Genome Browser
Species Human (GRCh38)
Location 1:19438032-19438054
Sequence GATGGATGGATTCCTCGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890231_902890242 21 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890242 1:19438076-19438098 ACTACCTCCTACGTCAGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 68
902890231_902890238 17 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890231_902890244 23 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890244 1:19438078-19438100 TACCTCCTACGTCAGGGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 85
902890231_902890240 18 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73
902890231_902890248 29 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
902890231_902890237 16 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890231_902890243 22 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890243 1:19438077-19438099 CTACCTCCTACGTCAGGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 76
902890231_902890247 28 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890247 1:19438083-19438105 CCTACGTCAGGGGAGGGGACCGG 0: 1
1: 0
2: 2
3: 29
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890231 Original CRISPR GATGGATGGATTCCTCGTCT GGG (reversed) Intronic
901121222 1:6895638-6895660 GTTTGATGGATTCCCCGTATGGG - Intronic
902399705 1:16151207-16151229 GATGGCTGGAATCCTGGCCTGGG - Intronic
902890231 1:19438032-19438054 GATGGATGGATTCCTCGTCTGGG - Intronic
914785561 1:150826208-150826230 AATAGATGTTTTCCTCGTCTGGG - Intronic
918181167 1:182086840-182086862 GAAGGATGGATTCCATTTCTAGG + Intergenic
918306343 1:183250293-183250315 GATTGATGGAGTCCGCTTCTGGG + Exonic
920594165 1:207251712-207251734 GGTGCATGCATTCCTGGTCTAGG - Intergenic
922464037 1:225834426-225834448 GATGGACGGAAACCTCGACTTGG + Intronic
1063838867 10:10047748-10047770 GTTGGATTGATTCCTGGTGTGGG - Intergenic
1065681361 10:28236699-28236721 GATGCATGGATTGCTCATTTGGG - Intronic
1066794138 10:39100136-39100158 GATGTGTGGATTCCTCTTCCAGG + Intergenic
1071426868 10:85566044-85566066 TATGAATGGATGCCTCCTCTAGG + Intergenic
1073282953 10:102368138-102368160 TATGGATGAACTCCTAGTCTTGG + Intronic
1074714173 10:116202931-116202953 GATGGATTGATTCCTCTACCTGG - Intronic
1077368831 11:2172197-2172219 GGAGGCTGGATTCCCCGTCTTGG - Intergenic
1081485992 11:43529624-43529646 GATGGATGGGTTACTCTTATAGG - Intergenic
1085252401 11:75152466-75152488 GTGGGATGGATGCCTCCTCTCGG + Intronic
1089327264 11:117665892-117665914 GAGCAATGGATTCCTCATCTGGG - Intronic
1097288052 12:57892737-57892759 AGTGGATGGATTTCTCTTCTTGG + Intergenic
1098655928 12:73028979-73029001 CATGGATTCATTCCTCGTCCTGG - Intergenic
1101375848 12:104170691-104170713 GGTGGAAGGATTGCTGGTCTGGG + Intergenic
1102175421 12:110870567-110870589 GATGGAGGGATGCATCCTCTTGG - Intronic
1103228327 12:119306854-119306876 GATGAATGGATTCTTTTTCTGGG - Intergenic
1104008406 12:124912064-124912086 GAGGGATGCCTTCCTTGTCTTGG + Exonic
1104008438 12:124912292-124912314 GAGGGATGCCTTCCTTGTCTTGG + Exonic
1104008470 12:124912520-124912542 GAGGGATGCCTTCCTTGTCTTGG + Exonic
1104008502 12:124912748-124912770 GAGGGATGCCTTCCTTGTCTTGG + Exonic
1109360788 13:61292685-61292707 CATGCATGGATTCCTTTTCTAGG + Intergenic
1109587553 13:64426493-64426515 GATGGATGGAGTCCTTTTCTTGG - Intergenic
1109820752 13:67650448-67650470 GATGCATCAATTCCTCTTCTAGG - Intergenic
1112096564 13:96138550-96138572 GATGGATGTATTCATCATCTTGG - Intronic
1114476626 14:22999782-22999804 GATGGATGTATTCCTTATTTAGG - Intronic
1117242589 14:53849836-53849858 AATGGATGAATGCCTAGTCTTGG - Intergenic
1118816432 14:69317473-69317495 GATGCTTGGATTCCTGTTCTAGG + Intronic
1123754372 15:23385556-23385578 GCTGGCTGGGTTCCTCTTCTTGG - Intergenic
1128214637 15:65925734-65925756 CATGTATGGATTCCTAGCCTAGG - Intronic
1133911432 16:10069838-10069860 GAAGGATAGATCCCACGTCTTGG + Intronic
1135638675 16:24100982-24101004 GTTGTATGGATTCCCAGTCTGGG + Intronic
1138428876 16:56955002-56955024 GATGGATGGAATCCCTGTATTGG + Intergenic
1139306816 16:65993653-65993675 GATGGATGGATCCCTCTTACTGG - Intergenic
1140843193 16:78861286-78861308 GATGGATGGATGCATGGACTGGG - Intronic
1143119108 17:4596395-4596417 GAGGGATGAGTTCCTCTTCTGGG - Intronic
1143243885 17:5467326-5467348 GATGGAGAGTTTCCTGGTCTCGG - Intronic
1144213657 17:13035950-13035972 GATAGAAGGTTTCCTCCTCTTGG + Intergenic
1145202130 17:20955708-20955730 AATGCATGGCTTCCTCATCTAGG - Intergenic
1146432978 17:32816062-32816084 GATGAATGGATTCCTTGTTTAGG - Intronic
1148056132 17:44797056-44797078 GATATATAGATTCCTAGTCTGGG - Intergenic
1152325094 17:79631490-79631512 GGTGGATGTCTTCCTGGTCTGGG - Intergenic
1153254252 18:3154962-3154984 GATGGAGGGAGTCCTATTCTCGG - Exonic
1157499646 18:48180520-48180542 GAGGGATGGTTTCCTTCTCTGGG + Intronic
1160532282 18:79572425-79572447 TATGGTTGGATTCCACTTCTAGG - Intergenic
1162480435 19:10924101-10924123 GATGGAGGGGTCCCTCCTCTGGG + Exonic
1162840468 19:13352758-13352780 GATGCATGGTTCCCTAGTCTAGG - Intronic
931821119 2:65953402-65953424 GATGGAAGCTTTCCTCCTCTGGG + Intergenic
936241789 2:110794170-110794192 GAAGGATGGATTCCTCACCTGGG - Exonic
943588124 2:189764387-189764409 CATTGGTAGATTCCTCGTCTAGG + Intergenic
944396394 2:199272474-199272496 TGTGGATGGCTTCCTGGTCTGGG + Exonic
948600890 2:239106932-239106954 GATGGTGGGATTCCTGGTGTGGG + Intronic
1173430344 20:42982278-42982300 GATGGATGGCTTCTTAGTCATGG - Intronic
1173640717 20:44600045-44600067 GATAAATGGATTCCTGGCCTTGG - Intronic
1173841700 20:46161496-46161518 GAAGGATGGACACCTCTTCTTGG - Intergenic
1174911264 20:54610427-54610449 GATAGATGGCCTCCCCGTCTCGG - Exonic
1176813555 21:13572265-13572287 CATGGGTGCATTCCACGTCTTGG - Intergenic
1177319380 21:19500525-19500547 GCTGGATGGATTGCTCTTCCTGG - Intergenic
960221376 3:115113335-115113357 GATGGGTGAATTCCTCTTCCAGG + Intronic
961689845 3:128661269-128661291 CCTGAATGGATTCCTCCTCTTGG - Intronic
962040893 3:131706514-131706536 TCTGAATGGATTCCTCCTCTTGG + Intronic
963033206 3:140999731-140999753 GATGCATGCATTCCTCTTTTTGG + Intergenic
969089833 4:4685436-4685458 GGAGGATGGATTCCTCTTCCTGG + Intergenic
969284443 4:6194115-6194137 GATGGATGGATGCCGGGGCTGGG + Intronic
974248533 4:59355195-59355217 GTTGGGTTGATTCCACGTCTTGG + Intergenic
975278225 4:72527827-72527849 GTTGGATGAATTCTTCCTCTGGG - Intronic
979039459 4:115768369-115768391 GATAGATGTATTTCTTGTCTTGG - Intergenic
987763953 5:22201263-22201285 GATGGATTGATTCCGTATCTTGG - Intronic
990509416 5:56476888-56476910 GATAGATAGATTCCTTGGCTGGG - Intronic
993265845 5:85725400-85725422 GACAGAGGGATTCCTTGTCTTGG - Intergenic
995747332 5:115417699-115417721 CATGGATGAATTCCTGGTCTAGG - Intergenic
995844730 5:116481465-116481487 GATGGATGAGTTTCTCCTCTGGG + Intronic
1002711499 5:181197856-181197878 GATGGATGGAAACCTCTCCTGGG - Intronic
1008047604 6:46867284-46867306 GCTTGATTGATTCCTCTTCTGGG + Intronic
1017013288 6:150079620-150079642 GATGGATTCCTTCCTTGTCTTGG - Intergenic
1021489565 7:21204020-21204042 CATTGATAGATTCCTAGTCTGGG + Intergenic
1024038962 7:45534642-45534664 GAGGGATGCCTTCCTTGTCTTGG + Intergenic
1028598837 7:92578669-92578691 GATGGCTAGATTCTCCGTCTAGG + Intronic
1033315311 7:140292296-140292318 GATAGATGCATTCCTCTTTTGGG + Intergenic
1033437816 7:141349917-141349939 GATGCATGGATTCTTCCTCAGGG - Intronic
1037290587 8:17345572-17345594 GAGGGAGGGATTCCTGCTCTAGG - Intronic
1037521780 8:19686780-19686802 GATGGATGGTATCCCTGTCTGGG - Intronic
1049201747 8:141343747-141343769 GATGGGGAGATTCCTCGCCTGGG + Intergenic
1059071937 9:111147064-111147086 GATGGATGGAATTGTCTTCTAGG - Intergenic
1059893558 9:118833265-118833287 GATGGAAACATTCCTCCTCTTGG - Intergenic
1061504881 9:131026221-131026243 GAGGTATGGAATCCTGGTCTAGG - Intronic
1062623895 9:137434457-137434479 GATGGATGGAGTCCAGGCCTGGG - Exonic
1186264394 X:7816469-7816491 GATGGAAGTATTCCTGGGCTGGG + Intergenic
1186500957 X:10050182-10050204 GATGCATGGCTTCCTCTTCAGGG - Intronic
1195458798 X:105100406-105100428 GATGGAGGGATTCCTTCTCAGGG + Intronic
1199188814 X:144946714-144946736 GATGGATTGATCCCTAGTATCGG - Intergenic
1200984151 Y:9288449-9288471 GCTGGATGGAGTCCTCCTCAAGG + Intergenic
1201673126 Y:16547675-16547697 TCTGAATGGATTCCTCCTCTTGG - Intergenic
1201894276 Y:18976962-18976984 GAAGGATGGGTTCCTAGTTTTGG - Intergenic