ID: 902890232

View in Genome Browser
Species Human (GRCh38)
Location 1:19438033-19438055
Sequence GGATGGATGGATTCCTCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890232_902890237 15 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890232_902890238 16 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890232_902890243 21 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890243 1:19438077-19438099 CTACCTCCTACGTCAGGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 76
902890232_902890247 27 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890247 1:19438083-19438105 CCTACGTCAGGGGAGGGGACCGG 0: 1
1: 0
2: 2
3: 29
4: 309
902890232_902890242 20 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890242 1:19438076-19438098 ACTACCTCCTACGTCAGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 68
902890232_902890248 28 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
902890232_902890244 22 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890244 1:19438078-19438100 TACCTCCTACGTCAGGGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 85
902890232_902890240 17 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890232 Original CRISPR GGATGGATGGATTCCTCGTC TGG (reversed) Intronic
902399706 1:16151208-16151230 GGATGGCTGGAATCCTGGCCTGG - Intronic
902890232 1:19438033-19438055 GGATGGATGGATTCCTCGTCTGG - Intronic
908801252 1:67883105-67883127 GGATGGATGGATAGATGGTCAGG - Intergenic
918306342 1:183250292-183250314 GGATTGATGGAGTCCGCTTCTGG + Exonic
920017632 1:202926751-202926773 GAATGGAGGGATTCCACTTCGGG + Intronic
924843223 1:247736709-247736731 GGATGGATGGTTTGCTAGTTTGG + Intergenic
1066137949 10:32469699-32469721 TGATGGATGGCTTCCTGGTAAGG - Intronic
1070475475 10:76825019-76825041 GGATGGATAGAGTCCTTGTAGGG - Intergenic
1075343760 10:121667372-121667394 GGATGGATGGATTGTTAGACAGG + Intergenic
1077537459 11:3131336-3131358 GGATGGATGGATGCCTGGAAGGG - Intronic
1084413341 11:69016463-69016485 GGATGGATGGATGGATGGTCTGG - Intergenic
1091207067 11:133829127-133829149 GGATGCATGGAATTCTCTTCAGG - Intergenic
1097171189 12:57114182-57114204 GGATTGATTGATTCCTTCTCAGG + Intronic
1098739058 12:74147380-74147402 GGATAGATGGATGCATTGTCAGG - Intergenic
1103228328 12:119306855-119306877 GGATGAATGGATTCTTTTTCTGG - Intergenic
1106833687 13:33611863-33611885 GGAAGGATGGCTTCCTCACCAGG + Intergenic
1114811997 14:25911803-25911825 GGCTGGAGGGATTGCTCGTTTGG + Intergenic
1118724753 14:68621177-68621199 GGATGGATGGATGCATGGACAGG - Intronic
1122416180 14:101550626-101550648 GGATGGATGGATGCATGGACAGG + Intergenic
1122741703 14:103875368-103875390 GGATGGATGGATTGATGGACAGG + Intergenic
1131276236 15:90983918-90983940 AGATGGAAGGCTTCCTCGTAGGG - Intronic
1132653661 16:1032578-1032600 GGATGGATGGATTGATGGACTGG - Intergenic
1132653822 16:1033351-1033373 GGATGGATGGATTGATGGACTGG - Intergenic
1132653872 16:1033587-1033609 GGATGGATGGATTGATGGACTGG - Intergenic
1134663866 16:16004034-16004056 GGATGGATGGGTTCATGGTTGGG + Intronic
1135585720 16:23669469-23669491 GGCTGGATACCTTCCTCGTCTGG - Exonic
1139797904 16:69497901-69497923 GGAGGGAGGGATTCCTAGTGTGG + Intergenic
1140843194 16:78861287-78861309 GGATGGATGGATGCATGGACTGG - Intronic
1143119109 17:4596396-4596418 GGAGGGATGAGTTCCTCTTCTGG - Intronic
1146982857 17:37182232-37182254 GGATGGATGAAATCCACTTCTGG - Intronic
1149219833 17:54403996-54404018 GGAAGGATGGAGTGCTCTTCAGG - Intergenic
1153233935 18:2967709-2967731 GAAAGGCTGGATTCCCCGTCAGG - Intronic
1157499645 18:48180519-48180541 GGAGGGATGGTTTCCTTCTCTGG + Intronic
1159954015 18:74506894-74506916 GGGTGGGAGGATTCCTCATCTGG - Intronic
1161138808 19:2636217-2636239 GGGTGGATGGAATTCTCCTCTGG + Intronic
1161422804 19:4184986-4185008 GGATGGATGGATTGGTGGTTGGG + Intronic
1161632902 19:5367945-5367967 GGATGGATTGATTCGTGGTTGGG + Intergenic
1162480434 19:10924100-10924122 GGATGGAGGGGTCCCTCCTCTGG + Exonic
1164840069 19:31386656-31386678 GGATGGATGGATGCCCAGTTGGG - Intergenic
936241790 2:110794171-110794193 AGAAGGATGGATTCCTCACCTGG - Exonic
936463951 2:112730589-112730611 GGATGCCTGGATTCCTCGTTGGG + Intronic
943584992 2:189727935-189727957 GGAGGGAGCGATTCCTCCTCTGG + Exonic
944396393 2:199272473-199272495 GTGTGGATGGCTTCCTGGTCTGG + Exonic
947441843 2:230129810-230129832 GGATGGATGGAGTTCTCTGCAGG - Intergenic
948600889 2:239106931-239106953 GGATGGTGGGATTCCTGGTGTGG + Intronic
1169217004 20:3799902-3799924 GGATGGATGGATGCCTTTCCTGG + Intronic
1170847105 20:19971602-19971624 AGATGTATGTATTCCTCCTCTGG + Intronic
1174302399 20:49592175-49592197 GGATGGATGGATTGATAGACAGG - Intergenic
1179214997 21:39359941-39359963 GGATGGACACATTCCTCCTCTGG + Intergenic
1180855201 22:19041084-19041106 GGGTGGATGGAGGCCTCGTAGGG + Exonic
1182961876 22:34483094-34483116 GGATGGATGGATGGGTCGACGGG - Intergenic
960362054 3:116724865-116724887 GGATGGATTGATTCCACATACGG - Intronic
976660433 4:87534994-87535016 GGATGGATGTATTCTGCGTGTGG - Intergenic
984358727 4:178699783-178699805 GGATGGATGGATGACTTTTCTGG + Intergenic
986265827 5:6189539-6189561 GGATGGATGGATGGATGGTCAGG + Intergenic
1002341649 5:178520187-178520209 GGATGGATGGATGGCTGGTAAGG + Intronic
1005008365 6:21312391-21312413 GAATGGATGTATCCCACGTCAGG - Intergenic
1021489564 7:21204019-21204041 GCATTGATAGATTCCTAGTCTGG + Intergenic
1026306940 7:69150592-69150614 GGAGGGGTGGCTTCCTGGTCAGG + Intergenic
1026320516 7:69263905-69263927 GGATGGATGGATTGATGATCAGG + Intergenic
1031230207 7:119096081-119096103 GGAAAAATGGATTCCTGGTCAGG - Intergenic
1033437817 7:141349918-141349940 GGATGCATGGATTCTTCCTCAGG - Intronic
1034537313 7:151733637-151733659 GGAGGGATGGAATCCTAGACGGG - Intronic
1036725544 8:11217676-11217698 GGATTGCTGGATTCCTCCTGGGG - Intergenic
1037521781 8:19686781-19686803 GGATGGATGGTATCCCTGTCTGG - Intronic
1042964274 8:74334332-74334354 GGATGGATGGATGCATGGGCAGG - Intronic
1045053072 8:98344304-98344326 GGATGGAAGGATTCCAGGTGAGG - Intergenic
1049201746 8:141343746-141343768 GGATGGGGAGATTCCTCGCCTGG + Intergenic
1058959331 9:109978127-109978149 GGAGGGATGCATGCCTCCTCAGG + Intronic
1060498636 9:124136177-124136199 GGATGGATGGATGGATAGTCAGG - Intergenic
1203769617 EBV:42507-42529 GGATGGTTGGATTCATCAACAGG + Intergenic
1186264393 X:7816468-7816490 GGATGGAAGTATTCCTGGGCTGG + Intergenic
1186500958 X:10050183-10050205 AGATGCATGGCTTCCTCTTCAGG - Intronic
1193547098 X:82844257-82844279 GGATGGATAGTTTCATCTTCTGG - Intergenic
1195458797 X:105100405-105100427 GGATGGAGGGATTCCTTCTCAGG + Intronic
1199604963 X:149569925-149569947 GAATGGGTAGATTCCTCATCTGG - Intergenic