ID: 902890233

View in Genome Browser
Species Human (GRCh38)
Location 1:19438046-19438068
Sequence AAGAACAATACTTGGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 237}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890233_902890249 22 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890249 1:19438091-19438113 AGGGGAGGGGACCGGGCACATGG 0: 1
1: 0
2: 3
3: 54
4: 578
902890233_902890242 7 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890242 1:19438076-19438098 ACTACCTCCTACGTCAGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 68
902890233_902890240 4 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73
902890233_902890238 3 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890233_902890243 8 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890243 1:19438077-19438099 CTACCTCCTACGTCAGGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 76
902890233_902890247 14 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890247 1:19438083-19438105 CCTACGTCAGGGGAGGGGACCGG 0: 1
1: 0
2: 2
3: 29
4: 309
902890233_902890237 2 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890233_902890244 9 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890244 1:19438078-19438100 TACCTCCTACGTCAGGGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 85
902890233_902890250 30 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890250 1:19438099-19438121 GGACCGGGCACATGGTTCCGAGG 0: 1
1: 0
2: 0
3: 0
4: 40
902890233_902890248 15 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890233 Original CRISPR AAGAACAATACTTGGATGGA TGG (reversed) Intronic
900869171 1:5289611-5289633 AATAAGAATGCATGGATGGATGG + Intergenic
901006684 1:6175120-6175142 ATGGACAATAGGTGGATGGATGG + Intronic
901182527 1:7351471-7351493 AAGAACAGTTCCTGGATGGTGGG - Intronic
901386566 1:8913338-8913360 AAGAATAACACTGGGATGGCCGG - Intergenic
902206614 1:14872989-14873011 TAGAAGGATACATGGATGGATGG + Intronic
902731426 1:18372491-18372513 AAAATGAATGCTTGGATGGATGG + Intronic
902890233 1:19438046-19438068 AAGAACAATACTTGGATGGATGG - Intronic
908774714 1:67628615-67628637 AAGAAGAAGAGTTGGATTGAGGG - Intergenic
911905521 1:103563837-103563859 AAGAAGAATACTGTGAGGGAAGG + Intronic
912126168 1:106541218-106541240 ATGACCAAGCCTTGGATGGAAGG + Intergenic
912220796 1:107672870-107672892 AAGAACAATACAAGGTTGGTGGG + Intronic
912806032 1:112757915-112757937 AAAATTAATACATGGATGGAGGG + Intergenic
915894223 1:159798894-159798916 AATACAAATACCTGGATGGATGG + Intergenic
916670706 1:167017159-167017181 AGGATGAATACTTGAATGGATGG + Intronic
916896358 1:169167150-169167172 AAGAACAATGAAAGGATGGATGG + Intronic
917058316 1:171007910-171007932 CAGATCAATGCTTGGATGGTAGG - Intronic
920119363 1:203644267-203644289 AAAAAGAATGCTTGGATGGATGG + Intronic
921436818 1:215133449-215133471 CAGAGCAATACTTGGATGTCTGG - Intronic
923354388 1:233139887-233139909 AAGAAAAATACTTTGATCGGTGG - Intronic
924075084 1:240325198-240325220 AAAAACAAAACTTAGCTGGAGGG + Intronic
1064548703 10:16476884-16476906 AAAAAGAATTCTAGGATGGAGGG - Intronic
1066269879 10:33811790-33811812 AAAAACAATACATGTGTGGAAGG + Intergenic
1066571147 10:36773965-36773987 AAGAAAGAAACTTGGAAGGAAGG - Intergenic
1070211668 10:74329586-74329608 AAGAAGATTGGTTGGATGGATGG + Intronic
1070259002 10:74835288-74835310 ATGAACATCTCTTGGATGGATGG - Intronic
1070369778 10:75771267-75771289 AAAAAAAATGCATGGATGGAAGG - Intronic
1070575120 10:77671827-77671849 AAGAATAATACTGACATGGAAGG - Intergenic
1070703713 10:78622076-78622098 AACAACAATATTGGGATGTAGGG - Intergenic
1071204914 10:83263385-83263407 AAAAACAATACCTGGAAAGATGG + Intergenic
1072487639 10:95871443-95871465 AAGAAAAATACATAGATGTATGG - Exonic
1073151767 10:101316507-101316529 AAGAAAAAGGCTTGGAGGGAGGG + Intergenic
1074286413 10:112101975-112101997 AAGGACAATATTTAGTTGGATGG - Intergenic
1074938925 10:118215828-118215850 AAGAAAAATATTTGACTGGAGGG + Intergenic
1075411925 10:122234522-122234544 AAAAACAATTCTTGGTTGTAAGG + Intronic
1079836628 11:25342761-25342783 AAGAACAATAATCGGCTGGGCGG + Intergenic
1080675802 11:34425615-34425637 AAGAACACTACTTGGGTGATGGG + Intergenic
1086734967 11:90294863-90294885 CAGAACAAGACAAGGATGGAAGG - Intergenic
1088569311 11:111205963-111205985 AAGACCTGTACTTGAATGGATGG + Intergenic
1088633026 11:111792326-111792348 AAAAACAAATGTTGGATGGATGG + Intronic
1089663371 11:120000598-120000620 AAGAAGTATAATAGGATGGAGGG - Intergenic
1090421094 11:126575437-126575459 ATGTACAATACTGGGAGGGAAGG + Intronic
1093133241 12:15417399-15417421 GAAAACAATAATTGGATAGATGG + Intronic
1094074652 12:26459468-26459490 AAGAACAATCTATTGATGGAGGG - Intronic
1094639938 12:32264195-32264217 TAGAACATTACTTGCATGTACGG + Intronic
1098842789 12:75496555-75496577 AAAAAACATACTGGGATGGAAGG - Exonic
1106720780 13:32432639-32432661 CAGACCAATACTTGGATATAGGG + Exonic
1107908050 13:45079973-45079995 AAGAACAACACATTGATGGTAGG + Intergenic
1109641447 13:65197311-65197333 AAGAACTAGATTTGGAAGGAAGG + Intergenic
1109746821 13:66634794-66634816 AAGAACAATACTTTTTTGGAGGG - Intronic
1111683252 13:91469747-91469769 AAAAAAAATACCTGGCTGGATGG + Intronic
1111959790 13:94797781-94797803 AAGAAAAATAATGGGATCGAGGG + Intergenic
1112617722 13:101022237-101022259 AAGAATCATACTTGGAGGGCAGG - Intergenic
1113561138 13:111282720-111282742 AAGAATAATACGTGGCTGGGGGG + Intronic
1114037488 14:18643706-18643728 AAGCATAATACTTGGGGGGATGG - Intergenic
1114121146 14:19671341-19671363 AAGGATAATACTTGGGGGGATGG + Intergenic
1117503645 14:56379010-56379032 TAGAACAAGACTTTGATGGAAGG - Intergenic
1118859002 14:69647255-69647277 AAGATAAATACTTTGTTGGAAGG + Intronic
1120710901 14:87792243-87792265 CAGAGCAATACTTGGAATGATGG - Intergenic
1120896986 14:89542141-89542163 AAGTACAATACTTGTATATATGG + Intronic
1121207381 14:92180795-92180817 AAGAACATTCCTTTGTTGGATGG + Intergenic
1121583942 14:95050114-95050136 AAGAAAAATGGATGGATGGATGG + Intergenic
1121857943 14:97287966-97287988 AATAAAAATAGATGGATGGATGG + Intergenic
1125303645 15:38285115-38285137 AAATACATTACTTGAATGGAGGG - Intronic
1125864481 15:43032715-43032737 ATGAAAAATACTAGGCTGGATGG - Intronic
1126210534 15:46096496-46096518 TCGATCAATACTTGGATTGAAGG + Intergenic
1126923153 15:53550291-53550313 AAAAACAATACATGAATGGATGG + Intronic
1128950028 15:71869543-71869565 AGGAACAATAGTGGGATGAATGG + Intronic
1129234509 15:74215908-74215930 AAGAAAAAAAGTTGGAGGGAGGG + Intergenic
1129800686 15:78411772-78411794 AAGAACAATAATCAGATGAATGG - Intergenic
1131434884 15:92414693-92414715 AAGAACCTTGCTCGGATGGATGG - Intronic
1132277544 15:100582258-100582280 AAGACCAAGACTTGGCTGGTGGG - Intronic
1133454353 16:5930196-5930218 AAGAAGAATGGATGGATGGATGG + Intergenic
1133621335 16:7529495-7529517 AATAGCAATGATTGGATGGATGG - Intronic
1133893788 16:9906269-9906291 AAGAACAGTTTTAGGATGGAAGG - Intronic
1135297301 16:21292941-21292963 AAGATAAATGCATGGATGGATGG + Intronic
1135344448 16:21676710-21676732 AAGAAGAATACTTGGAGAGGAGG - Intergenic
1135948579 16:26889778-26889800 ATGTACAATACTTGGATGACAGG - Intergenic
1137896166 16:52215332-52215354 TAGAACTATACCTGGATGAAGGG - Intergenic
1138059968 16:53879767-53879789 ATGAACAATCCTAGGAAGGATGG + Intronic
1138670796 16:58612721-58612743 AAGAGCAAAACTTCTATGGAAGG + Intronic
1139085189 16:63576242-63576264 AAAAAAAATAGATGGATGGATGG + Intergenic
1139120171 16:64006887-64006909 AATAACAATTCTTGGAGAGAAGG + Intergenic
1140108679 16:71984552-71984574 AATACGAATACTTGAATGGAGGG - Intronic
1141421502 16:83920868-83920890 ATGAACATTAGATGGATGGATGG + Exonic
1142774030 17:2122132-2122154 AAGAAGAAAAAATGGATGGATGG + Intronic
1143698592 17:8639815-8639837 AAGAAGAATAAATGGATGGATGG + Intergenic
1143698605 17:8639902-8639924 AAGAAGAATGAATGGATGGATGG + Intergenic
1143812593 17:9484465-9484487 AAGAACAGTAATTGGCAGGAGGG + Intronic
1146924873 17:36737235-36737257 CAGCACAATCCTTGGATTGAGGG - Intergenic
1148114665 17:45168678-45168700 AAGAAGAAAACTGGGATAGAAGG - Intronic
1149376975 17:56053944-56053966 ACGTACATTACTTGGATGGCAGG - Intergenic
1149522487 17:57328242-57328264 TAGATGAATACATGGATGGATGG - Intronic
1150366177 17:64587250-64587272 AAGAGCAATTCTTGGATTGATGG + Intronic
1150826631 17:68481837-68481859 AGGAACACTTCTCGGATGGATGG + Intergenic
1151120508 17:71787774-71787796 AAGAAAAAGACTTGGAGGGCAGG - Intergenic
1152649789 17:81487658-81487680 AAAAACAATGCTTGGCTGGAGGG - Intergenic
1153002857 18:472314-472336 AAGAATAATACTTTTAAGGAAGG - Intronic
1153566256 18:6420907-6420929 AAAAACAAAACTTGAGTGGATGG - Intergenic
1154480262 18:14815501-14815523 AAGAAGAGTAATTGGATAGAGGG + Intronic
1157516672 18:48316257-48316279 AAGAACAATCCTTCCATGTATGG + Intronic
1158231804 18:55264930-55264952 CTGAACAATACTTGGGTGGCAGG - Intronic
1159770911 18:72544170-72544192 AAGAAGAAGACTGGGATGGCTGG + Exonic
1159978156 18:74741162-74741184 GAGAAAAATACATGTATGGATGG + Intronic
1159986070 18:74842509-74842531 AGGAACAATACGAGGATAGAAGG - Intronic
1160542022 18:79629071-79629093 AAGATCAAAGCTGGGATGGAAGG + Intergenic
1165202639 19:34157794-34157816 AATAAAAATACTTGGATTTAGGG + Intergenic
1165998465 19:39862774-39862796 AAGATAAATGATTGGATGGAGGG - Intergenic
1168490882 19:56808050-56808072 TAGAGCAATACATGGATTGAAGG - Intronic
925509543 2:4610005-4610027 AAGATCAATAGTGGGAGGGAAGG + Intergenic
925758404 2:7157616-7157638 ACGAAAAATACATGGAGGGAGGG + Intergenic
929532010 2:42758693-42758715 AAGAAAAATACTGGGGAGGAGGG - Intergenic
929890146 2:45912137-45912159 AAGAACAATACCAGGAACGATGG + Intronic
930635689 2:53803164-53803186 AAGAAACATACTTGGCTGCAAGG + Intronic
933235997 2:79865301-79865323 AAGTACAATAGTTAGATGGCGGG + Intronic
933516330 2:83308169-83308191 AAGAAAAATACTTTGAAGGAAGG + Intergenic
937611719 2:123869618-123869640 AAGATCAAAACATGGAAGGAGGG - Intergenic
938273495 2:129995332-129995354 AAGGACAATACTTGGGGGGATGG + Intergenic
938277811 2:130042590-130042612 AAGGATAATACTTGGAGGGATGG + Intergenic
938328777 2:130433394-130433416 AAGGATAATACTTGGAGGGATGG + Intergenic
938361168 2:130688098-130688120 AAGGATAATACTTGGAGGGATGG - Intergenic
938437572 2:131294787-131294809 AAGGATAATACTTGGAGGGATGG - Intronic
938442719 2:131350778-131350800 AAGGATAATACTTGGGGGGATGG - Intronic
939034578 2:137115349-137115371 AAGAAGAATACTTGGAGAGTTGG - Intronic
939132666 2:138256369-138256391 AAGATGAATAAATGGATGGATGG + Intergenic
939762657 2:146201910-146201932 AAGAACAAGAGTAGGAGGGAAGG - Intergenic
940336466 2:152533301-152533323 CAGAAGCATACATGGATGGATGG - Intronic
942508651 2:176672062-176672084 AAGAAGAAGAGTTGTATGGAAGG - Intergenic
942642521 2:178074726-178074748 GAGAAGAATACTGGGAAGGATGG + Intronic
943011881 2:182460164-182460186 GATAACAATAGTTGGATTGATGG - Intronic
946094164 2:217258056-217258078 CAGAACAAAACTTGAATTGATGG - Intergenic
946564855 2:220953210-220953232 AAGAAAAATAGATGGATGGATGG + Intergenic
946605918 2:221404390-221404412 AATAACAATGCTTGGATCAAAGG + Intergenic
947213362 2:227727968-227727990 AACAGCAATGCTTGAATGGATGG - Intergenic
947243418 2:228020516-228020538 AATAAGAACACTTGGATGCAGGG + Intronic
948242799 2:236452385-236452407 ATGAAAAATATGTGGATGGAGGG + Intronic
948702507 2:239769056-239769078 AACAACAACACTTGGCTGGGTGG - Intronic
1169077392 20:2769582-2769604 AAGGACAATACTTGGGAGAAGGG + Intergenic
1170840054 20:19917408-19917430 AAAAAGAATAATTTGATGGATGG - Intronic
1170977634 20:21181450-21181472 AAAAAAAAAACTTGGATAGATGG - Intronic
1173121354 20:40292720-40292742 AAGAAGAACACATGGATGCAGGG + Intergenic
1174679967 20:52396754-52396776 GAGACAAATACTTGGATAGAGGG - Intergenic
1174976697 20:55343950-55343972 CTGAACAATACTTGGATGTCTGG - Intergenic
1175277313 20:57780984-57781006 AAGAAGAATAGGTGGATGGATGG - Intergenic
1177527287 21:22310962-22310984 ATGCAAAATACTTGGATGAAAGG + Intergenic
1178819265 21:35960428-35960450 TAGATGAATAATTGGATGGATGG + Intronic
1180461615 22:15570748-15570770 AAGCATAATACTTGGGGGGATGG - Intergenic
1182086676 22:27565678-27565700 AGGAAAAATAAATGGATGGATGG + Intergenic
1182262030 22:29080208-29080230 AAGAGCAAAACATGGAGGGAGGG - Intronic
1183058464 22:35320992-35321014 AAAAAAAAAACTTGAATGGAAGG + Intronic
1183487802 22:38098627-38098649 AAGAACACCACCTGGCTGGAGGG + Intronic
1183981566 22:41543665-41543687 AAAAACAATGCATGGCTGGAAGG + Intronic
950121954 3:10487977-10487999 CAGAAGAATAAGTGGATGGATGG - Intronic
953290166 3:41652371-41652393 AAAAACAATACTGGAGTGGATGG + Intronic
953926896 3:46987229-46987251 CAGAACTATCTTTGGATGGATGG - Intronic
956617920 3:71191638-71191660 GACAACAATATTTTGATGGAAGG + Intronic
958415658 3:93869799-93869821 AAAGACAGTACTTGGATGCAGGG + Intergenic
960533713 3:118793691-118793713 AACAAAAAAACTTGGATGGCTGG + Intergenic
963348289 3:144122794-144122816 AACAACTATACTGGGTTGGAAGG - Intergenic
963726463 3:148927360-148927382 ACCAACAGGACTTGGATGGATGG - Intergenic
964130442 3:153280877-153280899 AAGAACAAGGCTTGGCTGGATGG + Intergenic
964585156 3:158289951-158289973 AACATCAAATCTTGGATGGATGG - Intronic
965415562 3:168388262-168388284 TTGAACAATGCTTGGATGCAGGG + Intergenic
965863403 3:173174464-173174486 AAGATAAATACTTGAGTGGATGG - Intergenic
966013115 3:175106469-175106491 AAGATCAAGAAGTGGATGGATGG - Intronic
966159882 3:176956582-176956604 AATAACAATAAGTGGATGGATGG + Intergenic
967091790 3:186140866-186140888 GAGAACCATACTTGCATGGAAGG - Intronic
969032049 4:4223376-4223398 AACAAAAAAACATGGATGGATGG + Intronic
972874631 4:43343480-43343502 AAGAAGAAGGCATGGATGGAAGG - Intergenic
973114044 4:46432534-46432556 AAGATCAATAAATGGAAGGAAGG - Intronic
976812641 4:89112615-89112637 AAGAACATTACCTGCAAGGATGG + Intergenic
976841183 4:89433848-89433870 AAGAAAGATATTAGGATGGAAGG + Intergenic
977530519 4:98195279-98195301 AAAACCAACACTTGGAGGGAGGG - Intergenic
978609299 4:110519726-110519748 AAAAAAAATACATGGATGGTGGG - Intronic
980052631 4:128053546-128053568 AGGAACAATTCTTGGATTGAAGG + Intergenic
980788542 4:137587402-137587424 AAGGAAAATACTTGGATTAAGGG - Intergenic
981191969 4:141874260-141874282 AAGATCAAGAATTGGATTGATGG + Intergenic
981591248 4:146364803-146364825 ATGAAAAATACTTGGAATGATGG + Intronic
983922348 4:173359477-173359499 AAGAACAAAGCTTCCATGGAAGG - Intergenic
984461825 4:180046935-180046957 AAGTAGAATATTTGGAAGGAAGG - Intergenic
986237091 5:5921295-5921317 AACTACAATACTTAGGTGGATGG - Intergenic
988888459 5:35586239-35586261 AAGAACAATAGTTGTAGTGATGG + Intergenic
990147789 5:52782121-52782143 AAGTAAATTACTGGGATGGAGGG - Intergenic
991439804 5:66634992-66635014 AAAGACAATACTAGGATGGCAGG - Intronic
991501759 5:67283897-67283919 ATGAACATTACTTGGATTAAAGG - Intergenic
991627654 5:68620833-68620855 AAGTACCATAATTAGATGGATGG + Intergenic
992168211 5:74075815-74075837 AAGAGCAATACTTCCAGGGAAGG + Intergenic
993043155 5:82838106-82838128 AAGTACAATACTTGTATATATGG - Intergenic
993576996 5:89614299-89614321 AAGAACAAAGTTTGAATGGAGGG + Intergenic
993596398 5:89861740-89861762 GATAAGAATACTTGTATGGATGG - Intergenic
995293611 5:110490281-110490303 AAAAATAATACTTGGAAGTAAGG + Intronic
995561431 5:113386053-113386075 AAGAACAAGACTTGTATGTCAGG - Intronic
996943704 5:129042069-129042091 AAGACAAATAGTTGGAAGGATGG - Intergenic
997894891 5:137707625-137707647 GTGAACAGTATTTGGATGGACGG + Intronic
999007023 5:147993009-147993031 AAGAACAAGACATAGATTGAGGG + Intergenic
1000922672 5:167157188-167157210 AAGAACAGTAACAGGATGGAAGG - Intergenic
1002436751 5:179236209-179236231 AAGTCCAAGACTTGGAGGGAGGG - Intronic
1007731153 6:43947827-43947849 AAGAACAGAACTTGGATCAATGG - Intergenic
1008371945 6:50742513-50742535 AAGAAAAAGGATTGGATGGATGG + Intronic
1008458091 6:51735582-51735604 AAGGAGAAAACTTGGATAGAGGG + Intronic
1010451205 6:76005306-76005328 AAGAACAATCTTTGGATGTGGGG - Exonic
1010521286 6:76841178-76841200 AAAAACACTAGGTGGATGGAAGG + Intergenic
1011509401 6:88083525-88083547 AAGAGCAATAGTTGGCTGTATGG - Intergenic
1011852255 6:91644725-91644747 AAGAACAATACATGGACTAATGG + Intergenic
1011961147 6:93092342-93092364 AAGAACAATATCTGCAGGGAAGG - Intergenic
1012525419 6:100171073-100171095 AGGAACAATACTTTAATGGCAGG + Intergenic
1014626872 6:123737222-123737244 AAGAACAATACATAGCTGAAAGG + Intergenic
1015209380 6:130679388-130679410 AAGAACAAAAGTTGGATGAGGGG + Intergenic
1015317140 6:131829528-131829550 CAGATAAATACATGGATGGATGG - Intronic
1015714326 6:136175495-136175517 ATGAACTATACCTGGATGGCAGG - Intronic
1016375289 6:143414189-143414211 AAGAAAAAAACTTGGAGAGAAGG - Intergenic
1018323510 6:162638503-162638525 AAAAACAATAGATGCATGGATGG - Intronic
1018541047 6:164879538-164879560 AAGAACAAAACGTGGAGGAAAGG + Intergenic
1019846207 7:3504788-3504810 AAAAACCATACTTGGCTGGTGGG + Intronic
1022611126 7:31874532-31874554 AGGAACAAAATTAGGATGGATGG - Intronic
1023008387 7:35900798-35900820 AAGAACTATTCTTTGAAGGATGG + Intronic
1023971410 7:44993910-44993932 AAGAAAAAAAATTGGCTGGAAGG + Intergenic
1024680924 7:51686885-51686907 AATGACAACACTTGGATAGAGGG + Intergenic
1026438934 7:70425837-70425859 AAGATGAATAGATGGATGGATGG + Intronic
1027350988 7:77310933-77310955 AAGAACACTATTTGGAAAGAGGG - Exonic
1030554027 7:111000544-111000566 AAAAACAACAGATGGATGGATGG + Intronic
1032165435 7:129541320-129541342 AAGAAGAAAAGCTGGATGGAAGG + Intergenic
1032846845 7:135758599-135758621 AAGAACAAGAGGTGGGTGGAGGG + Intergenic
1034883665 7:154781171-154781193 ATGAACAGTAGATGGATGGATGG + Intronic
1036114069 8:5939554-5939576 AAGAGAAATTCTGGGATGGAAGG + Intergenic
1036187764 8:6639122-6639144 ACGATAAATACGTGGATGGAAGG + Intronic
1037575960 8:20203151-20203173 AAGCAAGCTACTTGGATGGATGG - Intronic
1039962331 8:42258808-42258830 AAGAACAAAACTTGTATGCAAGG - Intergenic
1045406871 8:101875376-101875398 GAGAAGAATACTTGCAAGGAGGG - Intronic
1046050288 8:109013651-109013673 AATAACAATAATTATATGGATGG - Intergenic
1046305959 8:112367220-112367242 AAGAGTAAAACTTGTATGGACGG - Intronic
1046776817 8:118173215-118173237 TCGATCAATACTTGGATGGAAGG - Intergenic
1047048466 8:121081567-121081589 AAGGATACTACTTAGATGGAAGG - Intergenic
1049077616 8:140411825-140411847 CATAACAATAAGTGGATGGATGG + Intronic
1051159716 9:14193204-14193226 AAGAAGTAAACTTGGATGGATGG - Intronic
1051160812 9:14205194-14205216 AGGAACAAAAATTGGAAGGAAGG + Intronic
1052103834 9:24486540-24486562 AAGAATAATACTTGTTTGAAAGG - Intergenic
1053309086 9:37004200-37004222 AAGAATAAGAATTGGATGGGAGG + Intronic
1053510012 9:38679733-38679755 ATGAACAATGCTTGAATGAATGG - Intergenic
1055678271 9:78688406-78688428 AAGAAAAATTTTTGGATGTATGG + Intergenic
1059166561 9:112082037-112082059 AAGAACAATACAAGGATGTCTGG + Intronic
1060132977 9:121123181-121123203 AAGAATTATACCTGGGTGGAAGG - Intronic
1185613295 X:1404849-1404871 AAGATGAATAGTTGGATGCATGG + Intronic
1185981297 X:4782795-4782817 TAGATCAATAGATGGATGGATGG + Intergenic
1185992486 X:4907028-4907050 AAGATCAATGGATGGATGGATGG - Intergenic
1186016642 X:5202827-5202849 TAGATCAATAGATGGATGGATGG + Intergenic
1186319629 X:8410396-8410418 TAGATGAATACGTGGATGGATGG - Intergenic
1187631958 X:21183207-21183229 GAGAACAGTGCTTGGAAGGAAGG - Intergenic
1189247150 X:39572055-39572077 AAAAAAAATGCTTGGAAGGATGG + Intergenic
1189636254 X:43013508-43013530 AAGAACAATACTCAAAGGGAGGG + Intergenic
1190414248 X:50165987-50166009 AAGAACAATACTTGGGCAGGAGG - Intergenic
1191673169 X:63768074-63768096 ATGTACAATACTTGGGTGGCTGG - Intronic
1192217523 X:69173157-69173179 AAAAACAATACTGTGATGTAAGG - Intergenic
1192538701 X:71950119-71950141 AAAAAAAATACTCTGATGGATGG - Intergenic
1192713232 X:73613873-73613895 AAGCACAACAGATGGATGGATGG - Intronic
1193437357 X:81492268-81492290 AAGGAGGATACTTGTATGGATGG - Intergenic
1193763731 X:85499186-85499208 AACTAGAATAATTGGATGGATGG - Intergenic
1194258128 X:91659542-91659564 AAGCTCAATATATGGATGGAGGG - Intergenic
1194818421 X:98474208-98474230 AAGGACAATATTTCCATGGACGG - Intergenic
1197306677 X:124850782-124850804 AACAAGAATACTAGGATGAATGG + Intronic
1197559909 X:128007299-128007321 AAGATAAATACTTGAAAGGATGG - Intergenic