ID: 902890240

View in Genome Browser
Species Human (GRCh38)
Location 1:19438073-19438095
Sequence CCCACTACCTCCTACGTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 73}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890233_902890240 4 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73
902890232_902890240 17 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73
902890234_902890240 0 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73
902890235_902890240 -4 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73
902890230_902890240 19 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73
902890229_902890240 28 Left 902890229 1:19438022-19438044 CCAGTAGTGCCCCAGACGAGGAA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73
902890231_902890240 18 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890240 1:19438073-19438095 CCCACTACCTCCTACGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890240 Original CRISPR CCCACTACCTCCTACGTCAG GGG Intronic