ID: 902890234

View in Genome Browser
Species Human (GRCh38)
Location 1:19438050-19438072
Sequence AGGTAAGAACAATACTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 161}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890234_902890242 3 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890242 1:19438076-19438098 ACTACCTCCTACGTCAGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 68
902890234_902890240 0 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73
902890234_902890244 5 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890244 1:19438078-19438100 TACCTCCTACGTCAGGGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 85
902890234_902890247 10 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890247 1:19438083-19438105 CCTACGTCAGGGGAGGGGACCGG 0: 1
1: 0
2: 2
3: 29
4: 309
902890234_902890250 26 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890250 1:19438099-19438121 GGACCGGGCACATGGTTCCGAGG 0: 1
1: 0
2: 0
3: 0
4: 40
902890234_902890238 -1 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890234_902890249 18 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890249 1:19438091-19438113 AGGGGAGGGGACCGGGCACATGG 0: 1
1: 0
2: 3
3: 54
4: 578
902890234_902890243 4 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890243 1:19438077-19438099 CTACCTCCTACGTCAGGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 76
902890234_902890237 -2 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890234_902890248 11 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890234 Original CRISPR AGGTAAGAACAATACTTGGA TGG (reversed) Intronic
902890234 1:19438050-19438072 AGGTAAGAACAATACTTGGATGG - Intronic
904374486 1:30071578-30071600 AAGTGAGAACAGCACTTGGATGG - Intergenic
904979349 1:34483889-34483911 AGGGAAGAACAATTTCTGGAAGG + Intergenic
905553646 1:38863771-38863793 AGGCTAGAAAAATACTTTGAGGG + Exonic
907111486 1:51930593-51930615 AGGAAAGAACATATCTTGGAGGG + Intronic
907940688 1:59084326-59084348 AGGAAAGGACAATGCTTTGAGGG + Intergenic
908048721 1:60203695-60203717 AGATATGAACAATAATTGTATGG + Intergenic
908236656 1:62153784-62153806 AGCTCAGAACAATACTTCCAAGG - Intronic
908274931 1:62460640-62460662 AAAAAAGAAAAATACTTGGAGGG - Intronic
908278404 1:62501341-62501363 AGCTAAGAAAAACACTAGGAGGG + Intronic
909444905 1:75738210-75738232 AAATAATAACAATACTTGGCTGG - Intronic
909596741 1:77414163-77414185 ATCTAAGAACAAAACTTAGAAGG - Intronic
910730175 1:90386670-90386692 AGGTAAGAACGACAGTAGGATGG - Intergenic
911329314 1:96508890-96508912 AGGTAAGAAAATTACTTGCTAGG - Intergenic
914748757 1:150518224-150518246 TGGGAAGAAGAATAGTTGGAGGG - Intergenic
914897423 1:151689189-151689211 AAGTAAGAATAATACCTGCAGGG - Intronic
915276956 1:154795739-154795761 AGATGAGAACAGCACTTGGAAGG + Intronic
915863669 1:159475247-159475269 AAGGAAGCACAATACTTGGTAGG + Intergenic
915987802 1:160483636-160483658 AGATAAGAAGAGTACTTAGATGG + Intergenic
918386603 1:184014279-184014301 AGGTAAGAAGAAAATTAGGAAGG + Intronic
920557672 1:206915959-206915981 AGGTAAAAACAATCATGGGAGGG + Intronic
922559092 1:226555089-226555111 AGGTAAAAAGAAAACTAGGAGGG - Intronic
922713183 1:227848779-227848801 AGGCAAGAAAAACACTTGGGTGG - Intergenic
923921460 1:238568849-238568871 AGGGATGAACAATTCTTGAATGG - Intergenic
1062769745 10:89461-89483 AGCTAAAAATAATACATGGATGG + Intergenic
1068573422 10:58656650-58656672 AAGAAAGAACAATACATGAAGGG - Intronic
1069206111 10:65688251-65688273 AGATAAGAACAATAATTAGTAGG + Intergenic
1075681461 10:124336040-124336062 AGGAAAGAAAAATAATTCGAAGG + Intergenic
1075950340 10:126471894-126471916 AGGTAACAAAACTATTTGGAAGG + Intronic
1076106181 10:127825511-127825533 GGGTAAAATCAATACATGGAAGG - Intergenic
1079960315 11:26915445-26915467 CTGTAAGAAGAATATTTGGAAGG + Intergenic
1081297219 11:41406667-41406689 AGGAAAGAGGAATACTTTGATGG - Intronic
1084804963 11:71572452-71572474 AGGTAAGAACACGACTTCGAGGG + Intergenic
1085217533 11:74845382-74845404 GGGTAAGACCAAGACTGGGATGG + Intronic
1086080029 11:82894154-82894176 AGGTAAGGAGAATACCTTGATGG - Intronic
1086483675 11:87273291-87273313 AGGTAATAACAATATCTGTATGG - Intronic
1086843066 11:91712782-91712804 AAGTAAAAACATTATTTGGAAGG - Intergenic
1086963857 11:93007875-93007897 ATGTAAGAACAATAGGTGGCCGG + Intergenic
1087360116 11:97147662-97147684 AGGTAAGAACAAAATTTTGAAGG - Intergenic
1088322323 11:108566816-108566838 TGTAAAGAACAAGACTTGGAGGG + Intronic
1090421093 11:126575433-126575455 ATGTATGTACAATACTGGGAGGG + Intronic
1090678061 11:129023312-129023334 GGGGAAGAACCATACTTGAAGGG + Intronic
1094594809 12:31855578-31855600 TGATAAGAGCAATTCTTGGATGG + Intergenic
1095421679 12:42030859-42030881 AGCTAAGAACCATACAGGGAAGG + Intergenic
1098043350 12:66374550-66374572 AGGTAAAAATAATAAATGGATGG - Intronic
1099877741 12:88430174-88430196 AGGAATGAAAAAGACTTGGATGG - Intergenic
1101318195 12:103649170-103649192 AGGTATGAACAAAGCTTGGCAGG + Intronic
1102326906 12:111993558-111993580 AGGTTAGACCAAGACTTTGAGGG + Intronic
1103815083 12:123648677-123648699 AGTTTAGAAAACTACTTGGATGG - Intronic
1115706694 14:36006575-36006597 AGGTAAGAAAAATTCTAGCATGG - Intergenic
1117004931 14:51411364-51411386 AAGTAAGGACAAGACATGGAGGG + Intergenic
1117623343 14:57610347-57610369 AAGTAAGAACAACACTTATAGGG + Intronic
1117688785 14:58283476-58283498 AAAAAAGAAAAATACTTGGAGGG + Intronic
1119016011 14:71055798-71055820 ATGTAAGAACAATCTTTGAATGG - Intronic
1120084559 14:80255471-80255493 ATGGAAGAACAAAACCTGGATGG + Intronic
1127978841 15:64019004-64019026 AGGTTATAACAATATGTGGATGG + Intronic
1130640343 15:85667460-85667482 AAATAGGAACAATTCTTGGATGG + Intronic
1139270385 16:65676976-65676998 AGGGAAGAACAGAAGTTGGAAGG + Intergenic
1139496746 16:67325894-67325916 AGGTAAGAAATTTACTTGGACGG - Intronic
1140271199 16:73467890-73467912 TGCTAAGAACAATGCTTGTAAGG + Intergenic
1143698591 17:8639811-8639833 AGGAAAGAAGAATAAATGGATGG + Intergenic
1143718416 17:8792919-8792941 AAGCATGAAGAATACTTGGAGGG - Intergenic
1143812591 17:9484461-9484483 AGGGAAGAACAGTAATTGGCAGG + Intronic
1143931344 17:10430482-10430504 AGGGTAGAAGAATACTTGAATGG - Intergenic
1149156892 17:53641737-53641759 AGGTAATAACAATAATGGCAAGG - Intergenic
1154088032 18:11326473-11326495 AGATCAGAACAACACATGGAGGG + Intergenic
1155667664 18:28330853-28330875 AGGTGAGCAAAATATTTGGAGGG + Intergenic
1155735067 18:29211324-29211346 AGCTAAGAAAAAGACCTGGAGGG - Intergenic
1157026869 18:43855315-43855337 AGGAGAGAACACAACTTGGAAGG - Intergenic
1159314828 18:66758826-66758848 AGGTGAGGAAAATACTTAGATGG - Intergenic
1159911674 18:74151966-74151988 TGAGAAGAACAATACTCGGAAGG - Intronic
1164544763 19:29151145-29151167 AGGAAATAACAATAGCTGGAAGG + Intergenic
927992639 2:27458930-27458952 AGGAAAGAACAAACCTTGGCTGG + Intronic
930256863 2:49103192-49103214 AGGTTTGGACATTACTTGGAAGG + Intronic
930307413 2:49692938-49692960 AAGTGAGAGCAATACTTGTAGGG - Intergenic
930879578 2:56255930-56255952 AGGTAAGAGCAATAGATGGGAGG + Intronic
931208057 2:60166572-60166594 AGGGCAGCACAATACTGGGAAGG - Intergenic
932329802 2:70891812-70891834 AGGGAAGAACAATTCAGGGAAGG - Intergenic
932967661 2:76496545-76496567 AGGTAACAAGAAAAATTGGAAGG - Intergenic
933592581 2:84249093-84249115 AGGAAAGAACAAAAATTGGATGG + Intergenic
938273494 2:129995328-129995350 TGGAAAGGACAATACTTGGGGGG + Intergenic
938277810 2:130042586-130042608 CGGAAAGGATAATACTTGGAGGG + Intergenic
938328776 2:130433390-130433412 CGGAAAGGATAATACTTGGAGGG + Intergenic
938361169 2:130688102-130688124 CGGAAAGGATAATACTTGGAGGG - Intergenic
938437573 2:131294791-131294813 CGGAAAGGATAATACTTGGAGGG - Intronic
939193515 2:138944376-138944398 AGCTAAGAAAAGTGCTTGGATGG + Intergenic
941508160 2:166373632-166373654 AGGTGATTTCAATACTTGGATGG + Intronic
944939896 2:204612447-204612469 AGTTTAGAACAAAAATTGGATGG + Intronic
1169182907 20:3585934-3585956 AGGTAATAACAAGTATTGGAAGG + Intronic
1170921020 20:20679427-20679449 AGGCAAGAACACCAATTGGAAGG - Intronic
1174387511 20:50196068-50196090 AGGTCTGGACAAAACTTGGAAGG - Intergenic
1175592249 20:60202351-60202373 ACGTAAGAACAATACCCTGAGGG - Intergenic
1178673599 21:34613250-34613272 AGGAAAAAATAAGACTTGGAGGG - Intronic
1181390549 22:22577435-22577457 AGGGCAGACCAATACCTGGAAGG - Intergenic
1182372962 22:29825119-29825141 AGGTGAGAAAAACACTTCGATGG + Exonic
1182694783 22:32190722-32190744 GGGTAAGAAAATTACTTGGGTGG - Exonic
1183143300 22:35965179-35965201 AGGTAAGAGCATTCCATGGAGGG + Intronic
949675500 3:6448300-6448322 AGGAAAGTACAATATTTTGAGGG + Intergenic
950789131 3:15458498-15458520 AGGTAAGAAAAATAGCTGGTAGG + Intronic
952301851 3:32110379-32110401 AGGTAAGAACCAGATCTGGAAGG - Intronic
952682690 3:36113180-36113202 AGGTAAGACTAATACTTCAATGG - Intergenic
957229463 3:77493381-77493403 AGGTAAGACCAACATATGGATGG + Exonic
957752789 3:84444158-84444180 AGGTAAGAAAATAATTTGGATGG + Intergenic
957869682 3:86075291-86075313 AGAAAACAACAATTCTTGGAAGG - Intergenic
959966395 3:112360398-112360420 AGTAAAGAACACTTCTTGGATGG - Intronic
960443057 3:117712854-117712876 GGGTAAGAAAAAAATTTGGAAGG + Intergenic
960744472 3:120871821-120871843 AAGTAAGAAGAATACTTTGGGGG - Intergenic
961173127 3:124813221-124813243 AAGTAAGATGAGTACTTGGAAGG + Intronic
961909250 3:130297998-130298020 AGGTAAGATGAATAGATGGATGG + Intergenic
964147790 3:153486613-153486635 AGGTAAGAATAATAGAAGGAGGG - Intronic
971539406 4:27796776-27796798 AGAAAGGAACAATTCTTGGAAGG + Intergenic
973063489 4:45759879-45759901 AAGCAAGAAAAATACTTGAAAGG - Intergenic
973318468 4:48785567-48785589 AGGCAAAAAAAAAACTTGGAAGG + Intergenic
973696488 4:53495838-53495860 AGGTAAGAACATTACTCGGCTGG - Intronic
976382891 4:84420335-84420357 AGATAAAAAGAATACTGGGAAGG + Intergenic
977603041 4:98954881-98954903 AGGTAACAGCAATAAATGGATGG + Intergenic
980687343 4:136245199-136245221 AGGTAAGATCAATAAATAGAGGG - Intergenic
982928409 4:161369473-161369495 AGGTAAGAAAAATAAATGAAAGG - Intergenic
986737189 5:10676447-10676469 AGGTGAGACCACTGCTTGGAGGG - Intergenic
988947431 5:36220024-36220046 AGGTTAGAATAAAAATTGGAAGG - Intronic
989030290 5:37111443-37111465 AAGGAAGAATAATACTTAGAGGG + Intronic
989264178 5:39453873-39453895 AGGTAAGAAATATATCTGGATGG + Intronic
989342299 5:40389513-40389535 ATGTAAGGACAATACTGGGGAGG + Intergenic
991475794 5:67017891-67017913 AGGTAATAGAAATACTTGGCCGG - Intronic
992268292 5:75039388-75039410 AGGTAAGAACAATAAGAGGCCGG - Intergenic
1000257776 5:159557282-159557304 AGGTAAGTACAATAAAGGGAAGG - Intergenic
1000774552 5:165402905-165402927 ATGAAAGAACAATAATTAGAAGG - Intergenic
1003289944 6:4771743-4771765 AGGTAAAGACGATACTGGGATGG + Intronic
1004075917 6:12344147-12344169 AGGGAAGAACAATTCTAGAAAGG + Intergenic
1004188686 6:13445555-13445577 ACTTCAGAACCATACTTGGAGGG - Intronic
1004382360 6:15143480-15143502 AGGTAAAAACAGCACTTGGGTGG + Intergenic
1007128610 6:39448628-39448650 AGGTAGGACAAAAACTTGGAGGG - Intronic
1010857257 6:80855279-80855301 AGATAAGAAAAAAAATTGGAAGG + Intergenic
1014390384 6:120855912-120855934 AAGTTAGAACAATACTTGTTCGG - Intergenic
1014415447 6:121177888-121177910 AGGTCAAAACAATACTAGGTAGG + Intronic
1015902416 6:138081812-138081834 AGGCAAAAACAGTACATGGAAGG + Intergenic
1017780508 6:157711790-157711812 AGGGAAGAGCAGGACTTGGAGGG + Intronic
1020070593 7:5224349-5224371 ATGTGAGAAAAATACGTGGAAGG - Intronic
1020268947 7:6580677-6580699 AGGTAAGGATGATCCTTGGATGG + Exonic
1024330423 7:48149260-48149282 AGGAAAGAAGAATGCATGGAGGG - Intergenic
1024360719 7:48464662-48464684 AGGGAAGTAAAATAATTGGATGG + Intronic
1025875965 7:65479784-65479806 AGCTAAGAACAATAGTTCCAGGG + Intergenic
1026385771 7:69846344-69846366 TTCTAAGAACAATATTTGGAAGG + Intronic
1028844948 7:95469860-95469882 ATGTAAGAAAAATACTTAAATGG + Intergenic
1029185449 7:98735263-98735285 AAGTTAGAAAAATACTTGAAAGG - Intergenic
1030487288 7:110185564-110185586 AGGCAAGAAAAAGATTTGGAAGG - Intergenic
1036592712 8:10183462-10183484 AGGTCATAACAGTGCTTGGAAGG + Intronic
1037661997 8:20935724-20935746 ATGAAAGAACAAAACTTTGAAGG - Intergenic
1039651517 8:39344631-39344653 AGATAAGAACAGAACTTTGATGG + Intergenic
1039908940 8:41809026-41809048 AGGCAAGAACAAGACTTGCAGGG - Intronic
1041431226 8:57782817-57782839 AGGCAAGGAGATTACTTGGAAGG - Intergenic
1043505777 8:80900386-80900408 CTGTTAGAACAATAATTGGACGG - Intergenic
1046847206 8:118930961-118930983 AGGTAAAATCATTACTTAGATGG - Intronic
1047885575 8:129246628-129246650 AAGTGAAAAAAATACTTGGAGGG - Intergenic
1050919294 9:11180427-11180449 ATGTAAGGATAAGACTTGGAAGG - Intergenic
1051006225 9:12348408-12348430 AGGTAAGAAAAAAATTTGAAGGG + Intergenic
1056327914 9:85495988-85496010 AGGTAAGCACAGGAATTGGATGG + Intergenic
1056726952 9:89127655-89127677 AGGTAGGAAGTATACTTTGAGGG + Intronic
1057369892 9:94461828-94461850 AGGTAAGAAAAGTTCTGGGATGG + Intergenic
1059653720 9:116338197-116338219 AGGAAAGAAGAATAAATGGAGGG - Intronic
1060654594 9:125361163-125361185 AGGTAAGAACAAATCTTGGCTGG - Intronic
1061998380 9:134201463-134201485 AAAAAAGAACAAAACTTGGAGGG + Intergenic
1189091469 X:38087324-38087346 AGATGAGCAGAATACTTGGAAGG + Intronic
1189636252 X:43013504-43013526 AGGGAAGAACAATACTCAAAGGG + Intergenic
1189636759 X:43018923-43018945 TGGTAAGATAAATACTTGGGAGG + Intergenic
1189649539 X:43174691-43174713 AGGAATAAACAGTACTTGGAGGG + Intergenic
1189980203 X:46502465-46502487 AGGTAAGAACTAGACTATGAAGG + Intronic
1192130461 X:68544977-68544999 AGGGAAGAAGAAAAGTTGGATGG - Intergenic
1201343625 Y:12959219-12959241 TGGAAAGAACAATACTCTGAGGG + Intergenic