ID: 902890237

View in Genome Browser
Species Human (GRCh38)
Location 1:19438071-19438093
Sequence CTCCCACTACCTCCTACGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890234_902890237 -2 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890235_902890237 -6 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890230_902890237 17 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890232_902890237 15 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890233_902890237 2 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890229_902890237 26 Left 902890229 1:19438022-19438044 CCAGTAGTGCCCCAGACGAGGAA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84
902890231_902890237 16 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890237 Original CRISPR CTCCCACTACCTCCTACGTC AGG Intronic
900369209 1:2323968-2323990 CACCCACTGCCACCTACCTCTGG + Intronic
902043704 1:13510275-13510297 CTCCCAGTACCTCCTCCGTGAGG - Intronic
902890237 1:19438071-19438093 CTCCCACTACCTCCTACGTCAGG + Intronic
903441966 1:23394923-23394945 CTCCCACTCCCTCCACCCTCTGG + Intronic
903700873 1:25247423-25247445 CAACCTCCACCTCCTACGTCCGG + Exonic
904608921 1:31714704-31714726 CCCCCACCACCTCCCACCTCGGG - Intergenic
906566315 1:46803693-46803715 CTCCCATGACCTGCTACATCTGG + Intronic
908128797 1:61054253-61054275 CTCCCGAGACCTCCTGCGTCCGG - Intronic
909039839 1:70635977-70635999 CTCCTTCTGCCTCCTACATCAGG - Intergenic
909590820 1:77347051-77347073 CTCCCACTAATTCCTATTTCTGG + Intronic
911302677 1:96193740-96193762 CTCCCACTTCTTCCTGCTTCTGG + Intergenic
912809055 1:112780051-112780073 CTCCCACTACCCCCAACATCTGG + Intergenic
916442619 1:164842324-164842346 CTCCCTCTACCTCCTCAGACAGG + Intronic
921715212 1:218410849-218410871 TTCCCTCTACCTCATACTTCTGG - Intronic
1072684815 10:97529899-97529921 CTCACACTGCCTCCTCTGTCTGG + Intronic
1074420790 10:113307303-113307325 CTCCCCCACCCTCCTACATCTGG + Intergenic
1081483793 11:43512173-43512195 CTCCCAGTACCTCCAAGGCCAGG + Intergenic
1081637079 11:44727911-44727933 CTCCCACTGCCCCCTAAATCTGG - Intronic
1082004872 11:47413947-47413969 CTTCCTCTACCTCCTCCCTCTGG + Intronic
1084774969 11:71369104-71369126 CCCCCACTGCCTCAGACGTCAGG - Intergenic
1084857498 11:71998298-71998320 CTCCCCCTACCTCCTGCCCCAGG - Intergenic
1085053191 11:73390188-73390210 CCCCCACTTCCTCCTACTTTGGG - Intronic
1085930735 11:81080054-81080076 CACCCTCTACCTCCTCCCTCTGG + Intergenic
1086722166 11:90134481-90134503 CTCCCGCCACCTACTATGTCCGG + Intronic
1096103221 12:48981778-48981800 CTCCCACTTCCTCCTACCTGGGG + Intergenic
1102196455 12:111028871-111028893 CTCCCTCTTCCTCCTGCTTCAGG - Intergenic
1102606783 12:114073911-114073933 CCCCCACCACCTCCCACATCAGG + Intergenic
1103821044 12:123699080-123699102 CTCTAACTACCTCCTAAGTTTGG + Intronic
1104464005 12:128975938-128975960 CTCCCAGTAGCTCCTGCATCGGG - Intronic
1104662322 12:130620294-130620316 CTCCCACTCCCTCCCACCCCAGG + Intronic
1105503910 13:20993751-20993773 CTCCCACCACCGCCTACTTCGGG + Intronic
1109726648 13:66349691-66349713 CTCTCACTACCCCCTAAGCCAGG - Intronic
1111206717 13:85020437-85020459 TTCCCACTCCCTCCTCCTTCTGG + Intergenic
1114149806 14:20025315-20025337 CTCCAACTACCCCCAACCTCTGG + Intergenic
1116360465 14:43989475-43989497 CTGCCACTCCCTCCTAGGTAAGG + Intergenic
1120687614 14:87556229-87556251 CTCCCTCAACCCCCTACCTCTGG - Intergenic
1121438496 14:93934221-93934243 CTCCCCCTACCCCCTACCTTGGG + Exonic
1122131891 14:99609060-99609082 CACCCACTTCCTCCTGCTTCAGG + Intergenic
1130150918 15:81310917-81310939 CTCCCAGTACCTCCTGTCTCTGG + Exonic
1130656640 15:85795870-85795892 CTCCCACCTCCACCTCCGTCAGG - Intergenic
1131861087 15:96653793-96653815 CCTCCACTACCTCCTTCATCTGG - Intergenic
1132464915 16:72822-72844 CTCCCACCAGGTCCTCCGTCGGG - Intronic
1133433147 16:5756074-5756096 CTCCCAGTGCCTTCTAAGTCAGG + Intergenic
1137478732 16:48833446-48833468 CTCACACTGCCTCCCACGTGGGG + Intergenic
1139674128 16:68511284-68511306 CTCCAAGTACCTCCAAGGTCTGG - Intergenic
1143165419 17:4895049-4895071 CTCCCACCTCCTCCTCCTTCTGG + Intronic
1150069118 17:62137557-62137579 CTCCCACTATCTCGTACGCCAGG - Intergenic
1155939878 18:31792419-31792441 CTCCCACTCCGTCCTACCTCAGG + Intergenic
1160085939 18:75777815-75777837 CTCCAGCCACCTCCTACTTCGGG + Intergenic
1160726304 19:619257-619279 CTCTCACTATCTCGTACGCCAGG - Exonic
1161295632 19:3518933-3518955 CTCCCACTACCTCCTCTGGTAGG + Intronic
1163219282 19:15902906-15902928 CTCCCACTACCTCGTACGCCAGG - Intergenic
1163935054 19:20434981-20435003 CTCCCACCACTTCCTTCATCAGG - Intergenic
1165819418 19:38665174-38665196 CTTTCACTACCTCCTAGTTCTGG - Intronic
925958403 2:8992651-8992673 CTTCCACTAACACCTAAGTCTGG + Intronic
929937935 2:46308151-46308173 CTCACACTAGCTCCTCCATCTGG + Intronic
931258845 2:60599237-60599259 CTCCCACCACCTCCCAGATCGGG + Intergenic
939490777 2:142874006-142874028 CTCCCTCTCCCTCCTACAACAGG - Intergenic
946068996 2:217014996-217015018 CTCCTACTGCCTCCCATGTCTGG - Intergenic
948898382 2:240940948-240940970 CTCCCAAAACCTCCTAGATCTGG + Intronic
1170098182 20:12669915-12669937 CTCTCTCTACCTCCTCCGTTGGG + Intergenic
1174549402 20:51351061-51351083 CTCCCTCTTCCTCCTTCCTCAGG + Intergenic
1174642965 20:52061169-52061191 CTCCCACTTCCTCCAGCGCCTGG - Intronic
1178512015 21:33213275-33213297 CTCCCACTGCCTCCTAGTCCAGG + Intergenic
1181329037 22:22074981-22075003 CACCCACTTCCTCCCAGGTCTGG + Intergenic
1182120255 22:27781812-27781834 CTCCCACTATCTCCTGGGGCAGG + Intronic
1183832475 22:40425701-40425723 CCCCCACAATCTCCTACTTCCGG + Intronic
949688807 3:6610330-6610352 CTCCCACTATCTCTTAAGTCAGG - Intergenic
957720805 3:83995838-83995860 CTCCCACTAGGTCCCACCTCCGG + Intergenic
961203180 3:125060470-125060492 ATCCCACTTCCTCCTGCCTCAGG - Intergenic
962499291 3:135973498-135973520 CTCCAACTACCTCTTGCATCTGG - Intronic
968833340 4:2944933-2944955 CTCCCACTCCCACCCACATCTGG + Intronic
971480432 4:27109736-27109758 CTCCCCCAACCTCCAACGTGAGG + Intergenic
972199200 4:36693078-36693100 CACCCACTCCCTCCTCCTTCTGG + Intergenic
991230513 5:64328020-64328042 CTCCCTCTTCCTCCTCCTTCTGG - Intronic
996575600 5:124973850-124973872 TTCCCCCTACCGCCTAAGTCAGG + Intergenic
1004206712 6:13598261-13598283 CTTTCACTCCCTCCTACCTCAGG - Intronic
1004340002 6:14799611-14799633 CTCCCACTACCTCCTCCTCCTGG + Intergenic
1004407178 6:15343988-15344010 CTCCCACTAACTCTCAGGTCCGG - Intronic
1005969288 6:30748887-30748909 TTGCCACTACCTCCCACATCTGG + Intergenic
1008445550 6:51585952-51585974 CTCCCACTACCTCCAACCTCTGG + Intergenic
1008459631 6:51753248-51753270 CTCCCCCTACATGATACGTCAGG + Exonic
1015446339 6:133309870-133309892 TCCCCACTACCTTCTTCGTCAGG - Intronic
1017757725 6:157543796-157543818 CTCCCCCTCCTTCCTACCTCAGG - Intronic
1018847513 6:167565956-167565978 CTCCCACACCCTCCTAGCTCAGG + Intergenic
1019801745 7:3092809-3092831 CTCTCACCACCTCCTACATCCGG - Intergenic
1031467969 7:122136868-122136890 CTCCCACCACCTTCTTTGTCTGG + Intronic
1031530524 7:122870453-122870475 CTCCCACTCCCTCCAGCCTCTGG - Intronic
1039196300 8:35035270-35035292 CTCCCATTACATCCTCCTTCAGG + Intergenic
1039309349 8:36298710-36298732 CTCCCACTAGGCCCTACCTCTGG + Intergenic
1045377911 8:101593593-101593615 CCCACTCAACCTCCTACGTCTGG - Intronic
1047422198 8:124716504-124716526 CTCCCACTTCCACCTACTCCTGG + Intronic
1051387126 9:16521272-16521294 CTCCCTCTACCTCCCCTGTCTGG + Intronic
1057459472 9:95246694-95246716 CTCCCAGCAGCTCCTACCTCAGG + Intronic
1060016320 9:120089477-120089499 CTCCCACTACCTCCTCGCTATGG + Intergenic
1196758876 X:119181828-119181850 CTCCCAACACCTCTTACCTCAGG + Intergenic