HTGT WGE

Individual CRISPR Summary

ID: 902890237

 View in Genome Browser
Species Human (GRCh38)
Location 1:19438071-19438093
Sequence CTCCCACTACCTCCTACGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890230_902890237 17 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890235_902890237 -6 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890234_902890237 -2 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890233_902890237 2 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890229_902890237 26 Left 902890229 1:19438022-19438044 CCAGTAGTGCCCCAGACGAGGAA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890232_902890237 15 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890231_902890237 16 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890237 Original CRISPR CTCCCACTACCTCCTACGTC AGG Intronic