ID: 902890235

View in Genome Browser
Species Human (GRCh38)
Location 1:19438054-19438076
Sequence TGGGAGGTAAGAACAATACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890235_902890243 0 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890243 1:19438077-19438099 CTACCTCCTACGTCAGGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 76
902890235_902890237 -6 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890235_902890238 -5 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890235_902890247 6 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890247 1:19438083-19438105 CCTACGTCAGGGGAGGGGACCGG 0: 1
1: 0
2: 2
3: 29
4: 309
902890235_902890240 -4 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73
902890235_902890249 14 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890249 1:19438091-19438113 AGGGGAGGGGACCGGGCACATGG 0: 1
1: 0
2: 3
3: 54
4: 578
902890235_902890248 7 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
902890235_902890244 1 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890244 1:19438078-19438100 TACCTCCTACGTCAGGGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 85
902890235_902890250 22 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890250 1:19438099-19438121 GGACCGGGCACATGGTTCCGAGG 0: 1
1: 0
2: 0
3: 0
4: 40
902890235_902890242 -1 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890242 1:19438076-19438098 ACTACCTCCTACGTCAGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890235 Original CRISPR TGGGAGGTAAGAACAATACT TGG (reversed) Intronic
901237972 1:7677728-7677750 TGGACGGTAAGAACAGTGCTTGG + Exonic
901853580 1:12030584-12030606 TGGGCAGTAAGAACAAAACTCGG - Intronic
902890235 1:19438054-19438076 TGGGAGGTAAGAACAATACTTGG - Intronic
905449829 1:38048731-38048753 TGGGAGGTAGGAGGAAGACTGGG + Intergenic
908308156 1:62846657-62846679 AGGGAGGTAAGAATAATCCAAGG - Intronic
911143486 1:94530850-94530872 TTGGAGGTAAGAACAATGGCTGG + Intronic
914793944 1:150903963-150903985 AGGGAGGCAAGCACAAGACTGGG + Intergenic
916400368 1:164441167-164441189 GGGGAGGAAAGAAGAATTCTGGG - Intergenic
917026782 1:170652193-170652215 GGGGAGGTCTGAAAAATACTTGG - Intergenic
918047028 1:180947835-180947857 GGGGAGGGAAGAAAAATGCTAGG - Exonic
918961164 1:191279904-191279926 TGGAAAGAAAGAACAATGCTAGG + Intergenic
919884071 1:201920078-201920100 TGGGTGACAAGAACAAAACTTGG - Intronic
921684552 1:218075040-218075062 ATGGAGGTAATAATAATACTTGG + Intergenic
921991831 1:221375037-221375059 TTGGAGGGAAGAACATTTCTTGG - Intergenic
1067252690 10:44601141-44601163 AGGGAGGTAAGGGCAATACCAGG + Intergenic
1068998406 10:63235471-63235493 TGGGCAGCAAGAACAAAACTTGG + Intronic
1070963222 10:80513540-80513562 TAGGAGGTAAGACCTATACTTGG - Intronic
1071807587 10:89141723-89141745 TGGGAGTTAAAAACACAACTGGG + Intergenic
1072186669 10:93046619-93046641 TGGGTGACAAGAACAAAACTCGG - Intronic
1076082830 10:127599025-127599047 TGAGAGGTGAGAACAACACAGGG + Intergenic
1078568917 11:12440728-12440750 TTGGAGGTAAGAACAGTCCCTGG - Intronic
1080342378 11:31280897-31280919 AGGGAGGCAAGCACAAGACTGGG - Intronic
1080550770 11:33372265-33372287 TGGGAAGAAAGAACAATCTTTGG - Intergenic
1083489620 11:63006477-63006499 TTGGAGGTAAGAACAAGAAAGGG - Intronic
1086746818 11:90439065-90439087 AGGAAGTTAAGCACAATACTGGG + Intergenic
1090367255 11:126217071-126217093 TGGGAGGAAAGCAGAATACCTGG + Intronic
1095284819 12:40397025-40397047 TGGGAACTAAGAAACATACTTGG + Intronic
1098099562 12:66999945-66999967 TGGGAGGGAAGAAGAAAAATTGG - Intergenic
1099977389 12:89560106-89560128 AGGGAGCTAAGAACAATAGAAGG - Intergenic
1100818467 12:98408395-98408417 TAGGAGGTCAGATTAATACTTGG + Intergenic
1101549304 12:105747302-105747324 TGGTAGGCAAGAACCATCCTGGG + Intergenic
1101889398 12:108698951-108698973 TTGGAAATAAGATCAATACTTGG - Intronic
1102747735 12:115264492-115264514 TGTGAGGTGAGAACAAGCCTGGG + Intergenic
1103708011 12:122889696-122889718 TGGGAGACAAGAGCAAAACTCGG + Intronic
1104034428 12:125088640-125088662 TGGGAGGGAAGAAAAAAACTGGG - Intronic
1104377913 12:128281355-128281377 TGGGAGGCAAGATCAAGGCTTGG + Intronic
1105482940 13:20795823-20795845 TGAGAGGTAAGAACAGTGCATGG + Intronic
1105553194 13:21417786-21417808 TCAGAGGTTAGAACAATGCTTGG - Intronic
1106720778 13:32432631-32432653 TGGGATCTCAGACCAATACTTGG + Exonic
1107489158 13:40863818-40863840 AGGGAGGCAAGCACAAGACTGGG - Intergenic
1108191163 13:47940493-47940515 TAGGAGTTAAAAACAATGCTTGG - Intronic
1109751804 13:66703275-66703297 TGAGAGGGAAGGACAATTCTTGG - Intronic
1112636062 13:101219343-101219365 CTGGAGGAATGAACAATACTGGG + Intronic
1115503197 14:34067561-34067583 TAGGAGGTATGAACATTTCTTGG + Intronic
1115569878 14:34656413-34656435 TGGGAGGTGAGATCTTTACTTGG + Intergenic
1117004929 14:51411360-51411382 TGGGAAGTAAGGACAAGACATGG + Intergenic
1117222908 14:53623906-53623928 TTGGAGTTAAGACCAAAACTGGG + Intergenic
1119403825 14:74383002-74383024 TGGGCGACAAGAACAAAACTTGG - Intergenic
1121207920 14:92185029-92185051 TGGGAGGTAGGAATAATGCAAGG - Intergenic
1121609003 14:95262940-95262962 TGGGAGGTAGGAGCAAAACTAGG + Intronic
1124422052 15:29531129-29531151 TCGTAGGTAAGAAGAAAACTGGG - Intronic
1124677451 15:31698027-31698049 TTGGAGGAAGGAACAATGCTTGG - Intronic
1126796858 15:52266603-52266625 TGTGAGATGGGAACAATACTAGG - Intronic
1127434850 15:58947086-58947108 TCAGAGAGAAGAACAATACTAGG + Intronic
1129483425 15:75844825-75844847 AGGGAGTTAAAAACAAGACTTGG - Intronic
1129497439 15:75998561-75998583 TATGAGGTGAGAACAATAATAGG + Intronic
1129604805 15:77019662-77019684 TGGGAGGTGAGAAACAAACTTGG - Intronic
1130579291 15:85121009-85121031 GGAGAGGTAAGAACAATGATTGG + Exonic
1134651108 16:15909555-15909577 TGGTAGGTAAGAACAGTAATTGG + Intergenic
1134784601 16:16930343-16930365 TGGGAGGTCTGAAAAATAGTTGG + Intergenic
1143581800 17:7832016-7832038 TGAGTGGTAGGCACAATACTGGG - Intronic
1144804539 17:17955942-17955964 TGGGAGGAATGAACAATTCCAGG - Intronic
1155832955 18:30541116-30541138 TGGAAGGAAAGAAAAATTCTAGG - Intergenic
1158000141 18:52608824-52608846 TGGGATGTAAAAACCAAACTTGG + Intronic
1159911675 18:74151970-74151992 AGGGTGAGAAGAACAATACTCGG - Intronic
1166096049 19:40539947-40539969 TGGGTGACAAGAACAAAACTTGG - Intronic
1166496862 19:43309522-43309544 TGGGAGGCACGAACTAAACTTGG + Intergenic
1166674029 19:44728332-44728354 TGGGAGGTGAGAACAGGACTGGG - Intergenic
1167751159 19:51380888-51380910 TGGGAGGGAGAAACAATATTTGG + Intronic
928125721 2:28614456-28614478 TGGGAGGGAACTACAATTCTGGG + Intronic
929532014 2:42758701-42758723 AGGGAGAAAAGAAAAATACTGGG - Intergenic
929890145 2:45912129-45912151 GGGGAGAGAAGAACAATACCAGG + Intronic
932044261 2:68331499-68331521 TGGGAGTTAAGGAGAAAACTTGG + Intergenic
932419811 2:71594959-71594981 TGGGAGGTTAGCACAGTGCTAGG - Intronic
933111940 2:78413013-78413035 AGGGAGGCAAGCACAAGACTGGG - Intergenic
933176012 2:79173843-79173865 TGGGAGGTAAGAAGAAAAAGGGG - Intergenic
933775677 2:85769861-85769883 TGGGAGGTAGGAACAAAGCTGGG - Intronic
937552910 2:123116614-123116636 TGGGACGTATAAACAATAATGGG + Intergenic
938208219 2:129441853-129441875 TGGGAGGTAAGATGAGTGCTAGG - Intergenic
945474210 2:210262778-210262800 TGGGAGTTAAGAAAATCACTTGG + Intergenic
947535356 2:230936984-230937006 AGGGAGGTAAGAGGAAAACTAGG - Intronic
1170435871 20:16328145-16328167 TGGGAGGGAAGAAAACGACTAGG - Intronic
1171526635 20:25817892-25817914 AGGGTGGTAAGAACACTCCTGGG - Intronic
1171550192 20:26037993-26038015 AGGGTGGTAAGAACACTCCTGGG + Intergenic
1174099767 20:48118395-48118417 TGGGAGGTAATAAAAGTATTGGG - Intergenic
1177067006 21:16451247-16451269 TGGGAGATGGGAACATTACTAGG - Intergenic
1179042713 21:37818104-37818126 TGGGAAATAAGGACAAGACTGGG - Intronic
1179587985 21:42385891-42385913 GGGGAGGTGAGCACAAAACTAGG + Intronic
1180593675 22:16960491-16960513 TGGGAGCTGAGATCAATACTGGG + Intergenic
1180986947 22:19910536-19910558 TTGGAGGTAATAACAATAACAGG - Intronic
950052192 3:10000861-10000883 AGGGAGGCAAGCACAAGACTAGG - Intronic
952518566 3:34130930-34130952 TTGCAGGGAAGAACAATAGTTGG - Intergenic
954427399 3:50450612-50450634 TTGGAGGCAAGTACAATATTTGG - Intronic
958064636 3:88528096-88528118 TTGGAGGTAAGAAGATTCCTTGG + Intergenic
958677113 3:97279176-97279198 TTGGAGGTAAAAGCAAAACTAGG - Intronic
959027772 3:101260630-101260652 TGGGAGGTAATAACAGGAATTGG - Intronic
961236242 3:125370757-125370779 TGGTAGGAAAAAACTATACTGGG - Intronic
963727654 3:148940044-148940066 TGGGAGGTGAGAATAAGGCTTGG - Intergenic
964942989 3:162184334-162184356 TGGGAGGTAAGAAGACAAATGGG + Intergenic
965068289 3:163881244-163881266 TGGCAGGTATAAACAAAACTAGG - Intergenic
965854040 3:173066349-173066371 TTGCAGACAAGAACAATACTGGG - Intronic
967150215 3:186641376-186641398 TTGGAGGTAAAAACACAACTTGG - Intronic
968767822 4:2483248-2483270 TGGGTGCTAGGAACCATACTGGG + Intronic
979765343 4:124459161-124459183 TGGGAGGAAAGAATATTACAAGG - Intergenic
984688232 4:182695579-182695601 TGGGAGGTAGGAAGATTCCTAGG - Intronic
987502089 5:18725202-18725224 TGTGAGGTAAGTACTATATTAGG - Intergenic
989278646 5:39616888-39616910 TGGCTGGGAAGAACAATTCTTGG + Intergenic
989372095 5:40721306-40721328 TTAGAAGTAAGAACAAAACTAGG + Intronic
990194219 5:53294885-53294907 TGGGTGGTAAGTTCAGTACTGGG - Intergenic
991431426 5:66551801-66551823 TTGGAGAGAAGAACAGTACTAGG + Intergenic
991471765 5:66976418-66976440 TGTGAGCCAAGCACAATACTGGG + Intronic
992967657 5:82019803-82019825 AGGGAGTTGAGAACAATAGTGGG + Intronic
992973593 5:82088285-82088307 TGGGAGATATGAACTATATTAGG + Intronic
994281714 5:97911762-97911784 TAGAAAGTAAGAAAAATACTTGG - Intergenic
995804569 5:116037153-116037175 TGGGAGGCAAGAGCCATGCTGGG - Intronic
996793088 5:127314258-127314280 TGCTAAGTAAGAACAATACCAGG - Intronic
997420341 5:133762083-133762105 TGGGAGGCAAGAACACAACTTGG + Intergenic
997881584 5:137596671-137596693 TGGGAGTGAAGAACAATTCAAGG - Intronic
999295780 5:150458801-150458823 TGGGAGGTAAGATCAAAGGTTGG + Intergenic
1001000240 5:167999196-167999218 TGGGAGGTAAGTACACAACTTGG - Intronic
1002668232 5:180843184-180843206 TGGAAGGTAAGAAGTATTCTAGG + Intergenic
1003909836 6:10733251-10733273 TGGGAGGAAAGAACAACTCTGGG - Intergenic
1006401380 6:33819663-33819685 TGGTGGGTAAGAACAATCCTGGG - Intergenic
1007590857 6:43020257-43020279 TGGGAGTTAAGAGCAAAAATGGG + Intronic
1009707821 6:67277263-67277285 TGGGCGACAAGAACAAGACTTGG + Intergenic
1010689554 6:78892973-78892995 TGGGGGACAAGAAAAATACTTGG + Intronic
1011381068 6:86742716-86742738 TGGAAGGTAAGAACAATGAGTGG - Intergenic
1011736409 6:90314747-90314769 TGGAAGGTAAGAAGAATAGGCGG - Intergenic
1011774666 6:90716457-90716479 TGGGAGGTGAAGAAAATACTGGG - Intergenic
1012240941 6:96871195-96871217 TGAGAGGGAAGAACAATATCTGG - Intergenic
1014930899 6:127334705-127334727 AGGGAGGAAAGAACAATATAGGG - Intronic
1015318792 6:131847788-131847810 TGTGTGTTAACAACAATACTTGG + Exonic
1016076288 6:139800284-139800306 TGTGAGGTGAGAACAAAAATAGG - Intergenic
1016603713 6:145892954-145892976 TGGGAGGGAAGAAAAAAATTGGG + Intronic
1020570718 7:9857803-9857825 AGTGAGATAAAAACAATACTAGG - Intergenic
1021884302 7:25124030-25124052 AGGGAGGCAAGCACAAGACTGGG - Exonic
1023522303 7:41060613-41060635 GGGAAGGTAAGAACAATAGATGG + Intergenic
1023621103 7:42074094-42074116 TGGGGGGCATGAAAAATACTGGG - Intronic
1024620267 7:51151006-51151028 TCAGAGGTCAGAACAATATTGGG - Intronic
1024687355 7:51760640-51760662 TGGAAGGTAACAACTAAACTAGG - Intergenic
1026231331 7:68486474-68486496 TGAGAGGCAAGAACAAGAGTGGG - Intergenic
1026489328 7:70849249-70849271 AGGGATGAAAGTACAATACTGGG - Intergenic
1030247603 7:107401665-107401687 TTAGTGGTAAAAACAATACTGGG + Intronic
1030957368 7:115871447-115871469 TGGGAAGTTAAAATAATACTTGG - Intergenic
1031845893 7:126805699-126805721 TGGGAGACAATAACAAAACTTGG - Intronic
1032509689 7:132462871-132462893 TGGGTGGAAAGAGCAAAACTCGG - Intronic
1033521615 7:142166647-142166669 TGGGAGGCAATAAGAACACTGGG + Intronic
1033834515 7:145293045-145293067 AGGGAGGTAAGATTGATACTTGG - Intergenic
1036796659 8:11760924-11760946 TGGGAGGTGAGGACAAGCCTGGG + Intergenic
1037669383 8:21001223-21001245 TGGGGGGCAAGAATAGTACTAGG + Intergenic
1040755023 8:50762709-50762731 AGGGAGGCAAGCACAAGACTGGG - Intronic
1040776105 8:51044896-51044918 TGAGAGGAAAGTACAACACTTGG - Intergenic
1041659202 8:60384734-60384756 TGGAATGTAATAATAATACTTGG - Intergenic
1042216051 8:66430144-66430166 TGGGAGGCAAGATGAATTCTGGG + Exonic
1048742018 8:137571615-137571637 TGGGATGTAACAACAACAATAGG - Intergenic
1048923683 8:139252328-139252350 TGGGAGGAATGAACAAGAATGGG - Intergenic
1049142597 8:140969584-140969606 TGTGAGGTAAGAAGAAAACCAGG - Intronic
1052774427 9:32719384-32719406 TGGGGGATAAGAACAATAGAAGG - Intergenic
1055027350 9:71736301-71736323 GGGAAGGTATGAACAATACCAGG - Intronic
1060463814 9:123884500-123884522 TGGGAGGCAAAAAAAATGCTTGG - Intronic
1060721338 9:125981385-125981407 TGGGAGGTAAGAAAGATAGGAGG - Intergenic
1186177617 X:6941661-6941683 TGGAAAATAAGAACAAAACTTGG + Intergenic
1186937381 X:14464939-14464961 TGGGAAAAAAGAACAAAACTGGG - Intergenic
1190414251 X:50165995-50166017 GCTGAGGGAAGAACAATACTTGG - Intergenic
1190911246 X:54774562-54774584 AGGGAGGTTAAAACAATACTTGG - Intronic
1190919970 X:54841648-54841670 AGGGAGGTTAAAACAATACTTGG + Intergenic
1194489390 X:94527756-94527778 TGGTAGGAAAAAAAAATACTGGG - Intergenic
1198797788 X:140417315-140417337 TGGAAGGTAAGAACAAGAATAGG - Intergenic
1198867080 X:141134779-141134801 TTGGTGGTAAGAAAAATATTGGG + Intergenic
1199222329 X:145331750-145331772 TGAGAGGTCAGAACTATACAGGG - Intergenic
1200130524 X:153841318-153841340 AGGGAGGCAAGCACAAGACTGGG + Intergenic
1200309711 X:155065704-155065726 TGGGAGGTAAGAAGGTGACTTGG + Exonic
1202152318 Y:21854950-21854972 TGGGAGGTAAGACCAAGACCAGG - Intergenic
1202271209 Y:23076351-23076373 TGGGAGGTGAGAACACAGCTGGG - Intergenic
1202294817 Y:23344331-23344353 TGGGAGGTGAGAACACAGCTGGG + Intergenic
1202424204 Y:24710095-24710117 TGGGAGGTGAGAACACAGCTGGG - Intergenic
1202446585 Y:24959990-24960012 TGGGAGGTGAGAACACAGCTGGG + Intergenic