ID: 902890238

View in Genome Browser
Species Human (GRCh38)
Location 1:19438072-19438094
Sequence TCCCACTACCTCCTACGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890234_902890238 -1 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890229_902890238 27 Left 902890229 1:19438022-19438044 CCAGTAGTGCCCCAGACGAGGAA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890235_902890238 -5 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890231_902890238 17 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890230_902890238 18 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890233_902890238 3 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
902890232_902890238 16 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890238 Original CRISPR TCCCACTACCTCCTACGTCA GGG Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
904917916 1:33983673-33983695 TCCTACTACCTCTGAGGTCAGGG + Intronic
909703644 1:78554388-78554410 TCCCACTAGCTCCCAAGTAATGG + Intergenic
914916148 1:151820349-151820371 TCCCACCACCTGCTGCTTCAGGG - Intronic
923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG + Intergenic
1066546184 10:36503034-36503056 TCCTCCTTCCTCCTAAGTCAAGG + Intergenic
1071049057 10:81423585-81423607 TCCCACTAGCTCTAACTTCAAGG - Intergenic
1071863170 10:89697085-89697107 TCCCATTACCTCCTTAGTGAAGG - Intergenic
1073881071 10:107980683-107980705 TCCCCCTACCTCCTTCTTCCTGG + Intergenic
1077306132 11:1869432-1869454 TCCCCCTCCCTCCTCCTTCAAGG - Intronic
1081483794 11:43512174-43512196 TCCCAGTACCTCCAAGGCCAGGG + Intergenic
1084697751 11:70765941-70765963 TCACAGTACCTCCTAGGTAATGG - Intronic
1084857497 11:71998297-71998319 TCCCCCTACCTCCTGCCCCAGGG - Intergenic
1121251348 14:92501913-92501935 TGTCACTAGCTCTTACGTCATGG + Intergenic
1123439907 15:20282622-20282644 TCCCTGTTCCTCCTACGTCGAGG - Intergenic
1124343461 15:28904842-28904864 TCCCACTGCCTCGTGTGTCATGG - Intronic
1130656639 15:85795869-85795891 TCCCACCTCCACCTCCGTCAGGG - Intergenic
1143405809 17:6676615-6676637 TCTCACTAACTCCAGCGTCAGGG - Intergenic
1148382480 17:47209905-47209927 TCCCACTACCTCCTAGGAAAAGG - Intronic
1151869869 17:76829203-76829225 CCCCACTTCCTCCTGCCTCAGGG + Intergenic
1158411209 18:57207650-57207672 TCCCACAACATCCAACATCAGGG - Intergenic
1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG + Intronic
1164537957 19:29100441-29100463 TCCCCCTACCTCCTACCTGAAGG + Intergenic
1166368664 19:42289981-42290003 TCACACTCCCTCCTAAGCCATGG + Intronic
1166371259 19:42302490-42302512 TCCACCTACCTCCTAAGTGAAGG - Exonic
926353810 2:12021640-12021662 TCCCACCACACCCTACGACAGGG - Intergenic
926938619 2:18112741-18112763 TCCTACTACCTCCTTCACCATGG + Intronic
928281319 2:29948865-29948887 TCCCACTAACTGAAACGTCATGG + Intergenic
938983102 2:136545309-136545331 ACCCACTCCCTTCTACTTCAGGG + Intergenic
939490776 2:142874005-142874027 TCCCTCTCCCTCCTACAACAGGG - Intergenic
941847501 2:170148179-170148201 TCCCACTACTGCCTATATCAGGG + Intergenic
941893922 2:170610620-170610642 TCCCACTACATCCTGCTTGATGG + Intronic
944441369 2:199746907-199746929 TCCCACTACCTTAAACGTCTTGG + Intergenic
1178512016 21:33213276-33213298 TCCCACTGCCTCCTAGTCCAGGG + Intergenic
1182120256 22:27781813-27781835 TCCCACTATCTCCTGGGGCAGGG + Intronic
1182239497 22:28903747-28903769 TTCCACTCCTTCCTACGTCAAGG + Intronic
951864231 3:27289361-27289383 TGCCACTACCTCCTCCTTTAAGG + Intronic
961696808 3:128710941-128710963 TCCCACTGCCTCTTACATCTAGG + Intergenic
967350635 3:188510565-188510587 GCCCACTCTCTCCTTCGTCATGG + Intronic
972232295 4:37088394-37088416 TCCCACTACTACCTACATAAGGG - Intergenic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
976817655 4:89168164-89168186 TACCAATACCTCCTACAGCATGG - Intergenic
984921071 4:184765001-184765023 TCTCACTAACTCCCAAGTCATGG + Intronic
995154392 5:108893501-108893523 TCCCAAGACCTCCTACTTCTAGG - Intronic
995596593 5:113754025-113754047 TCCCACTACTTTGTATGTCAGGG + Intergenic
1001763689 5:174227852-174227874 TCCCACTCCTTCCTCCGGCAGGG - Intronic
1004206711 6:13598260-13598282 TTTCACTCCCTCCTACCTCAGGG - Intronic
1005173453 6:23015052-23015074 TTCCACTTCCTCCTATGACATGG - Intergenic
1005775675 6:29129306-29129328 TCCCACTGCAGCCAACGTCATGG - Intergenic
1011153076 6:84297245-84297267 TACCACAACCTCCTACCTGAAGG - Intergenic
1013395862 6:109738924-109738946 TCCCACTATATCCTACCTCCTGG - Intronic
1015935539 6:138403855-138403877 TCCCACCACCTCCTCCGCAAGGG + Intronic
1018735720 6:166685935-166685957 TCCCCCTCCCTCCTAGGGCATGG - Intronic
1018847514 6:167565957-167565979 TCCCACACCCTCCTAGCTCAGGG + Intergenic
1024374904 7:48626234-48626256 TCCTCCTAACTCCTACCTCATGG - Intronic
1037462976 8:19131695-19131717 TCACACTATCTGCTATGTCAAGG + Intergenic
1050737741 9:8783618-8783640 ACACACTACCTCATACCTCAAGG + Intronic
1185639018 X:1576212-1576234 ACCCTCCACCTCCTACCTCAAGG + Intergenic
1197151100 X:123220758-123220780 TGACACTACTTCCTACTTCATGG + Intronic